chapter
stringlengths 1.97k
1.53M
| path
stringlengths 47
241
|
|---|---|
Learning objectives
By the end of this lesson you will be able to:
• Understand primary and secondary growth of trees.
• Explore the factors that affect the rate of tree growth.
Introduction
Long-lived trees like bristlecone pines can live more than 5,000 years! Understanding how trees grow can unlock a record of the environment a tree has experienced through its lifetime, and provide a record of the climate conditions during that period. In this exercise you will compare how trees grow in height (primary growth) and diameter (secondary growth).
Please watch this short video for a brief review of the two growth types: Growth of Woody Plants Animation.
A longer and more detailed video on secondary tree growth can be found here: How Trees Grow
You can also review the previous lessons on apical meristem growth. As you review the lessons and videos, think about the environmental and genetic factors that affect the rate of secondary growth of trees.
The study of tree rings is called “dendrochronology,” — the science of determining environmental change using annual growth rings in trees. Here’s a short video on Dendrochronology (Tree Ring Dating).
Here’s another optional video on the nitty gritty of collecting a tree ring “Dendrochronology: How to Core a Tree.”
The photograph below shows a grafted kiwi vine. Notice the bright green vascular cambium on the outside edge of the cut branch, just below the brown bark. These are the actively growing cells, where cell division and production of xylem and phloem in each growing season are produced. This fast growth often causes the bark to “slip” as it is expanding and making room for the new growth under it. During the summer, you may take a young branch and easily peel the bark away from wood below. You will notice that it is quite wet. This time of year is generally good for propagation techniques like grafting, especially T-budding (you will learn this method later) because the plant tissues used are at the right stage of growth. Plant propagators take advantage of these natural processes for the best results.
Below the cambium, working to the center of the tree, is the sap wood. Sap wood is still functional for moving water from the roots. You can identify it because of its color, and it may be noticeably wet. The next layer inside is the heart wood. This is what is typically used in lumber. The wood is functioning to support the tree, but it no longer has the capacity to move water.
Review questions
• What causes the altering dark and light rings?
• Explain why you would, or would not, see these rings in a palm tree. Hint: palms are monocots.
• In your own words, describe how tree rings can help us understand climate over long periods of time.
• Where is the phloem in each of the images above? What does it do?
6.03: Terms
Chapter 6 flashcards
Callus Growing mass of unorganized parenchyma cells produced in response to wounding.
Casparian strip A band-like deposit of waterproof suberin that wraps around each cell in the endodermis and forces water to move through the cells rather than the intercellular spaces.
Cell membrane Made up of layers of protein and lipid (fats and oils are examples of lipids) and semi-permeable, meaning that it allows select compounds in and out, but blocks other types of compounds.
Cell wall Rigid membrane that contains cellulose (a carbohydrate that is indigestible for humans) and is the outer covering of the cell.
Chloroplast Organelle that contains chlorophyll where light energy is captured and where the first steps are taken in the chemical pathway that converts the energy in light into forms of energy that the plant can transport and store, like sugar and starch.
Chromoplasts Cellular organelles that contain types and colors of pigments other than the chlorophyll found in chloroplasts.
Collenchyma Elongated cell type with thicker walls; usually arranged in strands; provides support.
Companion cells Associated with sieve tube members (direct the metabolism) and containing a nucleus (alive).
Cytoplasm Fluid inside the cell membrane in which the organelles and other plant cell parts are suspended.
Dermal tissue Tissue on the outside of the plant; provides protection for the plant cells it surrounds.
Endodermis Innermost cells of the cortex.
Epidermis Outermost layer of cells in the plant.
Ground meristem New, primarily parenchyma, cells lying between the protoderm and procambium that will mature to become the cortex tissue.
Mesophyll Site of most photosynthesis reactions in the leaf; located in the middle layer of the leaf.
Middle lamella Material containing pectin that forms between cells and that cements the cell wall of one cell to the cell wall of an adjacent cell.
Mitochondria Organelle where stored sugars are metabolized to produce forms of energy that the plant can use for growth; the cell’s power plant.
Nucleus Organelle that contains the chromosomes. Chromosomes contain the genetic code that is carried within each cell and that directs which chemical reactions are turned on and off in the cell.
Organelle Generic term for a plant organ.
Palisade mesophyll Densely packed, columnar-shaped, elongated cells full of chloroplasts. Analogous to cortex parenchyma cells in the stem, but in the leaf are specialized for light energy capture.
Parenchyma Cell type with thin cell walls; unspecialized, but carries on photosynthesis and cellular respiration and can store food; forms the bulk of the plant body.
Pericycle Single layer of tightly packed cells located in the vascular cylinder that retain the ability to divide and produce new cells; source of lateral roots.
Sclerenchyma Cell type with thickened, rigid, secondary walls that are hardened with lignin; provides support for the plant.
Sieve tube members Elongated cells that join end to end to form tubes for passage of liquids. The end walls have pores. Unlike xylem cells, these cells are still alive. They have a thin cell membrane containing a layer of living protoplasm that hugs the wall of the cell.
Spongy mesophyll Loosely packed cells with large air spaces between the cells, allowing movement and exchange of gases, specifically oxygen, carbon dioxide, and water vapor. Also contain chloroplasts.
Tissue Group of cells that share a function.
Tracheids Elongated and narrower than vessels, connected by overlapping at their ends, dead at maturity, and containing pits through which water can move.
Vacuole Organelle containing various fluids including stored chemical energy like starch and waste products from the cell. Takes up much of the cell volume and gives shape to the cell.
Vessels Elongated xylem cells that connect end to end to form tubes, are dead at maturity, and have perforated end walls so water can move freely through the holes and flow from cell to cell. Vessels have a relatively large diameter compared to other xylem cells and allow greater movement of water. | textbooks/bio/Botany/The_Science_of_Plants_-_Understanding_Plants_and_How_They_Grow_(Michaels_et_al.)/06%3A_Cells_Tissues_and_Woody_Growth/6.02%3A_Woody_Growth.txt |
Learning objectives
• Understand the meristems of primary and secondary growth and the specialized tissues they produce.
• Understand flower morphology and how sexual reproduction via pollination occurs.
Plants have meristematic cells that are not differentiated, but that are destined to divide and produce other cells that may also divide, elongate, and differentiate into specialized cells and tissues. This process is called growth. A highly specialized structure produced after the transition from a vegetative meristem to a reproductive meristem is called a flower. Floral organs are arranged in concentric circles or whorls and are the site of sexual reproduction.
Thumbnail: Cross section of trunk. Dpaczesniak. CC BY-SA 4.0.
07: Meristems and Flowers
Learning objectives
By the end of this lesson you will be able to:
• Differentiate between primary growth from apical meristems and secondary growth from lateral meristems.
• Describe two types of lateral meristems and the types of tissues that are derived from these meristems.
Primary growth from meristems
You’ll recall that the apical meristem is the site of cell division and new cell production at the tips of the plant stems and roots. The cells that make up the meristem are undergoing mitotic cell division to produce more cells. These new cells result in growth and development of plant tissues. (If you haven’t previously studied mitosis, you’ll have the opportunity to do so during this class.) For now it is sufficient to know that mitosis is the process of cell division where one plant cell divides into two identical cells.
Above is a micrograph of a coleus shoot tip. You can see the dome of the apical meristem at the very tip of the shoot surrounded by leaf primordia (rudimentary leaves). On the far left and far right are the cells of two growing leaves. You can see a trace of vascular tissue on the left leaf near the “L” of the leaf label. There is another red stained area called the axillary bud, which we’ve studied previously. The axillary bud is another very small shoot tip with a meristematic area. Axillary buds are found at a node and typically occur where a leaf petiole attaches to a stem. The axillary buds in this stage of growth are inactive, but in time may begin active cell division and develop into new branches off of the main stem.
The coleus micrograph is clearly stem tissue because you can see leaves and leaf primordia, so where are the nodes and internodes? The region where the leaves are attached, and where you find the axillary buds, is a node. Above this is the internode, and at the top where you find the leaf primordia is another node.
The root meristem looks very different from the shoot apical meristem. Recall that, unlike branches that develop at nodes, lateral roots are formed adventitiously, as the result of meristematic activity in the pericycle cells of the root’s vascular system in the zone of maturation. We don’t see a node-internode structure like we saw with the coleus shoot tip.
When meristem cells divide, whether in the shoot or the root, one of the two resulting sister cells typically continues to be a meristem cell. The other sister cell divides a few more times and then differentiates into dermal, cortex, or vascular tissue in the stem or root. Meristem cells that remain meristematic are called initials because they continue to divide, producing new cells. The other sister cells that divide once or twice more and then differentiate are called derivative cells. The xylem and phloem tissues that result from differentiation of derivative cells are called primary xylem and primary phloem, where the word “primary” signals that the cells originated from cell divisions of the apical meristem.
To reiterate, young stems and roots have primary xylem and primary phloem that formed as a result of differentiation of derivative cells. Primary xylem and primary phloem cells trace back to an apical meristem.
Earlier you learned the arrangement of the vascular tissues in monocot and dicot stems and roots. Remember that mitotic cell divisions in the apical meristem result in lengthening of the root or shoot through production of new cells plus the elongation of those cells. With a few exceptions, this is the only type of growth — growth that is initiated by cell division in the apical meristem — you’ll find in monocots. Dicots, however, have another type of growth — from a different type of meristem — that results in thickening of the stem.
Review questions
1. If shown a micrograph of an apical meristem, how would you determine whether it is from a root or a shoot?
2. What happens to the initial cell mentioned in the question above? Does it continue to divide?
Secondary growth (thickening): Introducing lateral meristems
Unlike annual herbaceous plants that only survive for one growing season, and whose stem and root cells trace back to cell divisions of the apical meristems, woody plants and shrubs are perennial dicots that have the capacity for secondary growth and can survive from year to year.
Some annual herbaceous dicot plants, like tomatoes, can have secondary growth, but for now let’s consider those the exceptions and focus on perennial dicot woody plants. Secondary growth is the result of activity by a special type of meristem called a lateral meristem. As with apical meristems, lateral meristems are made up of cells that undergo mitotic cell division. Mitosis in lateral meristems results in lateral growth (thickening of the stem or root) and adds to the girth of a plant rather than its length. Remember that length is the outcome of cell division in the apical meristem plus elongation of those cells. Girth or thickening is the result of lateral meristems. We’ll learn about two types of lateral meristems: vascular cambium, and cork cambium.
Vascular cambium
Let’s start with the vascular cambium.
The three drawings on the right show a cross section of a stem for an imaginary woody dicot. The top drawing illustrates the stem early in the first year of growth, and shows the vascular cylinders arranged in a ring around the stem. The phloem is oriented to the outside, the xylem to the inside. A thin layer of parenchyma cells between the xylem and phloem has differentiated into the fascicular cambium (fascicular refers to bundles, in this case, cambium in the vascular bundles). The fascicular cambium is meristematic and can divide to produce new phloem toward the outside and new xylem to the inside. The new xylem and phloem produced by the cambium are called 2o (secondary) xylem and 2o phloem. Recall that the original xylem and phloem that differentiated from the apical meristem’s derivative cells are called the 1o (primary) xylem and 1o phloem.
The middle drawing is of the same stem later in the year. The cortex (cortical) parenchyma cells that lay between the vascular cylinders directly in line with the fascicular cambium begin to differentiate into a type of cambium called interfascicular cambium (cambium between the bundles). This is symbolized by the line connecting the vascular cylinders. This cambium is also meristematic, and produces 2o xylem and 2o phloem.
The cross section on the bottom illustrates the stem in its second or third year of growth, when there is a noticeable buildup of 2o xylem and 2o phloem with remnants of 1o xylem and 1o phloem.
In summary, the vascular cambium is a lateral meristem formed by differentiation of parenchyma cells located between the primary xylem and phloem into fascicular cambium, followed by differentiation of cortical parenchyma between the vascular cylinders into interfascicular cambium. After a few years of secondary growth, fascicular and interfascicular cambium can no longer be distinguished, and it is all simply known as vascular cambium. This layer of cambium runs vertically (assuming that the stem is oriented vertically) and parallel to the surface of the woody stem.
The illustration below shows how the cambium divides to produce 2o xylem and 2o phloem, with the outside of the stem toward the top of the page. Frame #1 shows a single cambium cell (C). This cell divides mitotically (M) to form two cambium daughter cells (Frame #2). Frame #3 shows that the cambium cell on the top differentiates (D) into a phloem cell (P-toward the outside) and the other cambium cell divides mitotically (M).
This type of cell division, in which new cells are formed either to the outside or inside, and the cell wall that separates the two new cells is parallel to the outside of the stem, is called periclinal division. Periclinal division by the cambium makes new cells that add girth to the plant. The cells that are added subsequently differentiate into xylem and phloem depending on their location to the outside or inside of the cambium. The meristem needs to divide periclinally to add girth to the plant stem.
In Frame #4, pay particular attention to a different type of cell division, where the cambium cell has divided so that the wall between the two cells is perpendicular to the outside of the stem. This is called anticlinal division. The meristem occasionally needs to divide anticlinally because as the stem is growing in girth, the diameter of the ring of vascular cambium must expand to keep up, or it will split into pieces and no longer form a continuous ring around the stem. Frame #4 also shows that the cambium cell to the inside has differentiated into xylem (X). In Frame #5, the two cambial cells that formed from anticlinal division now each divide periclinally.
Review questions
1. How might you recognize a plant that has secondary growth?
2. In a perennial woody dicot, how do the discrete vascular bundles found in the new seedling stem become continuous rings of xylem and phloem in the three-year-old woody stem?
3. Explain what is happening in Frames #6 and #7 in the drawing above. Note that there are two important changes: differentiation and anticlinal division.
Cork cambium
Let’s look at the second type of lateral meristem, cork cambium. Cork (called “phellem” in this image) provides a protective covering around the expanding trunk of the woody plant.
Cork develops in plants with secondary growth after the initiation of secondary xylem and phloem and the expansion of the stem and root’s girth. Cortex parenchyma cells next to the epidermis of the young stem differentiate into the cork cambium (also called phellogen), which is meristematic. The cork cambium lays down some new cells toward the inside called phelloderm, but lays down most of its new cells to the outside, and these derivatives of the cork cambium differentiate into the cork cells. The cork cells are lined with a waxy substance called suberin (we first saw this substance in conjunction with the Casparian strip around endodermis cells) that make the cells impermeable to water and gases. Breaks in the cork cells, called lenticels, allow gas and water exchange. You can see these lenticels in corks from wine bottles (wine corks are made from the thick cork of the Cork Oak, Quercus suber). Cork cells die when they mature. These cells replace the protective function provided by epidermis in young roots and stems. Cork cambium and its derivatives (phelloderm and cork) are called the periderm.
Botanically speaking, the word pb_glossary id=”1215″]”bark”[/pb_glossary] refers to all of the tissues exterior of the vascular cambium. So bark includes:
• Primary and secondary phloem
• Phelloderm if present
• Cork cambium
• Cork
Look again at the list above and note that the phloem is part of the bark. This is often overlooked!
This illustration summarizes the layers introduced above, but omits the phelloderm. If you were to add a label for the phelloderm, where would it be? In mature trunks the phelloderm is quite a thin layer in the bark though, particularly relative to the cork layer, so that is probably why it is absent in this illustration.
If you peel bark from a living tree, you are exposing the surface of the vascular cambium of the tree, and on the inside of the bark will be the phloem. Peeling off bark will kill the plant because you are removing phloem, which disrupts the ability of the plant to move sugars through the trunk of the tree, exposes the tree to moisture loss and predator invasion, and kills the vascular cambium through desiccation. Killing the vascular cambium halts production of new xylem which will subsequently interfere with water transpiration up the stem. This is what happens when rodents girdle the trunks of young fruit trees (left) just below the snow line as they feed on the tender tissues over winter.
A tree’s annual rings are found in the secondary xylem. In the spring, the newly produced xylem cells have thin walls and are large in diameter so they can accommodate the abundance of soil moisture that is typical of April and May.
As the growing season progresses and soil moisture levels are depleted, the cell walls of newly produced xylem are thicker and the diameter of the xylem cells diminishes. In the next spring, the newly produced xylem cells are once again thin-walled and large. The distinct contrast between the small-celled late summer wood from the previous year and the large-celled spring wood from the following year is noticeable, and this line of demarcation between late summer and spring xylem is called the annual ring. In the image to the right you can see the darker xylem, called heartwood, and the lighter xylem, called sapwood. Heartwood is older xylem that is clogged with resins that darken the cells and limit their ability to transport water. Sapwood is younger, resin-free, and still functioning to conduct water up the trunk.
There isn’t nearly as much phloem as xylem in a woody plant. Phloem isn’t produced as rapidly as xylem, and is crushed between the vascular and cork cambium layers, so we don’t see annual rings in phloem.
Review questions
1. Describe the origin of annual rings. If a woody dicot is growing in a tropical climate where the weather is the same day in and day out, will you find annual rings in the wood?
2. What is the most exterior cell layer in an herbaceous stem called? What is the most exterior layer of cells in a five-year-old woody perennial plant stem called.
3. If some kids in your neighborhood get hold of a little hatchet and chop off thin slices of bark all the way around the base of one of your trees, what will happen to the tree? Why?
What about roots?
Roots of woody perennial dicots also have vascular and cork cambium. The vascular cambium arises from parenchyma cells lying between the xylem and phloem in roots, just as in stems. The illustration below shows the initiation of the vascular cambium in a young root. It looks like a trace of white between the primary xylem in the middle and the primary phloem in each of the four lobes of the vascular cylinder. With age, the cambium encircles the root and produces (secondary) xylem to the inside, and (secondary) phloem to outside, again just as in stems. Older roots with secondary growth also have a periderm similar to that found in the stem that replaces the function of the epidermis. If you’ve ever tried to dig in the soil surrounding a mature tree, you know that roots are as tough and woody as the branches above ground.
Here is a diagram to help you visualize lateral meristems including cell division.
The next diagram shows a vascular bundle as it grows by dividing both periclinally and anticlinally.
Ross Koning at Eastern Connecticut State University has a helpful site regarding secondary plant growth (optional reading) with descriptions and images that explain secondary growth in the stem vascular column, in the stem dermal tissues, and in the roots. L. Rost from U.C.-Davis has this nice explanation of secondary growth in roots (more optional reading). | textbooks/bio/Botany/The_Science_of_Plants_-_Understanding_Plants_and_How_They_Grow_(Michaels_et_al.)/07%3A_Meristems_and_Flowers/7.01%3A_Meristem_Morphology.txt |
Learning objectives
By the end of this lesson you will be able to:
• Identify the parts of a flower.
• Describe how the whorls of floral parts are related to leaves emerging from nodes on a stem.
• Describe ways in which flower structure affects pollination.
General introduction to flower parts
The angiosperm flower is built upon a structural foundation consisting of a compressed stem with four nodes and three internodes. For a visual image of these compressed nodes, imagine pushing down on a telescoping radio antenna so that the antenna sections slide down into each other. At the very top of the fully compressed antenna you’ll still see the tips of each of the sections of the antenna, and this resembles the highly compressed nodes and internodes of a stem. The region of the stem containing these four compressed nodes is called the receptacle.
We have seen other examples of compressed stems with very short internodes, including the basal plate of the onion. In each of these cases we find leaves attached to these tightly compressed nodes. In the onion, the leaves are modified for water and nutrient storage as bulb scales. In the dandelion, the leaves are unmodified, but are arranged in a low-growing rosette. The flower is another example of a very compact stem with four nodes and three internodes. The leaves on this stem are highly modified to serve a reproductive function. They are so highly modified that, except for the structures at the fourth node, the parts don’t resemble leaves at all.
Complete the flower parts tutorial (strongly recommended) from the science department of John Burroughs School in St. Louis; it will introduce you to, or help you review, the parts of a flower using a graphic like the one shown here.
In #8 in the tutorial the author calls the structure the carpel and notes that pistil is an archaic term. You can use either carpel or pistil in this course, but we’ll usually say carpel. Pistil is sometimes still for the structure if it is composed of two or more fused carpels.
After completing the tutorial you know that the flower is actually a shortened branch containing a stem with four very compact nodes. This short stem is called the receptacle. From the nodes on the receptacle emerge four different kinds of modified leaves that collectively have these names:
• Calyx: the fourth node, at the base of the receptacle, individually called sepals; these are the parts that still bear some resemblance to leaves
• Corolla: the third node, individually called petals
• Androecium (Greek derivation meaning “men’s house”): the second node
• Gynoecium (Greek derivation meaning “women’s house”): the first node at the tip of the receptacle
For clarity, instead of using a number to refer to a particular receptacle node, we’ll use the name of the modified leaves attached to that node. For instance, we’ll call the fourth node where the calyx is attached the “calyx node,” the third node where the corolla is attached the “corolla node,” and so on.
We’ve noted that the calyx, corolla, androecium, and gynoecium are modified leaves. This may be surprising because, in particular, the androecium and gynoecium are highly specialized for sexual reproduction.
The nodes where these modified leaves are attached are often called whorls since usually two or more of these modified leaves are attached radially around the node. Monocots generally have three modified leaves attached at each node, while dicots usually have four or five attached at each node. One interesting feature of the strawberry flower shown above is the enlarged gynoecium node of the receptacle that is covered by carpels. The receptacle will become the red culinary “fruit,” while the actual botanical fruits will be the achenes (you’ve considered them seeds, but they are a type of fruit) embedded into the outer surface of the receptacle.
Watch the next two videos to learn more about flower parts and about the specialized florets of an Asteraceae flower.
Watch this video on flower structure.
Watch this video to explore the structures of an Asteraceae flower.
Review questions
1. What is the receptacle?
2. Draw a flower and label the parts, including the nodes.
3. What is the relationship between a whorl and a node? In what way is this relationship connected to the concept that a flower’s corolla is made up of modified leaves?
Calyx
The fourth whorl at the base of the receptacle is the calyx whorl. The calyx is made up of modified leaves called sepals. In some species the sepals look like miniature leaves; they are green and photosynthetic. In other species, like the lily, they are showy and almost indistinguishable from the petals. When sepals and petals are showy and indistinguishable, they are called tepals.
The saffron flower, below, is the source of the rare spice gathered from the long, red-orange stamens that you can barely see inside the opening flower. Notice that there are apparently no sepals. That is because the three sepals and three petals of this monocot plant look the same; they are therefore tepals.
It may interest you to know that saffron is a geophyte that grows from a corm. We introduced geophytes in a previous lecture as plants that develop underground organs that allow the plant to survive during periods of hostile environmental conditions.
Watch this video on tepals.
Corolla
The next whorl toward the tip the receptacle bears the corolla. The corolla is composed of highly modified leaves called petals. Petals attract pollinators through their bright colors and showy patterns. Petals may also exude nectar near their site of attachment to the receptacle to reward insects who visit the flowers and, when doing so, spread pollen from flower to flower. Color patterns on the petals may simulate a “bulls eye” or landing strip that provides the insect with a visual guide pointing to the location of the nectar, as in the violet, below.
The calyx and corolla are collectively named the perianth. Some flowers lack a perianth. Corn is an example; it is wind pollinated and has no need for a showy perianth to attract insect pollinators.
Review question
1. Sepals and petals are modifications of what other plant structure?
Androecium
The third whorl as we move towards the tip of the receptacle is the androecium whorl. The androecium is composed of modified leaves called stamens. Stamens are found in many different arrangements. The picture of the Rose of Sharon flower, in the top photo above, shows an androecium composed of an abundance of stamens in an open arrangement. In contrast, the 10 stamens in the tomato androecium (bottom photo above) are fused into a cone that surrounds the gynoecium. The tomato’s cone of stamens is a structure through which the tomato encourages self-pollination. It is difficult for pollen from another plant to get to the stigma of the carpel before pollen from the flower’s own stamen.
Stamens have two distinct components:
Filament (a long stalk)
• The filament has an architectural function, in that it lifts the anther to a position where it can effectively release pollen grains into/onto the pollinator.
• It also has a physiological (or some might say plumbing) function, in that it connects the anther to the plant’s vascular system so that it can receive water and nutrients.
Anther (usually four sacs containing pollen grains).
• Inside the pollen sacs are microsporangia and microspore mother cells where a special type of cell division called meiosis takes place (to be covered later). Meiosis in the microsporangia leads to formation of the male gametes (sperm) that will be packaged in a pollen grain.
The image above shows a cross section through a developing flower, showing components of the androecium and gynoecium.
Gynoecium
The whorl at the tip of the receptacle supports the gynoecium. The gynoecium is composed of carpels. Several carpels may be fused into a compound carpel (which may also be called a pistil). The Berberis (Oregon Grape) flower on the right has a fused carpel; the photo clearly shows the locule (inner chamber) with the ovules.
As you saw in the tutorial, the carpel consists of three parts:
Stigma
A tip on the end of the structure called the stigma.
Style
The stalk that elevates the stigma.
Ovary
The swollen base, which includes:
• A chamber called a locule
• Inside the locule, one or more ovules
• Inside the ovules, an embryo sac — the megasporangia and megaspore mother cells, which when fertilized by pollen the ovule become a seed
• Meiosis of megaspore mother cells in the embryo sac leads to the formation of the female gametes (eggs)
When you begin to compare structural differences among flowers, you will find that the position of the calyx and corolla relative to the ovary differs between some species. A more complete description of that relative alignment can be seen in the picture above, and is described here:
Epigynous flowers
Other flower parts are attached ABOVE the ovary.
This is called an inferior ovary because the gynoecium node isn’t positioned right at the tip of the receptacle, but rather is sunken down into the receptacle below where the androecium, calyx, and corolla are attached. This means that the ovary is surrounded by other tissues, primarily receptacle tissue. This will have an impact on whether any accessory plant tissues make up the fruit. More on that later.
Perigynous flowers
The ovary is surrounded by the fused bases of flower parts (calyx, corolla, androecium) that surround the ovary.
Hypogynous flowers
Other flower parts are attached BELOW the ovary. This is called a superior ovary because the ovary sits above the point of attachment of the top whorl.
A flower that has all four of the parts described above — Calyx, Corolla, Androecium, and Gynoecium — is called a "complete" flower. Flowers missing one or more parts are described as “incomplete.” We noted earlier that corn produces a flower without perianth. Such a flower could be described as “incomplete.”
Review questions
1. Sperm are produced from microspores contained in what plant part? To which whorl is this part attached?
2. Eggs are produced from megaspores contained in what plant part? To which whorl is this part attached?
3. Which type of ovary is shown in the tutorial graphic at the beginning of this lecture from which you learned the parts of the flower?
4. In what way does the filament of the stamen have an architectural function? How might this make a difference to the plant’s reproduction?
Pollination patterns
A flower with both androecium and gynoecium — that is both male and female parts — is called perfect or bisexual or hermaphroditic. Perfect flowers may be capable of self-pollination. Pollen produced within the flower may fall on a stigma in the same flower, and the sperm that it carries may fertilize the egg in the ovule. Sometimes, the timing of events during the stages of flower maturation encourage self-pollination. For instance, in some species the anther matures and pollen is shed, and the stigma is receptive, before the flower even opens. This is called cleistogamy, and is common in self-pollinating agricultural crops. Self pollination is encouraged because it is difficult for pollen from another flower to get to the stigma within a closed flower before pollen from the flower’s own anther gets there first. Flowers that are fully open when mature are chasmogamous and facilitate pollination from other flowers.
On the other hand, the development timing of male and female organs in a different species might encourage outcrossing by releasing pollen when the stigma in the same flower is not receptive, or vice versa. This relative timing is called Protandry when the pollen is shed before the stigma is receptive, and Protogyny when the stigma is receptive prior to pollen shed.
There are also genetic mechanisms called self-incompatibility, through which the stigma and style recognize pollen produced by the same plant and stop fertilization, thereby avoiding self pollination and promoting mixing genetic material (DNA) from diverse individuals.
Some plants produce imperfect male and imperfect female flowers on the same plant. The flowers containing only androecium are called staminate (male) flowers while the flowers with only gynoecium are called pistillate (female) flowers. Squash and melons, such as the watermelon shown above, are examples of plants with imperfect flowers. Corn and cucumber are others. Notice the enlarged receptacle and inferior ovary at the base of the pistillate flower of the watermelon. These flowers, because they are missing one of the four parts, could also be described as incomplete.
For the ultimate avoidance of self pollination, some plants have only staminate or only pistillate flowers. A single-sex plant like this is called dioecious (plants with both sexes, whether perfect or imperfect flowers, are called monoecious). Hops, asparagus, and hemp are examples of dioecious crop plants.
Review questions
1. Which floral characteristics or patterns of timing favor self-pollination?
2. Which floral characteristics favor cross-pollination?
3. When you eat asparagus, is the plant part you are eating more likely to be male or female? Why? | textbooks/bio/Botany/The_Science_of_Plants_-_Understanding_Plants_and_How_They_Grow_(Michaels_et_al.)/07%3A_Meristems_and_Flowers/7.02%3A_Flower_Morphology.txt |
Chapter 7 flashcards
Androecium One of the whorls of a flower and is all of the male reproductive parts; stamens.
Annual rings Demarcation between small-celled later summer and large-celled spring secondary xylem.
Anther Pollen-bearing component of the stamen.
Anticlinal division Type of cell division in which the new cells have divided so that the wall of the cells is perpendicular to the outside of the stem.
Axillary bud Bud borne in the axil of a stem.
Bark All tissues exterior of the vascular cambium, including the primary and secondary phloem, phelloderm (if present), cork cambium, and cork.
Bisexual A flower that has both the androecium and gynoecium; also called hermaphroditic or perfect flower.
Calyx One of the whorls of a flower; located at the base of the receptacle, and contains all the sepals.
Carpel Composed of three parts: stigma, style, and ovary.
Cell division Process in mitosis where one plant cell divides into two identical cells.
Chasmogamy When the anther matures after the flower opens and pollen is shed before the stigma becomes receptive; common in non self-pollinating crops.
Cleistogamy When the anther matures, pollen is shed, and the stigma is receptive before the flower opens; common in self-pollinating crops.
Complete flower Where all four whorls are present: calyx, corolla, androecium, and gynoecium.
Cork Outer protective tissue of bark; also called phellem.
Cork cambium Lateral meristem responsible for secondary growth that replaces the epidermis in roots and stems; also called phellogen.
Cork cells Cells located in the cork; lined with suberin and dead at maturity.
Corolla One of the whorls of a flower consisting of all the petals.
Cortex Also known as the ground meristem; found just inside the epidermis, extends toward the interior of the stem and root, and is made up of three types of cells: parenchyma, collenchyma, and sclerenchyma.
Derivative (cells) Other sister cells that, after the initial meristematic initial cells are created, divide once or twice more and then differentiate.
Dermal Outside of the plant; provides protection for the plant cells they surround.
Dioecious When an entire plant has only male or only female flowers; means “two houses.”
Epigynous When the perianth and androecium are positioned above the ovary; also called an inferior ovary.
Fascicular cambium Cambium within the vascular bundle.
Filament Stalk that holds up the anther so that pollen grains can be effectively released.
Gynoecium One of the whorls of the flower and is all of the female reproductive parts; carpels.
Heartwood Older, darker xylem in the stem that is clogged with resins that limit the transport of water.
Hermaphroditic A flower that has both the andreocium and gynoecium; also called a perfect flower or bisexual.
Hypogynous When the perianth and androecium are attached below the ovary; also called a superior ovary.
Imperfect flower Flower that has only the androecium OR only the gynoecium present.
Incomplete flower Flower missing one or more of the four whorls.
Inferior ovary When the perianth and androecium is positioned above the ovary; also called an epigynous flower.
Initials (cells) Meristem cells that remain meristematic because they continue to initiate new cells.
Interfascicular cambium Cambium between the vascular bundles.
Lateral meristem Specialized meristems made up of cells that undergo mitotic cell division.
Lenticels Breaks in the cork cells that allow gas and water exchange.
Locule Chamber in the ovary.
Monoecious When an entire plant has both male and female parts (can be perfect or imperfect); means “one house.”
Ovary Part of the carpel; contains ovules which develop into seeds.
Ovary wall Provides protection to the ovules; also called the pericarp.
Ovule Part of the ovary that contains an embryo sac; surrounded by the nucellus, which develops into a seed after fertilization.
Peduncle Large, central stalk that attaches the rachi to the stem of the plant.
Perfect flower A flower that has both the andreocium and gynoecium; also called hermaphroditic or bisexual.
Perianth Both the calyx and corolla.
Periclinal division Type of cell division where the new cells are formed either to the outside or inside and the cell wall that separates the two new cells is parallel to the outside of the stem.
Periderm Consists of the cork cambium, phelloderm, and cork.
Perigynous When the ovary is surrounded by the fused bases of the perianth and androecium.
Petals Modified leaves that make-up the corolla; showy, and attract pollinators.
Phellem Another name for cork.
Phelloderm New cells that are laid down toward the inside of the stem or root by the cork cambium.
Phellogen Another name for cork cambium.
Pistil Term used when several carpels are fused together.
Pistillate flower An imperfect flower that contains only the gynoecium.
Primary (cells) Cells that originate from cell divisions of the apical meristem.
Primary growth Growth that results from activity by an apical meristem; causes the elongation of the cells in the apical meristem region, which leads to increasing plant length.
Primary phloem Phloem tissue that results from differentiation of derivative cells (procambium).
Primary xylem Xylem tissue that results from differentiation of derivative cells (procambium).
Protandry When the pollen is shed before the stigma is receptive.
Protogyny When the stigma is receptive prior to the pollen shedding.
Receptacle Base of the flower where the floral parts are attached.
Sapwood Younger, lighter xylem in the stem that is resin-free and transports water up the trunk.
Secondary growth Growth that results from activity by a lateral meristem; causes thickening of the stem or root rather than elongation.
Secondary phloem New phloem formed on the outside and produced by the fascicular cambium.
Secondary xylem New xylem formed on the inside and produced by the fascicular cambium.
Self-incompatibility When there are genetic mechanisms that inhibit self-pollination of a flower.
Self-pollination When the pollen from the plant pollinates the stigma of the same plant.
Sepals Outermost whorl of the flower that protects the flower and photosynthesizes.
Stamen Modified leaf; collectively makes up the androecium. A stamen is made-up of the anther and filament.
Staminate flower An imperfect flower that contains only the androecium.
Stigma Receptive apex of the carpel of a flower, on which pollen is deposited at pollination.
Style Part of the carpel that elevates the stigma to a position for reception of pollen; conduit for pollen tube growth.
Suberin Waxy substance present in the cell walls of corky tissues; impermeable to water and gases.
Superior ovary When the perianth and androecium are attached below the ovary; also called a hypogynous flower.
Tepal When the sepals and petals are showy and indistinguishable.
Vascular cambium Lateral meristem producing vascular tissues.
Vascular tissue System containing vessels that carry or circulate fluids and dissolved minerals in the plant; composed of xylem, phloem, and bundle sheath cells.
Whorl Node on the receptacle where the four types of modified leaves are attached (four whorls of a flower). | textbooks/bio/Botany/The_Science_of_Plants_-_Understanding_Plants_and_How_They_Grow_(Michaels_et_al.)/07%3A_Meristems_and_Flowers/7.03%3A_Terms.txt |
Learning objectives
• Define simple, aggregate, and multiple fruit.
• Explain the general characteristics of fleshy and dry fruits.
• Identify the difference between a true fruit and an accessory fruit based on structure and tissues.
Fruit are important for their culinary importance and provide calories, nutrition, and pleasure. They also are the location for the development of seeds — the most important means to propagate plants and the source of genetic variation.
Thumbnail: Carpel structure, cross section. JmproutyCC BY-SA 3.0
08: Fruit
Learning objectives
By the end of this lesson you will be able to:
• Define “fruit” from a botanical point of view.
• Describe the differences among simple, aggregate, and multiple fruits.
• Explain the general characteristics of fleshy and dry fruits.
• Identify the difference between a true fruit and an accessory fruit based on structure and tissues.
That’s a fruit? I thought it was a vegetable!
The graphic to the right shows a cross section of the carpel. Recall that the carpel is the female reproductive structure that is attached to the top whorl of the flower — the gynoecium node. The carpel has three basic parts:
• The stigma, at the tip, and to which pollen grains adhere.
• The style, the channel of tissue through which the pollen tube grows.
• The ovary, at the base, and housing the ovules that contain the plant’s eggs.
The photo below shows a bit more detail about the carpel — in particular, the attachment of the ovules within the ovary via a stalk called the funiculus, emerging from the placenta. It also names the chamber in which the ovules hang: the loculus (or locule). Remember the locule, but you won’t need to remember funicule, funiculus, or placenta. If you do come across those names in the future, then recall that they relate to the attachment of the ovule within the ovary.
A fruit, in the botanical sense, is the ripened ovary together with the seeds within the ovary. People often think of a fruit from the culinary point of view, considering it to be the part of a plant that has seeds and when ripe is ready to eat, and think of vegetables as a savory food that is any edible part of a plant not associated with seeds (these include roots, stems and leaves). But some plant parts that, when we wear our chef’s hat, we think of as vegetables, are really botanical fruits. That green pepper chopped up on your pizza is a botanical fruit, as is the tomato that’s pureed to make the pizza sauce. A squash is another botanical fruit that we treat like a vegetable in the kitchen. Adding to the confusion is the legal decision that tomato fruits are vegetables (Nix v. Hedden 1893; The Washington Post). In Plant Propagation, we’ll define fruits from the botanical standpoint: the ripened ovary of a flower, together with the seeds within that ovary.
Review the diagram below of the tomato flower and fruit to be sure you know exactly which parts of the flower develop into the fruit. In the flower, the ovary wall provides protection to the ovules that contain the egg — the female gametes. The egg cells within the ovules are fertilized by the sperm from the pollen, the ovules develop into the seeds, and the ovary matures into the fruit. For some species, fruits are brown, green, starchy, bitter, proteinaceous, dry, and durable. They may be inedible, unpalatable, or so small as to be terribly inconvenient as a food. The ovary wall doesn’t always become a sweet and fleshy fruit like a peach. In kidney beans, for instance, it becomes a dry and brittle protective pod. Nevertheless, both the peach and the bean pod are botanical fruits.
The illustration shows a cross section of a tomato, with the fleshy ovary wall around the outside, locules (chambers) within the tomato, and seeds forming within the locules. The seeds are attached to the central placenta tissue by the funiculus.
Watch this videos to learn about flowers and fruits (2:45 min);
this video to learn about the structure of the ovary in the flower (3:40);
and this video on the structure of the mature tomato ovary or fruit (2:19).
Review activity
1. Draw a diagram of a flower showing which parts become the fruit.
2. Based solely on the botanical definition of a fruit, would the receptacle, petals, sepals or stamens be part of a true botanical fruit?
3. If you cut open a green pepper where is the locule?
Parts of a fruit
The ripened ovary wall is called the pericarp peri meaning around and carp referring to the carpel. Pericarp = around the carpel. The pericarp can be dry, as with bean pods, or fleshy like a peach, or sometimes both, as in an avocado, where the outer layer is leathery and the inner layer is fleshy.
The pericarp of a fleshy fruit typically has three layers, and each may have distinct characteristics. The photo of a peach below shows the layers making up the pericarp:
• Exocarp: the outer layer of the pericarp )also called the epicarp)
• Mesocarp: the middle layer (fleshy in this example)
• Endocarp: the inner layer (hardened with sclerenchyma cells in the coconut example below)
What type of cell makes up this hard shell of a walnut or peach?Sclerenchyma!
Depending upon the species, the exocarp may be tender, leathery, or hard. It may have oil glands (like in oranges and lemons) or hairs (like in kiwifruit). Similarly, mesocarps and endocarps may have various modifications that make them hard, soft, or leathery depending on the species. Remember that the pericarp is ripened ovary wall tissue and the exo-, meso- and endocarp are layers of that ripened ovary wall.
The coconut is a fruit. The photo below shows that the hard shell around the coconut that you see at the grocery store is actually the endocarp (the inside layer of the ovary wall). The fibrous mesocarp and the leathery exocarp have been removed from the coconut fruit by the time it reaches us. The fibrous mesocarp is used for other purposes like floor coverings in high-foot-traffic areas where a tough, durable fiber is needed.
A “nut” is a botanical name for a particular type of fruit. From a culinary perspective, there are many foods that we call nuts, but to a botanist a nut is a fruit with a particular structure.
You likely already knew that a peanut isn’t a nut; it’s a type of fruit called a legume, and is related to peas, beans, and locust trees. A cashew isn’t a nut either; it’s a type of fruit called a drupe. If you are interested in seeing other unusual fruits, visit the Fruits called Nuts page posted by W. P. Armstrong at Palomar College.
Review activity
1. Next time you’re grocery shopping, look around the produce section and try to figure out what parts of the fruits are the exo-, meso-, and endocarp. For instance, what are the parts that make up the banana? Where are those seeds?
2. Why are fruits important to plant propagation?
Types of fruits
Simple fruit
A simple fruit is formed from a flower with one carpel, or multiple carpels fused together so that it looks like just one carpel. The ovary wall surrounding the carpel or carpels ripens into an independent fruit (independent in the sense that it isn’t fused together with other ovaries). The photo below shows a grape, which is a simple fruit.
Aggregate fruit
In an aggregate fruit, the fruit is formed from the ripened ovaries present in one flower with numerous simple carpels. The ripened ovaries from that one flower coalesce into one larger unit, but you can still see evidence of the individual carpels. The raspberry, for instance, comes from one flower with many carpels. As the pericarps mature they mature together to form the thimble of the raspberry that we eat. You can still see the mosaic of individual ruby red carpels that fuse together to form the thimble. If you’ve ever harvested raspberries you know that the thimble pulls off a firm white structure, and that structure is the receptacle of the flower. Below is an illustration of the fruit structure.
Multiple fruit
A multiple fruit is formed from the ripened ovaries present in one flower with numerous simple carpels. The ripened ovaries from that one flower coalesce into one larger unit, but you can still see evidence of the individual carpels. In the photo of the pineapple, below, you can see individual flowers, some of which are still open and showing purple-pink petals. The pericarps of these individual flowers coalesce into one large multiple fruit.
The distinction between aggregate fruit and multiple fruit has to do with the number of flowers involved in the fruit. An aggregate fruit is from one flower with many ovaries, and the multiple fruit is made up of multiple flowers.
Fruit types
Fruits are also categorized according to whether the pericarp at maturity is:
• Fleshy: accessory parts of the ovary develop into succulent tissues with a high moisture content.
• Dry: at maturity the fruit has a low moisture content. Dry fruit that opens and releases the seeds from the pericarp is called dehiscent and dry fruit that remains closed retaining the seed within the pericarp is called indehiscent.
A dry, dehiscent pericarp may split open along sutures in various ways, and these ways of splitting open are also characteristic of particular types of fruits.
Simple fruits
Simple fruits with fleshy pericarp (exocarp, mesocarp, endocarp):
Drupe
A stone fruit, derived from a single carpel and containing usually one or two seeds. The exocarp is a thin skin, the mesocarp may be fleshy, and the endocarp is hard (i.e., “stony”) as shown in the photo of the peach, below. Examples of drupes include peach, plum, cherry, apricot, and almond.
Berry
A simple fruit formed from one flower with a superior ovary. The fruit has a fleshy pericarp, one carpel or multiple fused carpels, and many seeds. A tomato (below) is a berry, a grape is a berry, blueberries and cranberries are berries…but a raspberry is not. (Remember that a raspberry is an aggregate fruit where the carpels do not fuse the way they do in multiple-carpel berries).
Pepo
A simple fruit formed from one flower with an inferior ovary. The fruit has a fleshy mesocarp, a rigid or leathery exocarp, one carpel or multiple fused carpels, and many seeds. The photo of squash below shows the fusion of three carpels to form the fruit, each carpel having many seeds. The fleshy interior that we eat is the mesocarp. Other examples include zucchini, cucumber, summer squash, and winter squash such as acorn and butternut squash.
Hesperidium
Like a berry, but with a leathery exocarp instead of a fleshy exocarp. Each section of the hesperidium represents one carpel in the flower, but in the mature fruit the exocarp and mesocarp form an uninterrupted cover. The interiors of the carpels are packed with fluid-filled vesicles that are actually specialized trichomes. The exocarp contains volatile oil glands in pits. The orange, below, is an example of a hesperidium. All citrus fruits are this type of fruit.
Simple fruits with dry pericarp, dehiscent
Legume
Dry fruit made up of a single, folded carpel, multi-seeded, dehiscent along two sutures. It is easy to see the funiculus in peas, When you open the pod to shell out the peas there is a small stalk attaching the pea seed to the pod; that’s the funiculus. Beans are also legumes.
Capsule
A dry, dehiscent fruit made up of several fused carpels. The photo below shows the exterior of the poppy capsules and a cross section showing the locules with seeds inside. The capsule may split open in several ways depending on the species. In a poppy, the cap pops off to eject the mature seeds.
Simple fruits, dry pericarp, indehiscent
Caryopsis
A fruit from one carpel containing a single seed. The pericarp is fused to the seed. A corn kernel is a caryopsis. The outside of the corn kernel is the pericarp.
Achene
Like the caryopsis (one seed per ovary), but the seed can be threshed so that it is free of the pericarp. You can buy sunflower seeds “in the shell.” The “shell” is the pericarp. We also discussed achenes earlier when looking at the actual fruits on a strawberry.
Nut
A dry, indehiscent, one-seeded fruit with a hard exocarp. The ovaries that produce nuts have more than one carpel, but through abortion, only one seed matures. In the photo below, the pericarp of the acorn is partially encased in a tough covering called the involucre. True nuts will always have a hard exocarp and just one seed, while this is not always the case with culinary nuts. Peanuts, for instance, have a hard exocarp but multiple seeds. Horse chestnuts have a leathery exocarp and hard endocarp. True nuts have a hard exocarp.
Review questions
1. What features distinguish simple, aggregate, and multiple fruits?
2. What is meant by dehiscent and indehiscent? How would you classify the corn caryopsis and the sunflower achene in this regard?
Accessory fruits
Earlier, we sawhow one or more of the other flower parts (androecium, corolla and calyx) can be attached below the ovary (hypogynous parts, superior ovary), above the ovary (epigynous parts, inferior ovary), or around the middle of the ovary (perigynous parts). In the case of epigynous and perigynous parts there are tissues surrounding the ovary to which the other flower parts attach and that can also adhere to the outside of the ovary and become part of the fruit. One example of a fruit from this type of flower where there is accessory tissue (hypanthium) adhering to the outside of the ovary wall is the pome, examples of which are the apple, pear, and quince. Another example is the strawberry, where together the receptacle tissue and ovary wall tissue form the strawberry fruit. Since it isn’t part of the ovary wall, the receptacle tissue is considered an accessory tissue, so the strawberry, instead of being a true fruit, is a type of fruit called an accessory fruit.
Apple is an example of a species where the culinary fruit part we eat is actually hypanthium tissue rather than ovary wall tissue. In an apple, the ovary is the papery core that encloses the seeds. Since the part we eat isn’t the ripened ovary wall, the apple is called an accessory fruit, signifying that we are really enjoying hypanthium tissue (an accessory tissue), not ovary wall. The hypanthium is also the tissue that makes up the fleshy part of rosehips (fruit of roses) — logical, because apple and rose are in the same taxonomic family: Rosaceae. Plants in the same family have common flower (and therefore fruit) morphologies.
The situation can be very complex with plants like strawberry where the juicy part we eat is the swollen receptacle of the former flower and the actual botanical fruits are the brown specks sticking to the outside of the receptacle. The strawberry is an accessory fruit because the red fleshy part we eat is made up not of the ovary wall, but primarily of receptacle tissue. The strawberry is also an aggregate fruit formed from multiple ovaries present in one flower. The fruit is an achene that contains the single seed from a single ovary attached to the outside of the receptacle.
Review activity
1. Cut open an apple and identify where the hypanthium ends and the ovary wall begins.
2. Next time you are at the grocery store, identify which “fruits” are true fruits, accessory fruits, aggregate fruit, or multiple fruits.
You should know the types of categories, such as simple fruits, multiple, aggregate, dehiscent, indehiscent, and some examples, but you do not need to keep an exhaustive list in your mind. You should also know the definition of an accessory fruit and the relationship of these fruits to epigynous and perigynous flowers.
There are many more types of fruits. If you are interested in some optional reading you can discover more about fruit types. Or do a Google search on “types of fruits” or on any of the specific fruit types mentioned above.
8.02: Terms
Chapter 8 flashcards
Accessory tissues Tissue of the fruit that is from non-carpel origin, usually in epigynous and perigynous flowers — e.g., the flesh of an apple is hypanthium tissue and the ovary is the papery core that encloses the seed.
Aggregate fruit Fruit formed from the ripened ovaries present in one flower with numerous simple carpels.
Dehiscent Used to categorize fruits with seeds that separate from a dried pericarp.
Endocarp Inner layer of the pericarp.
Exocarp Outer layer of the pericarp.
Fruit (botanical sense) Ripened ovary together with the seeds within the ovary.
Funiculus Stalk that connects either an ovule or a seed to the placenta.
Indehiscent Used to categorize fruits with seeds that are retained within the dried pericarp.
Mesocarp Middle layer of the pericarp.
Multiple fruit Fruit formed from the ripened ovaries from a cluster of flowers that are in close proximity in an inflorescence and that coalesce into one unit.
Pericarp Ripened ovary wall; made up of three parts: exocarp, mesocarp, and endocarp.
Placenta Part of an ovary where the funiculus attaches.
Seed Ripened ovule containing a seed covering, food storage, and an embryo.
Simple fruit Fruit formed from a flower with one carpel or multiple carpels fused together so that it looks like just one carpel. | textbooks/bio/Botany/The_Science_of_Plants_-_Understanding_Plants_and_How_They_Grow_(Michaels_et_al.)/08%3A_Fruit/8.01%3A_Fruit_Morphology.txt |
Learning objectives
• List three functions of a seed and identify its structures.
• Describe the process of seed germination.
• List the external factors required for seed germination.
• Understand dormancy and how the skilled plant propagator overcomes it.
Seeds are key to feeding the world’s population as a nutrition and calorie source and for the propagation of most crops. In addition, being a fusion of paternal (pollen) and maternal (egg) genetic material, seeds create diversity; evolution acts on this diversity, and plant breeders take advantage of it to improve crops.
Thumbnail: Why a coconut? Because inside the coconut’s fibrous husk is a seed (image: Coconut. Filo gèn. CC BY-SA 4.0).
09: Seeds
Why a coconut? Because inside the coconut’s fibrous husk is a seed (image: Coconut. Filo gèn. CC BY-SA 4.0).
Learning objectives
By the end of this lesson you will be able to:
• List three functions of a seed and name the seed part that has that function.
• Identify the parts of the embryo and the structures they become.
• List the types of nutrients that are stored in seeds.
• Describe the differences between the tissues that provide protection for the seed.
Seeds and diversity
To review, the two fundamental ways of propagating plants and how they differ in their outcomes are sexual reproduction through seeds or spores, and asexual or vegetative reproduction through manipulation of various plant parts, including cuttings from leaves, roots, and stems, or grafting.
Asexual reproduction, also called vegetative propagation, normally results in progeny (offspring) that are an exact genetic copy of the parent plant that donates the vegetative parts used in propagation. All of the progeny propagated from the same plant contain the same genes as the parent plant, and the progeny are also identical to each other. Differences among progeny or between parent and progeny may arise as a result of mutation, but this is rare. More likely, any differences among plants that have been asexually propagated from the same parent occur because the growing environment differs from plant to plant in some important way (fertility, water, light). The way the plant looks and performs in a particular environment is called its phenotype. The collection of genes the plant contains is called its genotype. Vegetative propagation results in identical genotypes, but two plants with identical genotypes may have different phenotypes if they are grown in contrasting environments.
Sexual reproduction in weedy, native, or undomesticated plants typically results in seeds that are genetically different from either parent, and in progeny that are all genetically different from one another. Sexual reproduction in domesticated plants can also result in genetically diverse seed, but for those domesticated plants that are highly inbred, like peas, beans, and cereals other than corn (like barley, wheat, oats, and rice), sexual reproduction can also result in seeds that are genetically identical to the parent. For now, remember that sexual reproduction means that a seed is formed as a result of fusion of a sperm and egg cell, and that there is the potential for progeny to differ from the parent(s).
Sexual reproduction, and the genetically variable progeny that result, give a plant species a great deal of flexibility to adapt to new habitats and environmental conditions. Some progeny might be extremely well adapted to new niches and can thrive there, while some will not fit and will not survive and reproduce. To assist the species in spreading, the seeds of the plants that successfully reproduce often have strategies for dispersal away from the parent plant. This spread the species to diverse locations and new ecological niches, and also reduces the likelihood of too many plants of the same species competing with each other in a limited space for the same scarce resources.
Seed formation is normally assumed to be the result of sexual reproduction rather than vegetative propagation. In rare cases, however, an embryo can develop solely from maternal tissue with no fusion of egg and sperm. This is called apomixis. Apomixis is really a form of asexual reproduction disguised as sexual reproduction. The process results in a seed, but the embryo in the seed isn’t the result of sex — the fusion of male and female gametes. All of the progeny are identical to the parent because the embryo is actually a clone (genetically identical offspring) of the plant on which the seed is produced. Kentucky bluegrass reproduces this way, as does dandelion. It is ironic that our lawns are often inhabited by two apomictic species … the Kentucky bluegrass we struggle to grow, and the dandelions many homeowners go to great extremes to eradicate.
Basic seed morphology
Seeds have three main functions:
Propagation of the plant
This is accomplished by the embryo, which is the nascent (new, young) plant resulting from the combination of genes from the male sperm, transmitted by the pollen, to the female egg, held in an ovule in the ovary. The embryo has an axis with one end differentiating into the shoot and the other into the root.
Nutrient storage
Two types of structures can store nutrients in the seed — the cotyledon and the endosperm. The nutrients fuel growth of the embryo.
Protection
The embryo and nutrient source need a tough covering for protection from the environment and predators, and this is typically, but not always, provided by a structure called the seed coat (sometimes called the testa).
The drawing above shows a simple cross section of a kidney bean seed (a dicot, but only showing one cotyledon), illustrating these three functions. The kidney-shaped part is the outline of the cotyledon, the main mass of the bean seed and the site of stored nutrients. Sandwiched between the cotyledon halves is the embryo, which is the nascent plant. On the outside of the cotyledon is a thin layer that is the protective seed coat. The kidney bean seeds we see in the grocery store have a seed coat that typically has a light or dark maroon color. In peanuts, the different structures are easy to see when you pull the two cotyledons apart.
First function: Propagation of the plant by the embryo
In flowering plants the embryo is normally the result of fusion of egg and sperm. The egg is held within an ovule, which in turn is held within the ovary, which can hold several ovules, depending on the species. The egg is typically fertilized by sperm from pollen. The maturing ovule develops within the ovary of the maternal plant.
A mature seed has an embryo with a linear arrangement of parts. This arrangement is called the embryo axis. The drawing above shows the embryo axis from the kidney bean, straightened out to show the individual structures.
• Embryo axis — the embryonic root and shoot
• Parts making up the shoot tissue of the embryo axis:
• Plumule — the first true leaves of the plant that you can sometimes see already attached to the embryo. These leaves will emerge from the seed, rise above the soil surface, and start to collect energy from the sun.
• Point of attachment — the spot shown in red in the diagram (it’s not red on a real embryo) on the embryo axis where the cotyledon attaches. The cotyledon is attached to the embryo, and is actually part of the embryo. In the case of the bean, the cotyledon is a nutrient storage organ and the nutrients flow to the embryo through the point of attachment of the cotyledon to the embryo axis.
• Epicotyl — the part of the embryo axis that is above (epi-) the point of attachment of the cotyledons
• Hypocotyl — the part of the embryo axis that is shoot tissue below (hypo-) the point of attachment of the cotyledons, but above the radical. The hypocotyl is the part of the shoot between the attachment of the cotyledon and the start of the root (radicle).
• Part making up the root tissue of the embryo axis:
• Radicle — the embryonic root tissue
At the tip of the epicotyl is the shoot apical meristem that will produce new nodes and internodes. If you’re counting nodes on the embryonic axis, the first node on the stem starting from the point of transition of root to shoot is the point where the cotyledons attach. The cotyledons are actually embryonic leaves. The second node is where the plumule is attached.
At the tip of the radicle is the root apical meristem that will produce the primary root.
Review questions
1. Differentiate among embryo axis, epicotyl, hypocotyl and cotyledon. Which are derived from the cell resulting from the fusion of egg and sperm?
2. Describe why apomixis results in a seed that is actually a form of asexual propagation.
3. Of the tissues making up the embryo axis (plumule, epicotyl, hypocotyl, radicle), which are shoot tissue and which are root tissue?
Double fertilization and the endosperm
In flowering plants (angiosperms), there is a phenomenon called “double fertilization.” The angiosperm pollen grain holds two sperm cells. One fertilizes the egg, and the resulting zygote grows to become the embryo. The other unites with two other maternal nuclei, called polar bodies, and these three nuclei together grow to become a tissue called endosperm (like the meat and milk of the coconut). This will be covered in more detail when we study meiosis and gametogenesis. For now, remember that in flowering plants there is a process called double fertilization that results in an embryo and an endosperm.
In grasses, like the corn in the illustration above, the endosperm is the major energy and nutrient storage tissue. This is different from the kidney bean, where the cotyledon is the storage organ. There is a cotyledon in the corn seed as well, but instead of storing energy and nutrients, it helps break down, absorb, and transfer the energy and nutrients stored in the endosperm to the embryo. Also in many monocots, there is a sheath covering the plumule and epicotyl that provides protection. This sheath is called the coleoptile. A similar sheath covers the radicle, and is called the coleorhiza. Coleoptile and coleorhiza are terms used specifically with plants in the grass family (Poaceae), and not in other families within monocots. Both function in providing protection to the emerging shoot and root. In the corn seed, the three functions of 1) propagation, 2) protection, and 3) nutrition are satisfied by the:
• Embryo (shown in this illustration extending from the shoot to the root) and that will propagate a new plant.
• Endosperm tissue that provides energy and nutrition for the embryo.
• Pericarp protecting everything inside. Remember that in corn, which produces a type of fruit called a caryopsis, the pericarp is fused right to the seed. The pericarp is the mature ovary wall of the female corn flower in the ear (labeled ‘seed coat’ in the illustration above).
This summary table contrasts corn and bean seed components:
Cotyledon Endosperm Seed Coat Pericarp
Corn – monocot Energy absorption Energy storage Remnants (these tissues are absent or only fragments of tissue in the mature seed) Protection (outermost layer of the corn kernel)
Bean – dicot Energy storage Remnants (these tissues are absent or only fragments of tissue in the mature seed) Protection (outermost layer of the bean seed) Protection (pod)
Second function: Storing energy and nutrients for embryo growth
Among flowering plants, energy and nutrients can be stored in the seed in the:
• Cotyledon
• Endosperm
What types of energy and nutrients are stored in these tissues? Think about the seeds you eat, and you can probably name many of these nutrients.
Carbohydrates
• Provide energy — complex molecules composed of carbon, hydrogen, oxygen.
• In plants, carbohydrates include starch and sugar.
Protein
• Sources of amino acids for production of enzymes and other nitrogen-rich compounds.
• Amino acids are the building blocks of proteins.
• Protein is the solid material in tofu (pressed curds from coagulated soy milk). There are several different categories of protein in seeds based on the specific chemical structures of the molecules. Gluten is a type of protein found in wheat endosperm that confers elasticity to bread dough so that the stretchy dough traps the carbon dioxide given off by yeast in the bread-making process and forms a tender loaf full of air pockets.
Lipids
Plant oils, called triglycerides, are compact molecules for storing energy in a more compact way than in starch and sugar.
We are bombarded with a great deal of confusing nutritional information about lipids in our foods. When you encounter nutritional claims, keep this information in mind:
• The building blocks of a triglyceride are a Glycerol molecule plus 3 Fatty Acids. The illustration shows a triglyceride made up of glycerol linked to three saturated fatty acids.
• Fatty acids are long chains of carbon atoms with two hydrogen atoms attached to each carbon, except where there is a double bond between adjacent carbons on the chain. In the case of a double bond, each carbon involved in the double bond has only one attached hydrogen atom.
• Saturated fatty acids have no double bonds in the chain, and all carbon atoms in the interior of the chain have two attached hydrogen atoms — they are thus saturated with hydrogen atoms.
• Unsaturated fatty acids have one or more double bonds between one or more carbon atoms in the chain. These fatty acids lack some hydrogen atoms, and therefore the carbon atoms are not saturated with hydrogen — they are unsaturated.
• You have probably heard nutritional claims about saturated and unsaturated fats. The difference between the two is whether all the carbon atoms in the fatty acids are saturated with hydrogen atoms, or are missing hydrogen atoms as a result of double bonds in the carbon chain. Plant oils tend to be unsaturated, which results in them being liquid at room temperature — they have a low melting point. Animal fats tend to be saturated, which results in them being solid at room temperature — they have a higher melting point. If you are interested in more of the chemical nature of fatty acids, check out this link to The Fat Primer (optional reading).
Nutrient differences between monocots and dicots (legumes in particular)
Dicots
As noted above, seeds with two cotyledons tend to have cotyledons whose function is storage. Legumes (Fabaceae family) like beans, peas, soybeans, and lentils are dicots that tend to store large amounts of protein in their cotyledons. Some legumes have high protein, high lipid, and low carbohydrates (like soybean and peanut); these are called oilseeds because they have high lipid content and oil can be squeezed or otherwise extracted from them. Others have high protein, low lipid, and high carbohydrate (like pea and bean), and these are called pulse crops. Pulse crops are hugely important foods because they are edible protein sources. They are a key source of protein in vegetarian diets.
Monocots
Monocots have a cotyledon too, but as noted earlier the cotyledon is primarily used for absorption. In cereals the endosperm stores the nutrients, which tend to be primarily starch and sugar and low amounts of protein and oil.
As a rule, legume seeds are high protein (and in some cases like soybean and peanut high oil), while cereal grains like corn, wheat, oats, barley, and rice are high in starch.
Review questions
1. What seed structure(s) contains carbohydrates?
2. What is the key characteristic of an unsaturated fatty acid?
Third function: Protecting the embryo and nutrients
Seeds have two layers of protection:
• The seed coat, which originates as ovule wall tissue.
• The pericarp, which originates as ovary wall tissue.
The line drawing of a flower cross-section, right, shows sepals, petals, stamens (made up of a filament and anther), and carpel or pistil (made up of stigma, style, and ovary). Also identified are the ovary wall and the ovule wall. The ovary is at the base of the carpel and holds the ovules. The ovules are protected by the ovary and hold the egg. When the flower is fertilized, a pollen tube germinates from the pollen grain and grows into the stigma and down through the style. The sperm follows the pollen tube into the ovary. One sperm unites with the egg and the resulting zygote becomes the embryo. The other sperm unites with two polar nuclei to form the endosperm. This is the double fertilization noted earlier.
As the seed matures, the cells inside the ovule multiply and grow. The ovule wall, which is made up of maternal cells called integument tissue, matures to become the seed coat. An example of a seed coat is the red or tan “skin” on a peanut. The ovary wall (note the important difference between the words “ovule” and “ovary”) matures into the protective cover called the pericarp. Again using peanut as an example, the pericarp is the “shell” of the peanut. So peanuts-in-the-shell are an example of a pericarp (shell, ovary wall tissue) and a seed coat (skin, ovule wall tissue) protecting the cotyledons and embryo within the seed.
In contrast, when corn matures, the ovule wall smashes up against the ovary wall as the cells inside multiply and enlarge. The ovule wall cells disintegrate, so at maturity there are only remnants of the seed coat. The ovary wall matures into the pericarp of the corn seed, which is the hard exterior of the seed.
These words belong together:
• Ovule wall — Seed coat
• Ovary wall — Pericarp
You might be interested to know that you are probably wearing integument/seed coat tissue right now. The fine fibers attached to the outside of cotton seeds are made up of long chains of single cells of integument tissue and are extensions of the seed coat. These fibers are removed from cotton seeds, spun into a fiber, and woven into fabric.
Review question
1. When you eat green beans or snow peas as a (culinary) vegetable, are you eating pericarp, seed coat, or both? | textbooks/bio/Botany/The_Science_of_Plants_-_Understanding_Plants_and_How_They_Grow_(Michaels_et_al.)/09%3A_Seeds/9.01%3A_Seed_Morphology.txt |
Learning objectives
By the end of this lesson you will be able to:
• Describe the process of seed germination.
• List the external factors that are required for seed germination.
• Understand dormancy and the conditions needed for germination to occur.
Seed — a living plant in a quiescent state
In the ovary, within the ovule, after egg and sperm unite to form the zygote, the zygote cell repeatedly divides and develops into an embryo. The embryo differentiates into different structures — plumule, radicle, cotyledon(s), and the endosperm, seed coat, or pericarp develop. Once this development has occurred, the embryo’s metabolism slows down to nearly zero and the maternal plant stops pumping energy into the seed. The nascent plant contained within the seed — really an embryo surrounded by nutritive tissue and a protective covering — is now independent of the mother plant. The seed, which is the next generation of plant, enters a quiescent phase.
Recall that the seed contains:
• An embryo, which is the new plant,
• A nutrient source (typically endosperm and/or cotyledon), and
• A protective covering (typically a seed coat and/or pericarp)
Why do plants produce seeds? Because seeds allow plants to:
• Propagate the next generation
• Generate genetically variable offspring that can be sorted through natural selection
• Survive harsh conditions
• Disperse into new environments
The first of these reasons is obvious, to propagate. One parent plant generates many seeds, and through these seeds potentially bears many offspring. A kidney bean plant, for instance, might average 4 seeds per pod and have 20 pods hanging on the plant, so one plant yields 80 seeds. A nice ear of field corn will have 16 rows of kernels with 40 kernels per row, for a yield of 640 seeds. The tiny hot pepper in your garden has over 50 seeds, and 20 peppers on a plant would yield 1,000 seeds.
The second reason, genetically variable offspring, results from cross-pollination (mentioned above under Seed Morphology), which is particularly common in wild, undomesticated plants. When plants cross-pollinate, an egg is formed within the maternal plant. The genetic constitution of the developing embryo within the seed is 50% from the paternal plant, 50% from the maternal plant. The particular combination of genes in the developing seed is different from that in either parent plant, and from the other seeds on the same maternal parent. The seeds share some of the same genes, but the specific combination of genes is different. That difference results in genetic variability, which can be expressed as differences in plant height, flower color, leaf shape, fruit size, or other morphological or physiological characteristics. In nature, this variability is the raw material on which natural selection operates. In plant breeding, it is the resource that sustains our efforts to select improved plant varieties.
Due to their protective coating and quiescent metabolism, seeds can survive harsh conditions that will kill the parent plant such, as freezing cold, protracted drought, and even fires. Once conditions are again favorable for plant growth, the seeds can then germinate.
Seed dispersal
Seeds disperse from the maternal parent plant “in space” through many wonderful and creative mechanisms for hitching rides on the wind, on animals, and sometimes in animals as they are eaten, pass through the gut, and are excreted.
You have probably seen fluffy cottonwood (poplar) seeds floating on the summer breeze, pulled burdock seeds off your sweater after bushwhacking through the woods in the fall, or washed bird guano full of mulberry seeds off your car’s windshield. These seeds all used strategies for dispersal in space. Vanderbilt University’s Bioimages (optional) includes photos of mechanisms that help spatially disperse seeds.
Seeds also disperse from the maternal parent plant “in time.” Some have dormancy mechanisms that delay germination until the next favorable growing season, which might be a year from now or even several years from now. Seeds are considered dormant if they are alive and don’t germinate even if provided with favorable conditions for germination. There are many dormancy mechanisms; we’ll address some of them later.
If you’ve ever dug up new sections of your yard for a garden, did you notice that, a few weeks after planting veggies or flowers in the spring, you saw a big flush of weeds? And if you pulled up all of those weeds and somehow prevented any new seeds from landing in the garden, you still got a big flush of weeds the next year? This is called the soil’s seed bank, and it’s due to dormant seeds that are resting in the soil. Every year a percentage of those seeds lose their dormancy and germinate, leaving you wondering in frustration whether the weeding will ever end. (It won’t.)
Review questions
1. What type of reproduction results in genetic diversity among seeds produced on the same plant?
2. Distinguish between mechanisms causing dispersion in time vs. dispersion in space.
3. What part(s) of the seed provide nutrition? Protection?
Germination
Germination is the reactivation of the seed’s metabolism and the restoration of embryo growth. There are two main reasons why seeds don’t germinate:
1. They could still be quiescent because favorable external conditions do not yet exist. In particular, the environment could be too dry or too cold, or the oxygen levels could be too low to support embryo growth.
2. They could be dormant — the characteristic that allows seeds to disperse in time.
External conditions
The external conditions required for germination to occur are:
• Water
• Oxygen
• Temperature
• Light (for some small or fine seeds, like lettuce)
Looking at these external conditions more closely:
Moist conditions allow the seed to imbibe water. Seeds are typically very dry — somewhere in the 8–15% relative humidity range — so they will readily take up moisture from damp soil. Water moves through the pericarp and seed coat into cells and leads to reactivation of the metabolic processes. The seed’s nutritive reserves are metabolized for the embryonic cells to divide, enlarge, and differentiate.
The breakdown of nutrient reserves to form energy for plant growth is called respiration, and it requires oxygen. The seed must have oxygen to respire. If you keep seeds in an oxygen-depleted atmosphere, they will not germinate. One all-too-common type of oxygen-depleted environment in which seeds are sometimes placed is waterlogged soil. If you over-water newly planted seeds, the water will keep oxygen from reaching the seeds, and although the seeds will imbibe water and swell as if everything is going well, they will not germinate, and will likely rot because there is not enough oxygen available to sustain respiration. Waterlogged soil also encourages growth of bacterial and fungal organisms that can infect and decompose the seed.
Depending on the species, seeds have various temperature requirements for germination. Some spring flowers will germinate when soil temperatures are quite cool, even below 50ºF, while most of the seeds we plant in our gardens prefer temperatures in the 50–70ºF range. Again, respiration is the reason. Molecules move around faster when they are warmer, and this movement encourages the chemical reactions required for respiration. If the seeds are cold and the molecules aren’t moving around, the seeds won’t germinate.
If light is required for seed germination, the species is said to be positively photoblastic. This characteristic allows the seed to remain dormant when buried deep underground, but to germinate when brought to the surface. As you might imagine, weeds that are successful in annually-tilled soils may be positively photoblastic. They remain dormant until tillage brings them to the soil surface.
A note about respiration
Respiration refers to the set of reactions that take place in the plant cell to convert chemical energy stored in molecules into a form of energy that can be readily used by the cell to power other chemical reactions. Respiration converts the starch stored in the endosperm or cotyledon into ATP (Adenosine triphosphate) (optional reading), which is used in the apical meristems and the radical of the embryo to fuel cell division and the production of new cells.
Starch is made up of a chain of glucose subunits. Glucose, shown in the three-dimensional model above, is a simple sugar that is made up of 6 carbon atoms, 6 oxygen atoms, and 12 hydrogen atoms. The shorthand formula for glucose is C6H12O6. The shorthand formula for starch is [C6H12O6]n, where the “n” indicates that there are “n” glucose molecules that, when linked together, make up a starch molecule.
When we put a quiescent, but not dormant, seed in the ground and it has access to appropriate moisture, warmth, and oxygen (and light if positively photoblastic), it begins to respire. Enzymes are secreted by the cotyledon and, depending on the species, by other specialized cells surrounding the cotyledon and endosperm, which break down the stored starch into its glucose subunits. It is important that the starch be broken down to glucose because glucose is a sugar that is physically small enough to pass through the semipermeable cell membrane; starch is too large to get through. Starch can’t be moved from cell to cell, but glucose can. Starch can be stored in cotyledon or endosperm cells and be broken down to glucose, and that glucose then moves into the actively dividing meristem cells.
Once in the cell cytoplasm, the glucose is broken in half by a process called glycolysis to form a 3-carbon compound known as pyruvate. Pyruvate first reacts with a carrier molecule and then moves into the mitochondria — the powerhouse organelles in the cell — where it is further metabolized to yield high-energy molecules of ATP. The processes in the mitochondria require the presence of oxygen. The ATP moves out of the mitochondria and to the parts of the cells where chemical reactions are taking place that need energy.
Starch stored in the seed is a form of stored energy composed of glucose. Glucose is a transportable form of chemical energy that can move through cell membranes, so it helps surround the seed with chemical energy. Pyruvate is a compound formed from glucose that can move into the mitochondria and be broken down to yield ATP. ATP leaves the mitochondria and provides the cell with the energy needed for a wide range of chemical reactions.
The inputs for respiration are glucose and oxygen. Respiration converts the energy stored in the glucose into ATP that will power reactions throughout the cell. Carbon dioxide and water are the two waste products.
Seeds also store lipids and protein in the cotyledons. These too can be broken down during respiration. The lipids are first biochemically deconstructed into their components: glycerol and fatty acids. The glycerol molecule is made up of carbon, hydrogen, and oxygen — so it can also be converted to pyruvate and heads into the mitochondria for conversion to ATP. The fatty acids take a different biochemical route, but still end up yielding ATP. Protein respiration is even more complicated, and yields nitrogen-containing building blocks of protein and cells called amino acids that are used in construction of other molecules in the cell. Stored protein in the seed is better at providing amino acid building blocks than it is in providing ATP to energize the cell. Protein can provide energy if necessary, but starch and lipid are more efficient energy storage molecules.
Storing seeds
Since germinating seeds require oxygen, moisture, and warmth, you can intentionally restrict germination by limiting one or more of these conditions. Why restrict germination? One reason is to store and save seeds for long periods of time. The most common method for storing seeds is to ensure that they remain dry. If you dry seeds in the sun on a low-humidity Minnesota day, you will get the seeds down to around 10% moisture, which is great for storage. (Don’t bake them in the oven; too much heat will kill the embryo.) At a moisture level of 10% or lower you can put them into a glass jar with a tight lid and put them on a shelf for a few years of storage. To store them longer, you can put them in your freezer, which of course means that you have drastically reduced the heat in the seed, which will stall respiration even further and extend the life of the seed. In extreme situations, such as that maintained at the National Seed Storage Laboratory in Fort Collins, Colorado, seeds are dried and placed in oxygen-depleted conditions and stored in a freezer, or put in vials and suspended in the vapor over liquid nitrogen for storage at about -150ºC.
For home storage of most garden seeds, get them dry, put them in a tightly lidded glass jar, and, to make them to last 5–10 years, put the jar in the freezer. To dry small amounts of seeds, you can use a home food dehydrator set on a very low temperature. Don’t put your seeds in the refrigerator unless you have them very tightly sealed in an air-proof container, because refrigerators are damp. A refrigerator is a great place to store popcorn, because the humidity ensures that the kernels have enough moisture to pop strongly, but it’s a poor environment for seed storage.
Dormancy
The second reason seeds resist germination is dormancy. Dormancy is when the seeds do not germinate, even though conditions for germination are favorable. Something about the seed prevents germination. Barriers to germination could include:
1. Barriers in the protective covering:
• A seed coat, or pericarp, that is impermeable to water or oxygen.
• Compounds that act as germination inhibitors that are embedded within the seed coat.
2. Barriers in the embryo:
• Physiological immaturity of embryo — the embryo is initially immature and requires a period of cool temperatures or alternating warm and cool temperatures to fully mature.
• Endodormancy in temperate plants — internal biochemical processes must be met in the seed before germination can begin. Endo-dormancy is the first stage of dormancy for many seeds from plants grown in temperate environments like Minnesota. Once the internal biochemical processes are met, the seed usually goes into eco-dormancy.
• Ecodormancy — external factors are not optimal for germination. This is often due to temperatures being too cold, or to amounts of water not sufficient for germination.
The ways in which horticulturists overcome seed dormancy depend on the type of dormancy. For seeds with impermeable seed coat, such as the Kentucky coffeetree (Gymnocladus dioicus) seen above, a technique called scarification is used. Sandpaper is used to break through the seed coat until the white cotyledon is visible. Under warm, moist conditions, these seeds will germinate. To germinate a large amount of seed, there are other ways to break the seed coat, such as using acid to “etch” holes in the seed coat to allow for water imbibition.
In the case of endodormancy, we usually have to be patient. Seeds are placed in a cool (38–42ºF) place under moist conditions. This process is called stratification. Depending on the plant species, stratification can take from 2 weeks to almost a year. It is as easy as putting seeds in a sealable plastic container or bag with moist media, and placing them into a refrigerator.
Dormancy is a great strategy for enhancing a plant’s survival potential because germination is delayed until a later time when environmental conditions are more favorable. However, for horticulturists who prefer that a seed germinate as quickly as possible after being planted, dormancy is a nuisance. One of a horticulturist’s important skills is to recognize dormancy, identify the dormancy mechanism, and take steps to overcome the inhibition so that plants can grow predictably from seed when planted.
Review questions:
1. What external factors are required for germination?
2. Outline the process through which the seed’s embryo receives useful energy from the starch stored in the cotyledon or endosperm.
3. What are the factors required for successful long term seed storage? How do these compare to the factors required for germination?
4. What are the different types of dormancy?
5. If you knew a seed had ecodormancy, what would you do to encourage germination?
9.03: Terms
Chapter 9 flashcards
Apomixis A form of clonal reproduction where vegetative cells in the flower develop into zygotes to form seeds.
Carbohydrates One of the three major types of nutrients found in seeds; provide energy in the form of starch and sugar.
Coleoptile Protective sheath that covers in the plumule and epicotyl in the Poaceae family.
Coleorhiza Protective sheath that covers the radicle in the Poaceae family.
Cotyledon Food storage structure used in germination.
Dormant/dormancy Term used when seeds are alive and don’t germinate when provided with favorable conditions for germination.
Double fertilization Where one haploid male sperm cell fuses with the female haploid egg cell to form the diploid zygote, and the second haploid male sperm cell fuses with two egg cells to form a triploid endosperm.
Ecodormancy When external factors, usually environmental, prevent a seed from germinating.
Embryo Nascent (new, young) plant resulting from the combination of genes from the male sperm transmitted by the pollen to the female egg held in an ovule in the ovary.
Embryo axis Embryonic root and shoot.
Endodormancy When internal factors within the seed prevent germination.
Endosperm Tissue that results from the second haploid male sperm cell fusing with two egg cells during fertilization.
Genotype Genetic composition of an organism.
Lipids Compact plant oils that store energy; also called triglycerides.
Pericarp Ripened ovary wall; made-up of three parts: exocarp, mesocarp, and endocarp.
Phenotype Physical appearance of an organism.
Plumule First true leaves of the plant; emerge from the seed, rise above the soil surface, and start to collect energy from the sun.
Proteins Sources of amino acids for production of enzymes and other nitrogen-rich compounds in the seed.
Quiescent When a seed does not germinate until given proper conditions for germination (oxygen, water, temperature, and sometimes light).
Saturated
fatty acids
Fatty acids that have no double bonds in the chain with all carbon atoms in the interior of the chain having two attached hydrogen atoms.
Scarification Process used to break a physical seed dormancy (hard seed coat).
Seed coat Outer layer of the seed.
Stratification Process used to break a physiological dormancy, such as embryonic or endo/eco-dormancies.
Triglycerides Another name for lipids.
Unsaturated fatty acids Fatty acids that have one or more double bonds between one or more carbon atoms in the chain, lack some hydrogen atoms, and therefore the carbon atoms are not saturated with hydrogen. | textbooks/bio/Botany/The_Science_of_Plants_-_Understanding_Plants_and_How_They_Grow_(Michaels_et_al.)/09%3A_Seeds/9.02%3A_Seed_Physiology.txt |
Learning objectives
• Understand why plants are grafted or budded and the techniques used for specific outcomes.
• Describe how a graft union heals.
• Compare and contrast how a plant responds to wounding versus healing a graft union.
• Characterize the differences between bulbs and other storage organs.
• Describe techniques for propagating plants with different clonal strategies from storage organs.
Some plants do not produce sufficient seed or lack competency to form adventitious roots by making cuttings, and we are left with grafting as a method of choice for asexual propagation. Grafting is the cloning of a scion or bud onto a rootstock, but adds the possibility of manipulating shoot properties through the choice of rootstock. Other plants clone themselves naturally and may use special storage organs to help with perenniation. These can develop offsets, pups, and other clonal storage organs. The plant propagator can also induce these tissues to form more propagules. Excellent examples include bulbs, corms, and rhizomes.
Thumbnail: Grafted cactus. hmerinomxCC BY-NC-SA 2.0
10: Grafting
Learning objectives
By the end of this lesson you will be able to:
• Explain why plants are grafted or budded and the techniques employed for specific uses.
• Describe how a graft union heals.
• Compare and contrast how a plant responds to wounding versus healing a graft union.
Grafting
Grafting is the art and science of connecting two pieces of living plant tissue together in such a manner that they will unite and subsequently grow and develop into one composite plant. The union of these two different plant materials via grafting creates a chimera, — two different plant genotypes growing together in the same plant. The roots of an apple tree in a commercial orchard, for instance, likely came from a plant with a genotype that induces dwarfing of the tree. The picture below shows the swelling of the graft union a few inches above the soil surface.
Grafting is means of asexual reproduction, which is vegetative propagation. The scions are exact genetic copies, and are sometimes called clones or clonal propagation. Although the graft can combine two different plant types, species, or even genera between the scion and rootstock, the scion material being propagated is an exact genetic copy of the parent plant that donates the vegetative parts used in the graft. Usually the scion or bud and rootstock are the same species, because this favors compatibility and successful grafting. The rootstock can thus be from mixed types, but the scion is from the same plant type for clonal propagation.
The shoot of a grafted apple tree, for example, comes from a plant with great-tasting apples, while the rootstock may not produce great apples. The root and shoot were grafted together and the tree grows as one plant, but with two genotypes: the roots have one genotype — one set of genes — and the shoot another, yet they are all growing as one plant. That’s a chimera.
When a horticulturist makes a graft, as in the apple trees above, one genotype of the tree species is typically used for the above-ground part of the plant, called the scion, and another for the below-ground portion, called the rootstock. A grafted plant has a scion growing on a rootstock, and the scion and rootstocks have different genotypes. In many grafting situations the scion and rootstock are of similar diameter, uniting the two genotypes where the graft union is made.
Grafting is a very old horticultural technique; there are historic records of horticulturists grafting olives 2,000 years ago. They may not have known how the cells divided and healed, but they knew how and why to graft.
Reasons to graft
While grafting is a valuable vegetative propagation technique, not all plants are easily grafted. For those that do respond well to grafting, there are different reasons for employing the technique.
Create unique, commercially desirable ornamentals
For photosynthesis to take place, a cacti growing as yellow or orange cannot live without the rootstock. Cactus propagation is commonly done by grafting; the cambiums are aligned, and the two are held together, often by rubber bands. This is often referred to as a modified method of cleft grafting.
Perpetuate genotypes that do not root from cuttings
Japanese maples, above, have highly desirable leaf and plant forms. Genotypes don’t root successfully from cuttings, but can be grafted onto a rootstock grown from seeds of less desirable types. The seedlings provide great rootstocks, and the shoot that has been grafted onto this rootstock expresses the highly desirable plant type. In this process horticulturists usually use T-budding, addressed later in the course.
Conifers: Colorado blue spruce cuttings don’t root easily either, but blue spruce scions can be grafted onto Norway spruce rootstocks grown from seed to form a strong plant with the highly desirable blue spruce color and form.
Change cultivars
Most fruit trees, including apple trees, can survive for many years. In commercial apple orchards, some trees might be of cultivars that are no longer popular. Instead of pulling out these trees and planting young trees of a new cultivar, which difficult and expensive, new scions can be grafted from popular cultivars onto older trees after cutting those trees back to stumps. This is called cleft grafting or, more commonly, “topworking.” By putting the new scion on an established rootstock, an orchard will come back into production much sooner than if new, young trees were planted.
Produce trees with specialized forms
In the case of some flowering trees, like cherry and dogwood, propagators graft a weeping-type scion (one that looks like an umbrella rather than growing upright) onto a 3′ to 5′ standard rootstock. The “weeping” form has branches that arch downward rather than upright. The graft union is far above the ground rather than down by the soil, as is typically the case with grafted maple, spruce, and fruit trees. These weeping-habit trees are more prone to poor wound healing and regrowth of the rootstock at the point of the graft union.
Repair damaged plants
The idea here is to create a graft that re-unites the cambium in the tree trunk after being severed by a chewing rodent or mechanical damage such as might be dished out by an indiscriminately piloted weed whipper. The graft is inserted into a point below the damage and runs to a point above the damage. This grafting operation is particularly important when the tree is girdled or nearly girdled (the cambium is damaged all the way around the trunk) because otherwise the tree will die. This technique is called bridge grafting and can be quite successful in saving a tree. The picture is from Maple Valley Orchards where they bridged grafted several trees to save them from dying. You can see how the cambium and phloem have both been disrupted.
Take advantage of rootstock characteristics
All fruit trees grown in Minnesota are grafted, primarily in order to make the trees shorter. In apples, there are numerous rootstocks to choose from. If you are interested in growing Honeycrisp apples, for instance, you can grow a tree that will be anywhere from 6 feet tall at maturity to 25 feet tall at maturity, depending on which rootstock you choose. Same cultivar, “Honeycrisp,” but a different root system.
In a home landscape, many of us can think of a place for a tree that might grow to 12 feet high, but not many of us have places to grow trees that will get to 25 feet. In commercial orchards, almost all the trees that have been planted in the last 30 years are on dwarfing rootstocks. These trees are far easier to harvest, prune, and maintain.
Some rootstocks offer improvements in disease and insect resistance, or environmental stress such as cold or drought tolerance.
Grafting challenges
There must be a good reason to graft, and no easier or cheaper way to produce the desired plant. For most plant material that is grafted commercially, such as apple or peach trees, there is no other way to preserve the desired scion cultivar.
Grafting is an art. People who have grafted a lot of plant material understand aspects of their plants that will increase success, such as choosing compatible genotypes and matching stem diameters. Experienced grafters also know the timing of growth stages to increase grafting success. For example, whip and tongue grafts are done when both the rootstock and scion are dormant. In contrast, t-budding is done in August when the bark is “slipping” and the buds themselves are newly formed.
So why don’t grafts heal and produce new plants? Some of the reasons include:
• The type of plant is not conducive to grafting. Dicots and gymnosperms both have cambium encircling the stems, so aligning is possible. Monocot stems have cambium scattered around the stem, so aligning cambia between two plants is basically impossible.
• While the same species are often compatible and a successful graft results, as the relatedness decreases between the scion and rootstock, for example with different genera, grafting success is significantly reduced.
• Time of year and growing season both make a difference in graft success. Grafting success is more likely when the cambium is actively growing, but leaf growth is minimal, because water loss is at a minimum.
• The environment under which the grafts are healing, including temperature and humidity, is important. Light is less important.
• Technique is VERY important. If there is poor cambial contact, the callus bridge does not form, no vascular tissue is produced, and the grafted plant does not grow.
While most reasons to graft relate to desirable characteristics of the scion, there are situations in which the rootstock genotype or characteristics are also important. For example, apple and grape rootstocks are critical for correct plant form and disease resistance. Outside of those and perhaps a few other exceptions, the point of grafting is to propagate the scion.
Again, because of the expertise, time, and expense required for grafting, grafting is used only if it’s not possible to propagate a plant by other easier and cheaper methods, like planting seeds or taking cuttings. If a plant roots easily, and doesn’t require special rootstock characteristics like dwarfing or resistance to diseases and insects, there is no need for a graft.
Types of grafting and budding
Techniques for grafting have different names and are based on the type of plant material available and its stage of growth. Here are a few of the grafting or budding methods and when they are used.
Bridge grafting
Bridge grafting is used to repair damage to tree trunks. Smaller-size woody branches are used to reconnect the vascular tissues in the trunk so that water can flow up the trunk and sugars can flow down. These branches are the conduits.
Whip and tongue grafting
The whip and tongue graft is used when the rootstock and scion are the same size. If you have two pieces of woody plant material that are the same size in diameter, it is fairly easy to line up the cambium of each piece and slip the two pieces together. The video linked above shows the steps of this type of grafting, including the cuts that need to be made, how to tie the two pieces together, and the finishing step of reducing water loss at the graft union by applying a wax. For additional pictures and an explanation of the entire method, Texas A&M has an excellent short article with more information.
Approach graft
In approach grafting, the scion is often smaller than the rootstock. As the name indicates, the two plant materials are brought close together, the cambiums of both are aligned, and they are allowed to grow together. Often, in plant propagation, we have done approach grafting by using potato as the rootstock and tomato as the scion (remember that these two plants are closely related). Using the same methodology described above, the tomato and potato plants are potted into the same pot, a thin slice is taken off each stem to reveal the cambium, and the stems are tied together. When the graft heals, the plant on the top will produce tomatoes, and the one on the bottom will produce potato tubers that can be harvested at the end of the season. For a bit more reading, and a few more pictures, see the Texas A&M article.
Cleft grafting
Cleft grafting is a technique which allows the union of a rootstock that is much larger in size than the scion. It is conducted in late winter, when both the rootstock and the scion are dormant. Common applications for cleft grafting include changing the variety of an existing orchard (also called topworking), adding a branch of an untested scion cultivar to an existing tree for observation, or repairing a tree that may have had a branch broken off by storm damage or fruit overloading. The technique can also be used for producing one tree with multiple cultivars on it. Have you ever read about an apple tree with 10 different types of apples on it? This is one method that can be used to make that happen.
T-budding
T-budding is done when bark is “slipping,” meaning the plant is actively growing. The technique is used frequently because it does not require as much plant material of the scion. This is particularly true with new plants, such as a new apple genotype, from which you want to propagate as many trees as possible. T-budding requires only one bud to make one tree, while whip and tongue grafting uses more buds per tree.
The grafting site at University of Missouri Extension is a great place to visit for more information.
Another interesting video highlights the work of a Syracuse art professor and his development of a single tree with 40 different types of plums, peaches, and apricots on it. What type of grafting did he practice?
Review questions
1. How does grafting result in a chimera?
2. What is the difference between grafting and budding? Why would you use one over the other?
3. What types of plant habit can be produced through grafting onto special rootstock? Why are these habits desirable?
4. Provide three good reasons to use grafting and three reasons not to use it.
5. Provide two reasons why grafts are not successful.
6. What type of grafting is recommended to repair trunk damage?
Wound healing
What happens when you graft?
First, recall what happens when you do a stem cutting:
• The cells along the cut surface are sliced open, die, and become necrotic (dead) tissue.
• The surviving cells one layer in from the cut (parenchyma cells in the cortex) respond to the wound. There are two responses:
• The cells rapidly exude compounds like suberin (gummy substance) to protect the plant from excess water loss and invasion by diseases and insects.
• The cells are stimulated to divide and produce a mass of new cells to cover and protect the wound. The mass of new cells is called callus. This response takes quite a bit more time (like years) compared to the time required to exude suberin (hours).
From the plant’s point of view, the slicing that happens when making a graft is similar to the slicing that happens when you make an incision in the stem for a cutting. You are still slicing open cells, but because the rootstock and scion are in close contact, the environment around the cut ends is quite different from a cutting in which the wound is exposed to the environment. With a graft you have two stems that are held in close proximity and therefore are more protected than the open wound of a cutting.
• Within a few days, cell division starts and a callus of undifferentiated cells forms. The callus cells will continue to differentiate by developing cells with specialized form and function maturation of new cambium, xylem and phloem.
• The callus originates from parenchyma cells in the cortex, pith, or vascular bundles. The origin depends on the species.
• The callus grows from both the scion and rootstock.
• Callus from the rootstock and scion grow together to form a callus bridge.
• The parenchyma cells in the callus bridge that lie between the cambium of the rootstock and the scion differentiate into cambium cells.
• Additional parenchyma cells on either side of the cambium may differentiate into xylem and phloem until a connection among xylem, cambium, and phloem has been formed across the callus bridge.
• Once these links are formed, the cambium begins to initiate new xylem and phloem.
• Differentiation of the xylem and phloem is faster where cambium layers are closely aligned.
Again, it is important when grafting to get good cambium-to-cambium alignment between scion and rootstock. This will promote development of cambium cells that will differentiate into the callus bridge. The callus bridge is what joins the scion and rootstock. If your technique has poor cambial alignment, or gaps between scion and rootstock at the graft junction, the cell-to-cell linkage will not happen, or it will only happen weakly, and the graft will fail because there is no new xylem and phloem production, and therefore no water or sugar transport pathways. In addition to this being a linkage of plumbing so that water and sugars flow, it is also a structural linkage that gives the plant strength and rigidity across the graft union.
Five requirements for making a successful graft
1. The rootstock and scion must be compatible. Even if they are from the same species, some scions won’t graft on to some rootstocks.
2. The cambial layers of the rootstock and scion must be closely aligned and in contact.
3. The graft must be done at the appropriate time of year. The buds, whether grafting whole stems or just the buds themselves, must be dormant. In temperate latitudes, grafting is typically done in winter when rootstock is also dormant, but budding is done late in the growing season when buds are formed, but dormant, and the bark is “slipping” so that a T-shaped cut in the bark can be opened into a pocket for the bud (image on the right).
4. Grafts must be protected from drying.
5. The grafted plant must receive proper post-graft care such as removing sprouts and suckers that emerge from the rootstock and might be mistaken for scion, and pruning or training the scion so that it develops the appropriate plant form.
Review questions
1. Shortly after a plant is wounded, what is the first response of the surviving plant cells adjacent to the wound?
2. When a wound heals, what cells are stimulated to divide?
3. What types of tissues must be formed from the parenchyma callus if the graft is to be successful?
4. How does the stage of plant growth differ for budding compared to whip-and-tongue grafting? | textbooks/bio/Botany/The_Science_of_Plants_-_Understanding_Plants_and_How_They_Grow_(Michaels_et_al.)/10%3A_Grafting/10.01%3A_Grafts_and_Wounds.txt |
Learning objectives
By the end of this lesson you will be able to:
• Characterize the differences between bulbs and other storage organs.
• Describe techniques for propagating plants with different clonal strategies from storage organs.
• Demonstrate other ways in which plants colonize through natural clonal propagation.
Geophytes
Plants called geophytes have evolved to store carbohydrates and nutrients underground in special structures which allow them to regenerate during the growing season.
Unlike trees and shrubs that keep their dormant buds above ground during the winter, some plants keep their dormant nodes underground. Other plants may grow and store their nodes under water in a pond or stream. Many orchid species live in trees and are called epiphytes. The specialized storage organs have several roles which allow them to perenniate and colonize. This short video will introduce some of the special organs that you are likely already familiar with (3:27).
These organs store carbohydrates that can be used for rapid growth when favorable conditions return. They protect the nodes from injury from herbivory and injury (frost and freeze), and are a natural form of cloning by producing new daughter plants away from the mother plant. The plant propagator uses techniques that take advantage of these natural processes and can therefore rapidly increase the number of plants.
Bulbs
The onion and lily family (Liliaceae; monocots) are typical examples of bulb-producing herbaceous perennials. The bulbs are subterranean, which prevents them from predation and weather conditions. Bulbs consist of a highly condensed stem (with nodes and internodes) and adventitious roots that form along the basal plate. Two main types of bulbs include imbricate and tunicate. Imbricate bulbs, typical of some lily species, consist of scales, as shown in the photo below. Scales are specialized leaves that form radially around the meristem. During the growing season, leaves and a stem emerge from the soil from the center of the plant, where the apical meristem is located. These above-ground leaves are able to photosynthesize. The central meristem converts to a floral meristem where flowers are produced. New lateral bulblets form from the meristem in axils underground, allowing the plant to colonize and perenniate. In some cases, the main bulb may not continue to grow as the meristem has converted to flowering. The new bulbelts can be removed to produce new daughter plants. The plant propagator can remove scales from the bulb and create a new daughter plant from each. This scaling technique is highly effective, though it may take several years for the new plantlet to flower again.
Tunicate bulbs (below), or those with paper coverings, are exemplified by onions, tulips, and garlic. Specialized leaves make up the mass of the storage organ for the plant and form concentric rings around the meristem. Typically, when we cut an onion from the tip through the root end, we can see the layers of leaves (the parts that we eat) and then stem at the bottom. We know it is a stem because there are nodes and internodes. When cooking, we typically discard the stem, basal plate, and adventitious roots. To view the different structures of a bulb during the growing season, look in particular at green onions, scallions, and leeks. Newer leaves form in the interior of the bulb (the apical meristem is in the middle) and the papery skin is the oldest layer formed. From the middle of the bulb, leaves emerge to photosynthesize when the conditions are right, and the floral meristem emerges from the middle. Lateral tunicate bulblets may form inside the main bulb, or along the exterior at the basal plate, especially if there is an injury. Scooping the basal plate is one way to induce bulblet formation. The basal plate can also be scored to have a similar effect.
To propagate a tunicate bulb, it can be sectioned in many pieces by cutting from top to bottom through the basal plate. The sections are allowed to dry for a few days, treated with a fungicide, and then planted in a cold frame or other suitable system to induce bulb formation and plant regeneration. It may take several seasons for the bulbs to develop a suitable size for flowering. When doing any sectioning, scaling, scoring, or scooping the tools should be cleaned between cuts, or at the very least between bulbs, to prevent the spread of disease. Alcohol is suitable for killing microbes and for cleaning the cutting surface and fingers.
Liliaceae is unique in that bulb-like organs may also form above ground. In this family, bulbils, shown in the photo above, are formed in the leaf axils above ground or in some flowers. Bulbils are clonal (asexual) propagation and not formed through pollination. When the lily’s flower stalk dies, it falls to the ground and the bulbils are scattered away from the mother plant. This colonization strategy is highly effective and can be very weedy for the gardener. Mature or “ripe” bulbils can be removed from the plant and potted as soon as they easily detach. Alternatively they can “self sow” and be moved the following spring.
Some bulbs develop contractile roots that pull the bulbs into the soil. As bulbs grow each year, they would logically move closer to the surface, putting them at risk. The contractile roots are able to get the bulb to the proper depth after a growing season.
Corms
Like bulbs, corms are underground storage structures that have evolved in some plants. Corms are a storage unit made of compressed stems, unlike the leaves that provide the storage function in bulbs. Because they are stems, corms have nodes, internodes, and meristems just like above-ground stems. The roots of corms are adventitious and develop from a basal plate and nodes. Corms may be short-lived in herbaceous perennials like Gladiolus, where a new corm is replacing itself regularly; in tropical climates, taro (Alocasia) may grow for several years with the same corm structure. The giant elephant ear plant above shows a corm structure. Corms reproduce asexually through cormels, akin to the bulblets produced by bulbs. Watch this short video (0:47) to see a closeup of this corm.
Corms can be induced to produce cormels by removing the apical bud, which removes dominance and stimulates new growth at the nodes. This is generally not necessary, as many corm-producing plants naturally increase with new corms annually. In the photo above, the corm on the left shows the aggressive nature of colonization. The oldest corm at the bottom is being replaced by the actively growing corm attached above it. We can also see two cormels that have formed (red arrows). Eventually the lower, older corm will dessicate and decompose. This is a great example of why some geophytes have contractile roots, for in one growing season the newest cormel could grow above the soil surface.
Rhizomes
Rhizomes are also underground stems. The Canna lily (below) produces large rhizomes each year. Notice how it looks a lot like ginger “root;” the two plants are in the same family. As stems, they have nodes that produce shoots and they have adventitious roots. Rhizomes typically grow horizontally at or near the soil surface. Some grasses use rhizomes to help with rapid colonization from the crown. Rhizomes can be divided into many pieces as a way to produce multiple clonal propagules.
Tubers
Potato (Solanum tuberosum L.) is the typical example of a common plant that uses a tuber for storage and propagation. Tubers are another example of an underground stem, with nodes and internodes. The nodes may not be obvious when the potato is fresh from the grocery store, but in storage the potato may grow “eyes” which are new shoots that are growing from the once dormant nodes. Most people have seen this in their pantry or on the kitchen counter. To plant potatoes, the farmer cuts up pieces of the last year’s potatoes so there are enough carbohydrates and nodes for a new plant to emerge from the soil.
Roots
We’ve already learned that roots play an important role in storing nutrients for plants. Biennial plants like carrots, parsnip, and beets have fleshy roots which help them overwinter. These are not easy to propagate into new plants and typically are grown from seed. Horseradish and some poppy plants, however, can easily be propagated from root cuttings. A common example of a tuberous root is the sweet potato (looks like a tuber, functions like a root). The common garden radish (Raphanus sativus) may seem like a root, but close investigation reveals that it is mostly the swollen hypocotyl (image below).
Other methods of colonization
Crowns
Hosta plants are common examples of herbaceous perennials that are excellent at colonizing through an underground crown. The underground stem grows radially each year. New shoots can be removed, as shown below. Notice the adventitious roots. Many perennial grasses, asparagus, and other herbaceous perennial plants can be divided into multiple new plants, taking advantage of this colonization strategy. Offshoots (sometimes called pups) can be removed from the mother plant and replanted elsewhere.
Agave plants – which are used to produce tequila – are clonally reproduced this way, as seed production results in new genetic recombinations that are different from the mother plants. Clonal propagation ensures reproducibility for uniform forms and consistent tequila production. Gardeners have been using this method to propagate plants for millenia.
Stolons
Perennial grasses and strawberry (Fragaria spp., photo below) are excellent examples of plants that produce runners or stolons that extend the reach of the mother plant for colonization. These above-ground stems (there are underground examples as well) are not for storage, as in the previous examples, but are adaptations to reduce local competition with the mother plant while also spreading her genetic material. A strawberry stolon may root adventitiously at a node and produce a new plant from the bud (remember, buds are located at nodes and form into new shoots). The stolon likely will continue to grow and do the same at each node thereafter. A gardener can peg the stolon into the soil to help the plant root, then remove it later and replant it.
Stem layering
Plants with stems that creep along the soil or whose shoot tips bend and touch the soil take advantage of being able to form adventitious roots for colonization. Some raspberry species (Rubus occidentalis), for example, grow long canes after fruiting, which extend beyond the mother plant and push their shoot tips into the soil. In the photo below, the plant grows roots and reorganizes the developing shoot (see how the leaves face upward). Now anchored into place, a new crown can form, often several feet from the mother plant. Vining and climbing plants often can root at each node, which makes them able to grow along the forest floor until they find a structure to climb. This adaptation can allow clones of the same plant to “move” over time to conditions that are more favorable. This may be more evident in tropical regions, where plants grow faster and local conditions can change suddenly. Vining plants, like grape (Vitis), are often easy to root from hardwood cuttings because they have evolved to root quickly at a node.
10.03: Terms
Approach graft A type of grafting where two independent plants are grafted together and severed only once the graft has “taken.”
Bridge graft A type of repair graft used when a plant has been girdled; scion pieces are inserted above and below the girdled site and act to repair the disruption of the cambium.
Budding A form of grafting where a single scion is used rather than an entire stem.
Callus Growing mass of unorganized parenchyma cells produced in response to wounding.
Callus bridge Parenchyma cells that lie between the cambium of the rootstock and the scion and differentiate into cambium cells.
Chimera When two different genotypes are growing on a single plant.
Cleft grafting A form of grafting where the rootstock is much larger than the scion; both are dormant.
Corm A condensed stem and storage organ; typically growing underground and covered in scale leaves.
Differentiation Process by which cells or tissues undergo a change toward a more specialized form or function.
Genotype Genetic composition of an organism.
Geophyte New growth begins underground and the function of the underground growth is storage of food, nutrients, and water during adverse environmental conditions.
Graft union Location where the rootstock and scion meet.
Grafting Art and science of connecting two pieces of living plant tissue together in such a manner that they will unite and subsequently grow and develop into one composite plant.
Imbricate bulb Underground storage organ formed primarily of modified leaves (scales) without a papery covering. Individual scales do not encircle the entire bulb.
Pruning Cutting away dead, overgrown, or unwanted branches or stems to improve safety, aesthetics, or productivity.
Rhizome Stem that grows horizontally underground and is a swollen storage organ for the plant.
Rootstock Portion of a graft that contains the root system.
Scion Portion of a graft that contains the shoot system and all above-ground parts.
Stolon Creeping horizontal stem, sometimes called a runner, that roots and forms plantlets at nodes that extend away from the mother plant.
Suberin Impermeable (to water and gases), waxy substance present in the cell walls of corky tissues.
T-budding A type of budding performed using dormant scion buds on actively growing rootstocks; typically done outdoors in late summer.
Topworking A type of grafting performed on established orchard trees.
Tuber A thickened underground stem used as a storage organ for many plants to allow for perennation.
Tunicate bulb An underground storage organ formed primarily of modified leaves formed in concentric circles around the active meristem. The bulb is covered with a papery covering.
Whip and tongue graft A type of graft where both scion and rootstock are dormant and the same diameter; much more secure than other types of bench grafts. | textbooks/bio/Botany/The_Science_of_Plants_-_Understanding_Plants_and_How_They_Grow_(Michaels_et_al.)/10%3A_Grafting/10.02%3A_Unique_Storage_Organs.txt |
Learning objectives
• Understand the meaning of photoautotroph and where in the plant the various photosynthetic reactions take place.
• Explain how the energy from light is converted into carbon-based chemical energy and building blocks in plants
• Map the movement of water from the roots to leaves and carbon-based building blocks from source to sink.
Plants are sessile and cannot move to locations that might be more suitable for growth and reproduction when environmental conditions become less than favorable. To maintain growth, plants monitor signals of light, temperature, humidity, wind, and soil water availability; these signals inform the plant on how to modify water movement and gas exchange, which also affect photosynthesis. These lessons review how these signals impact physiology and the role of photosynthesis in growth.
Thumbnail: Guttation - water droplets on leaf margin. (Public Domain; Noah Elhardt via Wikipedia)
11: Water and Light
Learning objectives
• Summarize the mechanics of evapotranspiration.
• Describe how leaves adapt to lack of soil moisture.
Evapotranspiration
Most of the water molecules taken up by a plant’s roots move up the stem into the leaves, out the stomata in the leaves, and then evaporate into the atmosphere. The stomata open to allow oxygen (as a waste product of photosynthesis) to escape the leaf, and carbon dioxide (donor of the carbon atoms that are the building blocks of the sugar molecules assembled during photosynthesis) to enter. When these stomata are open, water vapor exits. We often refer to stomata as associated with gas exchange in the leaves because of the movement of these three gasses: oxygen (out), carbon dioxide (in), and water vapor (out).
Evapotranspiration (often just called transpiration) refers to the movement of water in the plant from root to stem to leaf and out through the stomata to the atmosphere. This isn’t just a dribble of water. An acre of corn will transpire about 3,000–4,000 gallons of water each day, and a large oak tree can transpire 40,000 gallons each year.
As illustrated above, a stream of water is constantly moving up from the roots and out of the plant. Note the tissues and cells that are involved, and recall that water moves from the soil through the epidermis and cortex toward the xylem in the vascular bundle in one of two ways, symplastically or apoplastically. Symplastic means that water and minerals move interior to the cell membrane, or through cells, while apoplastic water moves around the cell membrane in the space outside the cell. Symplastic movement starts with water entering the epidermis cells through root hairs and then continuing from cell to cell through the cortex to the xylem in the vascular bundle. Entry of symplastic water into the root is regulated by the cell membrane of the root hair. Apoplastic movement of water occurs between the cells. This movement is unregulated until the water hits the cutin barrier formed by the Casparian Strip around the innermost layer of cortex cells in roots The Casparian strip blocks apoplastic water movement. The apoplastic water must then move symplastically into the cortex cells through the cell membrane, which controls the entry of water and minerals. From here, the water moves from cell to cell to the xylem, and then is pulled up the plant as described below.
The rate of evapotranspiration depends on environmental factors such as:
Light — Due to the occurrence of photosynthesis, plants transpire more rapidly in the light than in the dark. The guard cells, part of the stomata, are stimulated to swell, opening the stomata in the light of the day.
Temperature — As temperatures rise, water evaporates out of the leaves more readily. On hot summer days, leaves thus have a tendency to wilt due to lack of water in the soil and to the increased rate of transpiration.
Humidity — When the air around the leaf is drier, there is greater movement of water vapor out of the leaf than if the air around the leaf is saturated with water.
Wind — A breeze will clear water vapor away from the surface of the leaf, leaving the humidity on the leaf surface low and increasing the rate of transpiration.
Soil water availability — The water that is transpired must come from somewhere, and that somewhere is the soil. When the roots can’t absorb enough water to keep up with the evapotranspiration demand, the leaves lose more water than they can replace. Water pressure inside the cells, called turgor pressure, is reduced because some water is pulled out of the cells to satisfy the demand from evaporation. This loss of turgor pressure relaxes the guard cells, causing the closure of the stomata, which shuts off a major avenue for gas exchange and the main channel for evaporation. This is a key strategy used by plants for managing stress from insufficient water. If the loss of turgor is severe, the plants will temporarily wilt. When the evapotranspiration demand is reduced through a change in environmental conditions, or when water supply increases, the cells again fill with water, turgor is reestablished, the stomata reopen, and the plant leaves recover from their temporary wilting. You have likely seen this happen when you have forgotten to water a house plant. So long as you water it soon enough, the plant regains turgor and survives the neglect.
Review questions
1. What is turgor pressure and how do leaves compensate when cells begin to lose turgor?
2. How can wind result in low turgor pressure?
3. What are three gasses that move through the leaf stomata? What is their involvement in plant function?
Mechanisms of water movement in plants
How does water move from the soil to root to stem to leaf and out to the atmosphere? This is a more complex question than it may first appear. Unlike animals, plants do not have a heart to pump water from roots to leaves. There is a push explanation and a pull explanation.
Push explanation
Water pressure (turgor) in the root cells during the night or during cloudy days can push water and dissolved materials up into the stem. This root pressure is the cause of guttation, the dew-like drops of water that are forced out of leaves. This same pressure is the force driving sap up the trunk of sugar maples in the spring. One problem with this mechanism is that, at most, root pressure can move water upwards only about 60 feet, and this only happens at night and when it is cloudy, and it only happens in some plants, but not in them all. So the push explanation has many limitations that make it unsatisfactory as a general theory for water movement up the xylem. How does water get to the top of a plant when it is sunny? And how does it make its way to the top of tall plants?
Pull explanation
The cohesion – adhesion – tension theory
Water is a polar molecule — like a magnet, it has positive (+) and negative (-) regions. When water molecules are near one other, the negative region of one molecule is attracted to the positive region of another. This attraction is called a hydrogen bond. This type of bond is weak compared to covalent bonds, where molecules share electrons, but when there are lots of hydrogen bonds holding these water molecules together, this type of chemical bonding is quite tenacious.
When water is held in a very small tube, such as an xylem vessel (above), the cohesion among water molecules due to the hydrogen bonds is very strong — strong enough to hold the column of water together very tightly over long distances, like from the root through the stem and into the leaf. Although an individual bond is weak, there are so many that a column has enormous tensile strength.
Water is also attracted to the walls of small tubes like xylem vessels. This force of adhesion between the water and walls of the xylem helps hold the water in the xylem against the downward force of gravity.
As a water molecule moves out of the leaf xylem into the air spaces among spongy mesophyll cells, out the stomate, and into the atmosphere through evaporation, it creates a void or empty space in the xylem, which is filled by the next water molecule in line. As this water molecule moves forward, it exerts tension (pulls) on the cohesive column of water that extends all the way back down to the root. As one water molecule leaves, the next takes its spot, and as it moves forward in line, it pulls upward the molecules behind it.
This force of cohesion-adhesion-tension is sufficient to pull water up to the top of the tallest tree, and is very effective while the sun is shining, when the stomata are open and transpiration is active.
The enormous flow of water through the plant isn’t simply waste and the price the plant pays for having stomata open for oxygen and carbon dioxide exchange. Transpiration also:
• Provides water for photosynthesis (although not that much is needed — only about 1–2% of what is transpired).
• Moves minerals up from the roots for use in the leaf.
• Cools the plant through evaporation.
Review questions
1. What is guttation and what type of water movement mechanism is involved?
2. Identify the source of cohesion, adhesion, and tension in the theory of water movement that goes by that name.
3. Why could plants suffer nutrient deficiencies when they are grown in high humidity conditions or situations like greenhouses where there is no air movement? | textbooks/bio/Botany/The_Science_of_Plants_-_Understanding_Plants_and_How_They_Grow_(Michaels_et_al.)/11%3A_Water_and_Light/11.01%3A_Plants_and_Water.txt |
Learning objectives
• Understand the meaning of photoautotroph in reference to plants.
• Explain how the energy from light is converted into carbon-based chemical energy and building blocks in plants.
• Identify where in the plant the various photosynthetic reactions take place.
• Explain how the carbon-based building blocks move to other parts of the plant and are used for energy, storage, and structures.
Photoautotrophs
Plants are autotrophs, meaning that they are self-nourishing (Greek autos = self and trophe = nutrition). Specifically, plants are photoautotrophs, because they use the energy from light to produce organic molecules with which they build their cells and store energy.
Organic molecules are compounds associated with living organisms that contain carbon atoms. It was once thought that organic molecules could only be synthesized in nature by living organisms through the intervention of a “life force.” This hypothesis was disproved in 1828 when urea, a simple organic compound, was synthesized in a laboratory. Since that time, a major branch of chemistry, organic chemistry, has arisen to study and synthesize organic molecules. In contrast to organic compounds, inorganic compounds were historically defined as those lifeless minerals that are dug up from the ground.
Note that this chemical definition of organic (containing carbon atoms) has little or no relationship to the contemporary use of the word to describe a method of producing food. Organic food production, by regulation, relies strictly on inputs of organic molecules that come from life (like manure) and also on inorganic compounds like minerals, and eschews the use of organic molecules that have been synthesized by humans.
The organic molecules that a plant produces must be:
• Storable within the plant.
• Metabolized by the plant to yield energy for use in growth, maintenance, and producing other required organic molecules.
• Reasonably compact so that enough energy can be stored for growth.
• Transportable within the plant.
• Stable and non-toxic to the plant.
Since plants are photoautotrophs, they must have a mechanism for capturing energy from the sun or other sources of light and using that energy to produce organic molecules with the characteristics noted above. Photosynthesis is the process on which photoautotrophs rely to capture that light energy and to produce carbon-based organic molecules. The carbon used to make these molecules comes from the carbon dioxide (CO2) in the atmosphere. Because photosynthesis removes carbon from the atmosphere and incorporates it into organic molecules which eventually become the plant’s leaves, stems, roots, and fruits, photosynthesis is sometimes said to fix carbon. Fix, in this sense, means to secure or sequester rather than to repair.
If you follow the public discourse on climate change, you are aware that global warming is accelerated by the accumulation of greenhouse gasses in the atmosphere which trap and re-radiate sunlight and heat back to the earth. CO2 is one of these greenhouse gasses. Removal of CO2 from the atmosphere, for instance by planting trees that photosynthesize, fix carbon, and store the carbon-rich product as wood, is one method of carbon sequestration. An emerging and increasingly popular strategy for remediating greenhouse gas emissions is through the buying and selling of carbon credits, where industries that discharge CO2 into the atmosphere purchase credits from organizations whose activities (such as tree planting) sequester carbon. Photosynthesis and sequestration of carbon by trees is one tool used to offset the industrial release of CO2.
Review questions
1. In what sense does photosynthesis fix carbon?
2. Where does the carbon come from that is used by photosynthesis, and where does it go within the plant?
Light reaction
Let’s start with light, because that’s where the plant gets the energy for photosynthesis. Here are some characteristics of light:
• Light travels in waves.
• The length of the wave is measured from one peak to the next and is called the wavelength, which differs for different colors of light.
• Within the visible wavelengths of light, the longest wavelengths are red light; outside the visible range of wavelengths, even longer wavelengths include infrared radiation, microwaves, and radio waves.
• Shorter visible wavelengths include blue and purple light, and beyond the visible range even shorter wavelengths include UV light, X-rays, and Gamma rays
• Light also has a particulate nature, and those particles are called photons.
The photons in light provide the energy that drives photosynthesis. This energy is used to incorporate carbon found in CO2 from the atmosphere into organic molecules and, in particular, into simple sugars used by the plant. The chemical formula is the same for the two types of simple sugars produced by photosynthesis: glucose and fructose: C6H12O6. The equation that summarizes photosynthesis is:
water + carbon dioxide -> oxygen, water, and simple sugars
12H20 + 6CO2 -> 6O2 + 6H2O + C6H12O6
This balanced equation tells us that 12 molecules of water plus 6 molecules of carbon dioxide, in the presence of chlorophyll, accessory pigments, and light, produces 6 molecules of oxygen gas, returns 6 molecules of water back to the cell, and produces one molecule of a simple sugar like glucose or fructose.
Two reactions make up photosynthesis: the Light Reaction (abbreviated LR) and the Light Independent Reaction (abbreviated LIR). As the names suggest, the LR requires light while the LIR does not. The LR uses light energy to split water, which transforms the energy from the sun into hydrogen ions and electrons. The LIR uses that energy to grab the carbon from carbon dioxide and use the carbon to build simple sugars.
Let’s start with the light reaction. You’ve heard of chlorophyll, and may recognize this molecule as a green pigment that captures light for photosynthesis. There are two chlorophyll pigments in plants that are critical for absorbing light: Chlorophyll a and Chlorophyll b.
The graph above shows % absorbance of different wavelengths by these two chlorophylls. The Y axis (the vertical one) shows the percentage of the light that is absorbed (rather than reflected). High levels of absorption mean that the chlorophyll molecule uses that wavelength of light for energy. Low absorption means that the molecule does not use that wavelength, and is thus reflected away. The X axis indicates the wavelength of light in nanometers (nm) (the wavelength of green light, roughly 500 nm). The bar at the top represents the color of the light at the wavelength shown. The blue line is a typical absorption curve for chlorophyll a, while the green line shows chlorophyll b.
High absorbance at a particular wavelength means that pigment is collecting that light at that wavelength to harvest energy. Low absorbance means that the plant is reflecting that light back. Both chlorophyll a and b absorb blue and red light wavelengths and reflect green. Chlorophyll a has a peak in the violet and red regions and chlorophyll b in the blue and orange regions. Notice how their absorbance is very low in the green region. That’s why we think of chlorophyll as green, and why we perceive leaves, which have chlorophyll as the predominant pigment, as green. Also notice that chlorophyll reflects some yellow wavelengths, but when the yellow and deep green wavelengths are mixed, we see the green leaf color.
The graph above shows the absorbance of carotenoid pigments, which are present throughout the growing season. Carotenoids are called an accessory pigment in photosynthesis. They assist chlorophyll in light capture and energy transfer, and contribute to the regulation and moderation of excessive excitation of pigment molecules during intense sunlight, including exposure to UV light. Carotenoids absorb light in the green range, but reflect in yellow and red. We don’t see these pigments during the growing season because they are much lower in concentration than the chlorophylls, so the green reflected light overwhelms the orange, and we see green. But when the chlorophyll fades in the fall, due to decomposition of chlorophyll, the orange can be seen in beautiful fall leaf colors.
Chlorophyll a and b, as well as the accessory pigments, are found in the chloroplasts, which are membrane-bound organelles within cells. The highest concentration of chloroplasts is most commonly found in the palisade mesophyll cells of the leaf.
The above illustration of a chloroplast labels the internal structures. The chloroplast has a double membrane. The interior of the chloroplast is called the stroma. Within the stroma are coin-like thylakoids. The stacks of thylakoids are called grana. The thylakoids are also surrounded by a membrane, called the thylakoid membrane. The green chlorophyll pigment that you associate with photosynthesis, as well as the accessory pigments, are embedded in the thylakoid membranes and arranged in a structure called the antenna complex — given this name because it captures and routes the energy from sunlight to a collector called a reaction center.
As shown above, when light hits a pigment molecule in the antenna complex, the energy from the light photon promotes (pushes up) an electron in one of the pigment’s atoms to a higher orbital as seen in the cartoon and energy is gained.
The electron can’t stay in that higher orbital indefinitely, and when it drops back to its home orbital it releases the energy it absorbed from light, denoted as energy loss. This released energy can be passed to another pigment molecule. This process of one pigment capturing the photon’s energy and passing that energy onto adjacent pigment molecules is the crucial step in energy transformation that takes place in photosynthesis. This is the step that takes light energy and converts it into chemical energy — one of the only known biological processes that allows this type of energy transformation.
A light photon excites an electron of one pigment molecule in the antenna complex, or light harvesting complex, and by resonance this energy is transferred from pigment molecule to pigment molecule The energy transfer makes its way to the reaction center, where the first major chemical reaction in photosynthesis — splitting water — takes place. This reaction is called the light reaction or light-dependent reaction because it requires light. Water is split when the reaction center grabs electrons from water, which separates water into oxygen gas (O2), hydrogen ions (H+), and electrons (e).
To reiterate, the light is captured by the light harvesting complex (antenna complex) where electrons in the chlorophyll atoms are excited and jump up to a higher orbital. When the electron drops back, the energy is transferred to an adjacent pigment atom. This resonance energy travels down the antenna complex to the reaction center, where the captured energy pulls electrons out of water molecules, and water is split into oxygen gas, hydrogen ions, and electrons. The energy that was present in the photons of light has been transferred to the hydrogen ions and the electrons. We’ll see more of how that energy is used in the next section.
Review questions
1. What wavelength(s) of light does chlorophyll a absorb? Chlorophyll b? What wavelengths do these two molecules reflect?
2. What pigments make up the antenna complex?
3. How is the energy in light transformed in the Light Reaction?
Recall that the overall equation for photosynthesis is:
water + carbon dioxide -> oxygen, water, and simple sugars
12H20 + 6CO2 -> 6O2 + 6H2O + C6H12O6
This equation is made up of two parts called half-reactions. The first half-reaction is an equation summarizing the Light Reaction, where energy from sunlight is used to split water molecules into oxygen gas, some electrons, and some hydrogen ions. The energy from sunlight is transferred from the pigments to these hydrogen ions and electrons. The half-reaction for the Light Reaction is as follows:
12H2O -> 6O2 + 24e + 24H+
Light independent reaction
The Light-Independent Reaction (LIR) is the second part of photosynthesis. It takes place in the stroma of the chloroplast. Unlike the Light Reaction, it does not require light. In the LIR, two compounds, NADPH and ATP, carry the energy from light that was originally transformed into hydrogen ions and electrons through the splitting of water. The NADPH and ATP, along with carbon dioxide from the atmosphere, enter a process called the Calvin Cycle, where the energy is used to fix carbon into a molecule abbreviated G3P. This process requires the help of an important protein abbreviated RuBisCO (Ribulose-1,5-bisphosphate carboxylase/oxygenase) that catalyzes the step in the process where the carbon from atmospheric CO2 is incorporated into an organic molecule. RuBisCO is the most abundant protein in leaves and, given the number of leaves in the world, likely the most abundant protein on the planet. The G3P produced by the carbon fixation process is called a triose phosphate, meaning it is a 3-carbon sugar (triose) with phosphorus and oxygen atoms (phosphate) attached. Triose phosphate moves out of the chloroplast into the mesophyll cell’s cytoplasm, where two of these three-carbon molecules are combined to produce the 6-carbon molecules glucose and fructose. The glucose and fructose molecules then combine to form sucrose, a 12-carbon organic molecule. Sucrose is important because it is the sugar that is transported by the phloem throughout the plant to provide energy and building blocks for other organic molecules like starch and cellulose.
The half-reaction for the LIR is:
24H+ + 24e + 6CO2 -> C6H12O6 + 6H2O
Review questions
1. Does the Light Independent Reaction require darkness?
2. What sugar is moved throughout the plant through the phloem?
Photosynthesis summary
When we add the two half-reaction equations for LR and LIR together, we get back to the summary equation for photosynthesis:
12H2O + 6CO2 -> 6O2 + 6H2O + C6H12O6
The illustration above is a summary of what happens in a mesophyll cell. The rectangular blue outline represents a palisade mesophyll cell in a leaf. Inside the cell is a green rectangle, representing a chloroplast. Inside the chloroplast is a stack of green ovals with black dots. These ovals are the thylakoids, and the stacks are grana. The black dots in the green thylakoid membrane represent the antenna complexes. Light hits the antenna complex and transfers its energy to pigments, and the energy is funneled to the reaction center where water (H2O) is split in the light reaction to form the energy carriers ATP and NADPH. This is the Light Reaction. The waste product formed at this stage is oxygen, which might be waste for the plant, but is quite useful for us.
In the Light Independent Reaction the energy is carried to the Calvin Cycle, represented by the multi-pointed star in the chloroplast, which uses the energy in ATP, the NADPH, and CO2 from the atmosphere to form the three-carbon G3P triose phosphate with the help of RuBisCO. Triose phosphate leaves the chloroplast and passes into the cytoplasm of the mesophyll cell to be transformed into glucose and fructose, which are combined into sucrose that is exported from the mesophyll cell to the phloem.
Cellulose and starch
Within a plant, the regions of photosynthesis and sugar production are called the source. Leaves are typically the main source within the plant, since that is where most photosynthesis takes place. Those regions that do not support photosynthesis (like roots), but that still need organic molecules to survive, are called sinks. Movement of solutes (molecules dissolved in water) like sucrose from source to sink through the phloem is called translocation. Translocation of sucrose through the phloem to the sink provides cells with a source of stored energy, and also building blocks for organic molecules, as noted earlier. Sucrose can be broken down to glucose and fructose, building blocks used to form other extremely useful organic compounds. Two particularly useful compounds result from the production of long glucose chains: starch, a key energy storage compound in plant cells, and cellulose, the main constituent of the cell wall and key to a plant’s structural integrity. Wood, for instance, is primarily made up of the cellulose-rich cell walls of dead xylem. Both starch and cellulose are long chains of glucose, but they differ in the way the glucose molecules are linked together.
Cellulose is the molecule into which carbon extracted from atmospheric CO2 is sequestered for long-term storage. Starch sequesters carbon for a much shorter period of time because it is either eaten, used by the plant for new growth, or decomposed by bacteria and fungi that can utilize starch for energy.
Review question
1. Define translocation — what molecules are being transported?
To review
• In the light reaction, pigments in the thylakoid membrane capture energy from sunlight.
• The energy is used to split water, which releases oxygen to the atmosphere.
• The energy used to split water is transferred into electrons and hydrogen atoms, and eventually to ATP and NADPH.
• In the light independent reaction, the ATP and NADPH power the Calvin cycle that captures carbon from atmospheric CO2 and incorporates it into simple sugar molecules.
• These simple sugars can be translocated to sinks, where they are used for energy, converted into energy storage compounds, or converted into structural molecules.
Some of the explanations and pictures used in this lecture came from Introduction to photosynthesis and other pages at that McDaniel College site. For additional explanations, an overview of the chemical reactions of photosynthesis, and another description of the properties of light and pigments, navigate to the pages listed at the top of that web page. | textbooks/bio/Botany/The_Science_of_Plants_-_Understanding_Plants_and_How_They_Grow_(Michaels_et_al.)/11%3A_Water_and_Light/11.02%3A_Light_and_Photosynthesis.txt |
Chapter 11 flashcards
Accessory pigments Light-absorbing pigments, other than chlorophyll, that are found in chloroplasts.
Adhesion A force where dissimilar molecules stick together; in plants this force of adhesion between water and the walls of the xylem helps hold the water in the xylem against the downward force of gravity.
Antenna complex Structure of chlorophyll and accessory pigments that are embedded in the thylakoid membranes; captures and routes energy from sunlight to a collector called a reaction center.
Apoplast Space outside the cell membrane where water and minerals can move freely; interrupted by the casparian strip in roots.
ATP A principle molecule for storing and transferring energy in cells; created in the LR.
Carotenoid pigments Accessory pigments that absorb green light and reflect yellow and red light; overtaken by chlorophyll during the growing season, so we do not see the yellow-red reflection.
Cellulose A long chain of glucose that is a main constituent of the cell wall and key to a plant’s structural integrity; sequesters atmospheric CO2 for long-term storage.
Chlorophyll Green photosynthetic pigment found in plants, algae, and cyanobacteria that captures light for photosynthesis.
Chlorophyll a Type of chlorophyll; mainly absorbs violet and red light while reflecting green light.
Chlorophyll b Type of chlorophyll; mainly absorbs blue and orange light while reflecting green light.
Chloroplasts Membrane-bound organelles found within cells that house chlorophylls and accessory pigments.
Cohesion A force where similar molecules stick together; in plants this occurs with water molecules bonding together.
Evapotranspiration Movement of water in the plant from the root through the stem to the leaf and out the stomata to the atmosphere; also called transpiration.
Fructose Simple sugar; can be produced via photosynthesis.
Gas exchange Movement of oxygen and carbon dioxide through stomata in the plant.
Glucose Simple sugar; can be produced via photosynthesis.
Grana Stacks of thylakoids.
Guttation Dew-like drops of water that are forced out of the leaves of some plants due to root pressure.
Hydrogen bond When water molecules are near each other and the negative region of one molecule is attracted to the positive region of another; a weaker bond than covalent bonds.
Light absorption Process in which light is absorbed and converted to energy.
Light Independent Reaction (LIR) Second half-reaction in photosynthesis; occurs without the presence of light and uses the energy produced in the Light Reaction to grab the carbon from carbon dioxide and use the carbon to build simple sugars.
Light Reaction (LR) First half-reaction in photosynthesis; occurs with the presence of light and uses light energy to split water, which transforms the energy from the sun into hydrogen ions and electrons.
Light reflectance Light wavelengths that are not absorbed, but are reflected back.
Light wavelength Length of the wave from one peak to the next; measured in nanometers.
NADPH Energy created in the LR; used to drive the LIR.
Palisade mesophyll Densely packed, columnar-shaped, elongated cells full of chloroplasts; analogous to cortex parenchyma cells in the stem, but in the leaf they are specialized for light energy capture.
Photoautotrophs Name given to living things, namely plants, that use energy from light to produce organic molecules with which they build their cells and store energy; self-nourishing.
Photon Particle representing a quantum of light; provides the energy that drives photosynthesis.
Photosynthesis Process of capturing light energy and producing carbon-based organic molecules.
Reaction center Complex of pigments, proteins, and other factors that execute the primary energy conversion reactions of photosynthesis, primarily where water is split in the LR to form the energy carriers ATP and NADPH.
Resonance Energy that is passed from one molecule to the next.
Rubisco One of the most abundant proteins on earth; catalyzes the step in the process where carbon from atmospheric CO2 is incorporated into an organic molecule; full name: Ribulose-1,5-bisphosphate carboxylase/oxygenase.
Simple sugars Monosaccharides; examples include glucose and fructose.
Starch Key energy storage compound in plant cells; a long glucose chain that sequesters atmospheric carbon for short-term use.
Stroma Interior of the chloroplast; site of the LIR.
Sucrose Sugar that is transported by the phloem throughout the plant to provide energy and building blocks for other organic molecules like starch and cellulose.
Symplast Interior to the cell membrane, where water and minerals are transported through cells.
Tension Differential pressure; in plants this occurs as water molecules are pulled through the plant via transpiration.
Thylakoid membrane Membrane that surrounds the thylakoid.
Thylakoids Membrane-bound compartments inside chloroplasts and cyanobacteria; the site of the light-dependent reactions of photosynthesis.
Transpiration Movement of water in the plant from the root to stem to leaf and out through the stomata to the atmosphere; also called evapotranspiration.
Triose phosphate A 3-carbon sugar (triose) with phosphorus and oxygen atoms (phosphate); G3P is an example.
Turgor pressure Water pressure inside of cells. | textbooks/bio/Botany/The_Science_of_Plants_-_Understanding_Plants_and_How_They_Grow_(Michaels_et_al.)/11%3A_Water_and_Light/11.03%3A_Terms.txt |
Learning objectives
• Understand how the texture, structure, and fertility of soil affect plant growth.
• Appreciate the different types of soil and manufactured soil-less media for growing plants.
When a plant grows in soil or potting mix it removes nutrients as well as water from the soil. Although a plant produces (fixes) its own carbon-based molecules from photosynthesis, all other nutrients are taken up by the roots from soil. As we harvest plant material and dead plant material decomposes, these nutrients are depleted. This lesson discusses how this process changes soil structure, texture, and fertility.
Thumbnail: Soil. Natural Resources Conservation Service Soil Health CampaignCC BY 2.0
12: Soils Fertility and Plant Growth
Learning objectives
By the end of this lesson you will be able to:
• Describe how soil texture and soil structure affect plant growth.
• Use simple tests to determine the texture of soil.
• Determine the meaning and impact of the three numbers typically displayed on fertilizer labels.
This is a course about plant propagation, but propagation is only useful if you can successfully grow the plants you propagate. Soil, light, and water are key to growing healthy plants. Here you’ll have a brief introduction to soils and soil fertility — a huge area of knowledge and study.
Soil texture
Soil has two key properties: texture and structure. Soil texture refers to the relative proportion of sand, silt, and clay particles in the soil. Sand, silt and clay are the three sizes of mineral particles (originating from rock rather than from previously living material) that make up soil. Sand is the largest particle, silt is intermediate, and clay is very small. In relative terms, if sand is a 55-gallon barrel, silt is the size of a plate, and clay is the size of a dime.
This mixture of different-sized particles is called texture because of how different combinations of these particle types make soil feel when you rub a sample between your thumb and forefinger. High amounts of sand makes a soil sample feel gritty, more silt makes it feel floury, and lots of clay makes it feel like velvet when dry and sticky when wet.
You can get a good idea of the texture of a field soil by doing a simple “jar test:” put soil in a jar, add water, shake the jar, then wait a few days to see the layers of different size particles settle.
The USDA Soil Texture Triangle, above, indicates the type of soil for different percentages of sand, silt, and clay. Notice that there are lines running through the triangle; these are to help you associate the percentages on the margins of the triangle with locations in the interior. The numbers on the margins are angled so that they are roughly parallel to the associated index lines. For example, the 60% clay index line is a horizontal line extending to the right of the 60 on the percent clay margin. The 20% silt index line runs from the upper right to the lower left of the triangle. And the 20% sand index line runs up from the lower right to upper left; all three lines are marked with a red arrow. These lines intersect at the red dot in the middle of the Clay area, indicating that a soil with 60% clay, 20% silt, and 20% sand is classified as a clay soil. When farmers talk about their field soil they often use the terms in the texture triangle rather than the percentages of sand, silt, and clay. This approach is much less common when talking about the potting mix used in greenhouses, as there is very little real mineral soil (sand, silt, clay) in these mixes.
Soils high in sand have great drainage and aeration so that roots are exposed to air in the soil and don’t rot as easily. Roots can penetrate sandy soil easily. But sandy soils are poor at holding moisture when the weather turns dry, and sands don’t hold nutrients well. Nutrients and moisture hang on to a soil best when the soil particles have a lot of surface area, and sand has the least surface area (relative to particle volume) of the three particle types.
Clay, in contrast, holds on to water so tenaciously that it is tough for the plant to get the water for itself. Wet clay is sticky, and clay packs together so tightly that when it dries it clumps together and turns into hard clods. Roots have difficulty penetrating a dry, clay soil. But clay does have a lot of surface area for its volume, and holds nutrients better than other particles. Clay soils tend to be fertile.
Silt has intermediate properties between sand and clay, as you might expect. An ideal soil has some of each type. A silt loam soil with 60% silt and 20% each of clay and sand is perfect for growing corn, wheat, and soybeans. But crops whose economically valuable part is in the ground, like potatoes and peanuts, do well in a sandy soil, because the tubers and pods come out of the ground cleaner and with less mechanical effort than they would from a soil with higher clay or silt.
All soil textures have advantages and disadvantages, depending on climate, topography, and crop. The soil texture of large areas, like fields, can’t really be modified to suit a particular crop, so a crop must be chosen that does well in the available soil. For example, if you have a field with sandy soils you aren’t going to truck in tons of clay and silt to make the soil suitable for corn. Instead, you’ll grow a crop like potato that does reasonably well on a lighter, sandy soil. For crops grown in greenhouses or containers, however, you can choose the soil texture to suit the crop you want to grow.
Review questions
1. What are the three particles that make up soil texture?
2. Which is smallest? Largest?
3. Is a loam soil high or low in clay relative to the other particles?
4. How do you determine soil texture using a soil jar?
Soil structure
Soil structure refers to the way in which the soil particles and other materials like the organic matter in the soil bind together into clumps. These clumps are called aggregates. Pure sand does not clump together into aggregates at all (think about how hard it is to get sand at a beach to stick together for a sand castle). When sand, silt, clay, and organic matter interact to form small aggregates, like the ones shown below, they create what is called a granular structure. Large holes in the aggregates provide spaces for gasses and water to pass through, while smaller holes hold water. The need for water is obvious, but the need for gas exchange may not be. As you know, root cells are growing, which means they require oxygen and give off carbon dioxide as a waste product. Oxygen needs to be available in the root zone, and carbon dioxide needs to be vented. If soils are waterlogged, plants die because too much carbon dioxide builds up around the roots and the roots are starved of oxygen. It is therefore important for soils to have these holes in the aggregates for gas exchange. This is called the aeration-porosity of the soil. Organic matter, which in this case refers to decaying bits of formerly living material, helps build the aggregates by gently sticking the soil particles together. The space between and within aggregates provides aeration-porosity.
The illustration below includes a cross section of soil, showing several soil aggregates packed together. Each aggregate is built from sand, silt, clay, and organic matter (also called humus). Note the micro- and macropores for water and gas exchange.
Soil with granular aggregation that favors plant growth by holding water and nutrients, yet allows for drainage and gas exchange, is said to have good tilth. The soil hangs together (unlike sand), doesn’t form hard clumps (unlike clay), and breaks apart into crumbly moist chunks when you turn over a spade of earth. While gardeners are usually stuck with whatever soil texture they might have in their gardens., one of the most important and readily accomplished tasks a gardener can take on to improve garden soil is to improve the soil structure by:
• increasing the soil organic matter, and
• reducing soil compaction.
Increasing soil organic matter will improve and stabilize soil aggregation. Reducing compaction, like foot traffic through the garden, will maintain the macro-and micropores in the soil to promote drainage, moisture retention, and gas exchange.
Review questions
1. What makes up the glue that holds the soil particles into aggregates?
2. Why is gas exchange in soils important for plant growth?
Soil organic matter
Soil organic matter refers to carbon-based material in the soil that was originally a living organism, whether plant, animal, or microbe. Sometimes, soil organic matter also refers to organisms such as bacteria, fungi, insects, and worms that are still living in the soil, but this discussion refers to the materials that were once alive and are now dead and decomposing. Leaves, stems, and roots eventually die, are incorporated into the soil, and decompose. Soil organisms decompose the former living material and transform it into material called humus. Humus is sticky, and helps bind soil particles together into aggregates, as noted above. Humus also can absorb and hold up to six times its weight in water, so it is very important in improving light (sandy) soils. The decomposing organic matter also releases nitrogen and other nutrients that the plant can take up for growth. And finally, humus, like clay, holds nutrients in the soil through electrochemical charge; organic matter is negatively charged, so it holds positively charged cations like calcium that are important for plant growth.
In summary, organic matter is formerly living matter that is transformed in the soil into humus. Humus helps stick soil particles together to improve soil structure, holds water in droughty soils, and holds plant nutrients. Decomposing organic matter makes nutrients such as nitrogen available to plants.
Organic matter is added to soils in several forms:
Compost
For gardeners, this may be the most familiar form of organic matter. Leaves, weeds, grass clippings, and other organic material are mixed together and occasionally turned to promote decomposition. This results in humus that, when added to the soil, builds soil structure. Most of the nutrients have been used by the organisms that are decomposing the organic matter, are lost to the air, or are leached away by rain, so compost isn’t very effective as a nutrient source. Its main purpose is to build soil structure and assist in retaining available moisture and nutrients.
Green manure, or cover cropping
A crop grown with the sole purpose of tilling the crop into the land to increase the organic matter is called green manure. Green manure crops are used to change soil structure by incorporating organic matter directly into the soil. This technique is also used extensively in horticultural crop production to reduce soil-borne pathogens, and these crops serve a very useful purpose of smothering weeds.
Incorporating crop residues
After a crop is harvested, it is good agricultural and horticultural practice to incorporate the remaining plant material into the soil. Sometimes this is done with a moldboard plow to completely bury the residue, but the more modern method is to use the bare minimum of tillage, or to leave the residue on the top of the soil and plant over the dead material the next spring. The latter method, called no-till, is particularly useful for minimizing soil erosion caused by soil particles blowing away with the wind or moving with flowing water.
The addition of too much organic matter that has too much carbon and not enough nitrogen can deplete the soil of nitrogen and harm plant growth. For instance, if you try to improve the organic matter of your soil by tilling in bales of straw or sawdust (both of which are almost all cellulose, which is very high in carbon), when the microbes begin to break the straw down they need to absorb nitrogen from the soil just for their own growth. If instead you add manure to the soil, which is a blend of straw (high carbon) and animal waste (high nitrogen), the microbes can use the nitrogen from the manure for their own growth as they decompose the organic matter and make more nitrogen available to plants.
Review questions
1. Why add organic matter to the soil?
2. Is all organic matter of the same value when added to soil, or are some types of organic matter better than others? Why?
Containers and raised beds
Garden soil cannot be used for container gardens, sa it compacts too tightly in pots and has terrible drainage. Instead, it is best to a soil-less mix like those available at nurseries, or to make a mix that is high in an organic matter like peat moss or rice hulls, to increase aeration porosity.
Author Dr. Tom Michaels developed this salad table, above, which has great potential for use in urban areas with smaller areas for growing greens, including apartment patios. This table is made with 2×4 lumber for the sides and legs, with hardware cloth and landscape fabric for the bottom of the table. The growth medium is normally a peat-based potting mix. A table this size supplies enough salad greens throughout the summer for two adults. You could modify it to have deeper soil so that you can raise a tomato or pepper plant.
Since the growing medium is potting mix, it dries out quickly. You can see a few modifications in this Hydroponic Salad Table, also created by Dr. Michaels. It’s about 2′ x 4′ x 7.5″ deep and made with lumber, a plastic liner, and a styrofoam lid. About 30 gallons of nutrient solution is added to the box, the box is covered with a lid, and salad green seedlings like lettuce, spinach, chard, and kale are placed in holes in the lid. The plants yield greens for most of the summer and little or no water needs to be added.
To see more about the hydroponic salad table, see the Hydroponic Salad Table website, where Dr. Micheals has posted more information about how you can make a table like this.
You might find that salad tables, container gardens, or raised beds can keep you in touch with the food you eat while you retain your urban lifestyle.
The big three on fertilizer bags
Fertilizer bags and containers display a series of three numbers separated by dashes. This is called the fertilizer’s analysis. The numbers represent the percentage of the fertilizer that is nitrogen (N), phosphorus (P), and potassium (K) — always in that order. N, P, and K are the elements needed by plants in the greatest quantities. Nitrogen is a key element found in protein, phosphorus is an important component in energy transfer molecules like ATP and as part of the DNA backbone, and potassium is an essential part of the mechanism for moving nutrients into and out of cells. Other elements can also be important in small quantities and in special circumstances, but N, P, and K are the most common plant nutrients.
A 10-10-10 general purpose garden fertilizer has 10% nitrogen, 10% phosphorus, and 10% potassium. The rest is filler, like sand or fine gravel. In Minnesota, fertilizers available to homeowners typically have no phosphorus because of legislation aimed at reducing phosphorus runoff into our lakes. Phosphorus is considered to be the limiting factor in algae growth, so if phosphorus runs off yards and gardens into lakes it causes algae blooms. In addition, our garden soils normally have sufficient phosphorus. A general fertilizer analysis without phosphorus would be 10-0-10. Nitrogen is usually the nutrient most limiting for plant growth, so it is worth it to read through the labels.
A caution: seeking the best value per pound of N isn’t always the right strategy. Sometimes the form of the nutrient is important. If you are interested in growing a hydroponic salad table, the plants need a particular form of nitrogen called nitrate, which is not usually found in big, cheap bags of fertilizer; it’s more likely to be found at a hydroponic shop, and costs more per pound of N than other forms.
Review question
1. Is a 20-pound bag of 10-0-0 fertilizer that costs \$10 a better value than a 10-pound bag of 46-0-0 that costs \$20? Why or why not?
12.02: Terms
Aggregates “Clumps” in the soil; see soil structure definition.
Clay Smallest particle in soil; has high nutrient holding capacity.
Compost A type of organic matter that builds soil structure and assists in retaining moisture and nutrients.
Cover cropping Crop used to benefit the soil rather than the main crop species.
Fertilizer analysis N-P-K content of a bag of fertilizer; shown in percentages by weight.
Granular aggregation Interaction of small soil aggregates; it is important to have a mixture of large and small holes between the aggregates to allow for water and gas exchange.
Green manure Crop grown to purposefully be tilled back into the soil to increase the organic matter (and thus change the soil structure); can also smother weeds.
Humus Sticky material made from organic matter that helps bind soil particles together into aggregates; can absorb and hold up to 6x its weight in water, releases nitrogen, and holds positively charged cations for plant growth.
Nitrogen (N) One of the most important elements for plant growth (by quantity); a key element found in protein.
Organic molecule Chemical compound associated with living organisms that contain carbon atoms.
Organic material/matter Material that has come from a recently living organism (such as plants) that may be partially or fully decomposed.
Phosphorus (P) One of the most important elements for plant growth (by quantity); a key component in energy transfer molecules like ATP and as part of the DNA backbone.
Potassium (K) One of the most important elements for plant growth (by quantity); a key part of the mechanism for moving nutrients into and out of cells.
Sand Largest particle in soil; helps increase aeration.
Silt Particle of intermediate size in soil.
Soil compaction When the pore spaces between soil aggregates are compressed.
Soil organic matter Carbon-based plant, animal, and/or microbe tissues that are in the process of breaking down; increasing soil organic matter improves and stabilizes soil aggregation.
Soil structure The way in which the soil particles and other materials, like the organic matter in the soil, bind together into clumps.
Soil texture Relative proportion of sand, silt, and clay particles in the soil.
Tillage Process of incorporating the residue from the top of the soil into the soil; there are many types. | textbooks/bio/Botany/The_Science_of_Plants_-_Understanding_Plants_and_How_They_Grow_(Michaels_et_al.)/12%3A_Soils_Fertility_and_Plant_Growth/12.01%3A_Soils_Fertility_and_Plant_Growth.txt |
Learning objectives
• Understand the structure of DNA.
• Compare the different states of ploidy and which process of cell division — mitosis or meiosis — they are produced from.
• Recognize what happens to the chromosomes, cell wall, cell membrane, and nuclear membrane in each of the stages of mitosis and meiosis.
• Compare the similarities and differences in the outcomes of mitosis and meiosis.
Mitosis is essential to all plant propagation. It produces the mighty oak from a single zygote cell and makes all forms of propagation possible. The adventitious rooting process of any cutting begins with mitosis and continues through many mitotic divisions to produce a root meristem. Meiosis is also fundamental to plant propagation for the production of gametes that fuse, producing diversity for evolution and plant breeding.
Thumbnail: Stages of mitosis in onion root tip. Melissa HaCC BY-NC-SA 2.0
13: Sexual Reproduction
Learning objectives
By the end of this lesson you will be able to:
• Discuss how ribose, phosphate, purine, and pyrimidine molecules are combined to make up a strand of DNA.
• Summarize how the strand of DNA is coiled and packed to become a chromosome.
• List the steps in the cell cycle and describe where in the cycle you would find particular types of cells.
Introduction to chromosomes
You have learned about two types of meristems: apical meristems, that result in primary growth, and lateral meristems, like vascular cambium and cork cambium, that result in secondary growth. Meristems are sites of cell division in plants. These new cells may themselves divide once or twice, but then they begin to enlarge and differentiate into cells with specialized function depending upon the type of tissue in which they occur. (Parenchyma cells are an exception because they remain undifferentiated. They can become meristematic and divide to form plant parts like lateral roots, to form interfascicular cambium, and to respond to wounds by filling in space with new cells called callus tissue.)
For a cell to divide into two identical cells, it is critical that all the components of the original cell are duplicated prior to cell division and then distributed between the two sister cells before they separate. It is also critical that the hereditary material, the DNA in the nuclear chromosomes, be exactly duplicated and equally distributed between sister cells. Exact duplication and equal distribution ensure that each cell in the organism has all the genetic instructions it needs to carry on its metabolic processes, and that every cell in the organism has the same instructions.
The type of cell division that takes place in meristems, which is the type where one cell divides into two identical sister cells, is called mitosis.
Mitotic cell division was first observed under light microscopes well over 150 years ago. Microscopists, scientists who use microscopes, noticed dark-staining cell bodies lined up in the middle of a cell that was about to divide. They called these cells chromosomes (based on the Latin for dark staining, “khrôma,” and bodies, “sôma”). Once lined up in the middle of the cell, the chromosomes divided and moved to opposite poles in the cell just prior to the actual division of the cell into two sister cells. It was clear to those scientists that the process of cell division ensured that the chromosomes were specially and carefully handled during cell division. In 1902, Water Sutton, studying grasshoppers, provided proof (optional reading) that chromosomes contained the hereditary material for the organism. That’s why cell division includes such careful division of the chromosomes — the organism needs to ensure that every cell has an exact copy of all of the hereditary material associated with that organism.
What makes up these chromosomes? The short answer is that chromosomes found in the nucleus of plant cells are composed of chromatin (optional reading). Chromatin is made up of DNA wrapped around proteins, called histones. These proteins around which the DNA wraps are called histones. We’ll start with the structure of DNA and build up to a chromosome.
DNA structure
DNA is a double-stranded chemical polymer (a polymer is several types of molecules bonded together) that looks like a flexible ladder twisted on its long axis. Each side, or single strand of the ladder, is made up of a chain of alternating ribose and phosphate molecules. Ribose is a sugar molecule composed of a ring of five carbons. These molecules are linked to each other by a phosphate molecule made up of one phosphorus atom and two oxygen atoms. This sequence of ribose and phosphate molecules constitutes what is called the DNA’s ribose-phosphate backbone.
The steps, or rungs, of the ladder are constructed from pairs of bases. Four types of these bases compose both strands of DNA. Two of the bases, collectively called purines — Adenine (A) and Guanine (G) — contain two rings of carbon atoms. The other two, collectively called pyrimidines — Cytosine (C) and Thymine (T) — have only one ring of carbon atoms. There is enough space between the sides of the ladder (or ribose-phosphate backbone) to fit two bases with a total of three carbon rings, so each rung of the ladder always has one purine bonded to one pyrimidine.
There isn’t enough space for two purines, and there is too much space for two pyrimidines. And because of the molecular structures of the bases, Adenine (A) always bonds with Thymine (T), because they each can share two hydrogen bonds, and Cytosine (C) always bonds with Guanine (G), because they each can share three hydrogen bonds.
As a consequence, the rungs on the ladder are always made up of AT, TA, GC, or CG. And the sequence or order of As, Ts, Gs, and Cs making up the rungs along one strand of the ladder is the genetic code carried in the DNA. With only rare exceptions, the code is read three-bases at a time and encodes all of the information for a plant’s life cycle.
Review questions
1. If you know that a rung of the DNA ladder has the base Adenine, then the other base to which it is bonded is Thymine. Why not Guanine? Why not Cytosine?
2. We take for granted now that chromosomes are the hereditary material in plants. When was this proven? A) about 15 years ago when the first genetically modified foods were developed, B) around the time the atom bomb was developed, C) just before WWI, or D) back when Mendel was doing experiments with peas and discovering his principles of inheritance.
3. Why is the shape of DNA called a double helix?
Nucleosomes
We now have a DNA helix made up of alternating ribose and phosphate rails with rungs containing a purine and a pyrimidine. The DNA helix strand next loops around nucleosomes (optional reading) which are made up of histone proteins (illustration above). The histone proteins are essentially the spools around which the DNA thread wraps, except that DNA doesn’t wrap continuously around one histone protein the way thread wraps around one spool. It makes a couple of loops and then moves on to the next histone protein.
The loops of DNA around these nucleosomes are separated by portions of naked DNA called linker DNA, so the effect is called “beads on a string” (see micrograph below). where the beads are the DNA loops and histone protein, and the string is the strand of linker DNA. This description dates back to the early days of exploring DNA using light microscopy. Chromosomes could be observed with the aid of the microscope and described, but their composition was unknown.
The “beads on a string” structure is further coiled into a 30 nm (nm=nanometer, one billionth of a meter) chromatin fiber, which further folds even more, with the association of other proteins, to form the chromosome.
A chromosome, then, is made up of DNA that has looped around histone proteins, then coiled, then folded. Think of a chromosome as a tightly and carefully packed long thread of DNA that is associated with histone proteins to help with the packing.
Here’s a diagram of this coiling:
Above is a rendering of a micrograph of a chromosome at the cell division stage, when the chromosome is most highly condensed (which is during a phase of mitosis called metaphase, as we will see later) and compactly packed. At this phase there is extensive coiling (DNA coiling is called “condensation”) of the chromatin (DNA + histone proteins). Note that there are two sister chromatids. Just prior to cell division these sister chromatids will separate at the centromere (the constricted spot where they are attached) and move to opposite sides of the cell.
It is helpful to have this detail so you can recognize where the genetic code sits in the DNA molecule, and how DNA is folded up and condensed into a tight package during cell division. When a cell is not dividing, parts of the chromosome relax, unfold, and uncoil so that the DNA base pairs in specific parts of the chromosome that provide the code for specific cellular functions can open up, be copied, and the code can be translated into proteins that do the cell’s metabolic business — a phase called “interphase“). During cell division, however, the package is tightly condensed (metaphase).
This interactive site has a feature that allows you to rotate the DNA helix (optional). Look for the following:
• 5-carbon ribose ring making up part of the backbone
• phosphate linking the ribose rings completing the backbone
• 2-ring purine base (one per rung)
• 1-ring pyrimidine base (one per rung)
• hydrogen bonds (two or three per rung depending on the composition)
Review questions
1. Why do you think the chromosome is so highly condensed (meaning wrapped and folded) during metaphase, which is in the middle of cell division? Think about why a chromosome might need to be very tightly packed during cell division.
2. What is the connection among nucleosomes, linker DNA, and beads on a string?
The cell cycle
Below is a diagrammatic summary of the cell cycle, the cycle a cell goes through during its lifetime. You’ll see that about 3/4 of the cycle is called Interphase and the other 1/4 is called M (for mitosis). As noted, during interphase the cell isn’t dividing (but may be preparing to divide); the cell divides during M. Interphase is divided into three parts: G1 (the “G” is short for “Gap” or “Growth”), S (S for DNA “Synthesis”), and G2.
Consult this page on the cell cycle (optional reading) for additional information about the cell cycle.
The stages in the cell cycle are:
• G1 — cells are enlarging, and some are differentiating into specialized cells like epidermis, collenchyma, sclerenchyma, and cells in the xylem and phloem tissue that will no longer divide. These differentiated cells stay in G1 until death.
• S — chromosomes in cells like apical meristem cells, vascular and cork cambium, or undifferentiated parenchyma cells prepare to divide by replicating their chromosomes. To prepare for division, the cell makes a complete copy of all of its DNA, so in the process of copying the DNA there is DNA Synthesis. Once a chromosome has been replicated, the two copies are called sister chromatids and they are held together at a spot called the centromere. The sister chromatids are exactly alike, down to the exact order of AT, TA, CG, and GC bases in the rungs of the DNA backbone.
• G2 — the cell builds up the chemical machinery that it needs for division.
• M — finally, the cell heads into mitosis (M), addressed next.
Note that the size of the slices of pie in the diagram above are not indicative of the actual time duration.
Review questions
1. Where would you place leaf spongy mesophyll cells on the cell cycle? Why?
2. Where would you place cork cambium cells? Why? | textbooks/bio/Botany/The_Science_of_Plants_-_Understanding_Plants_and_How_They_Grow_(Michaels_et_al.)/13%3A_Sexual_Reproduction/13.01%3A_DNA.txt |
Learning objectives
By the end of this lesson you will be able to:
• Compare diploid and haploid and identify which cells in the plant are which.
• Understand why cells undergo mitosis.
• Explain how the chromosomes prepare for cell division in the S phase of interphase.
• Recognize what happens to the chromosomes, cell wall, cell membrane, and nuclear membrane in each stage of mitosis.
Ploidy
The previous lesson focused on DNA’s ribose-phosphate backbone, on the purine and pyrimidine bases, and on how DNA complexes with protein and coils to form chromatin. Here we’ll look more closely at the synthesis (S) phase of interphase and at the mitosis (M) phase. Recall that the mitosis phase of the cell cycle “pie” is divided into four stages; we’ll look now at what happens in each of those stages and how it contributes to the outcome of mitosis, the equal division of chromosomes into two daughter cells.
Ploidy refers to the number of sets of homologous (identical) chromosomes in a cell.
• In higher organisms like plants (and animals, including humans), gamete cells (egg and sperm) typically each contain one set of each of the chromosomes found in that particular species. When cells contain one set of chromosomes characteristic of the species, this state is called haploid and is abbreviated n.
• When the sperm and egg, each of which are n, unite to form a zygote, the zygote cell now has two sets of chromosomes, one from the male parent’s sperm and one from the female parent’s egg. When cells contain two sets of chromosomes, they are described as diploid, abbreviated 2n.
• Recall that one result of double fertilization in plants is that one sperm cell unites with two female polar bodies to create the endosperm found in seeds. Endosperm cells have three sets of chromosomes, two from the female parent’s polar nuclei (n + n) and one from the male parent’s sperm (n), so this tissue is triploid, abbreviated 3n.
Most of the cells of flowering plants that we have studied so far, like the cells making up the epidermis, cortex, and vascular tissues (but not the sperm and eggs cells), are called somatic cells, and are diploid (2n). Each cell carries two sets of chromosomes: one from the male parent and one from the female parent.
Each species of plant has a characteristic number of chromosomes in its somatic cells. Bur oak has 24. The garden petunia has 14. Green bean has 22. Half of those chromosomes came from the egg and half from the sperm, so the plant has two sets of chromosomes. In the bean, the 22 chromosomes can be numbered from 1 to 11 based on their morphology (chromosomes have different lengths). The numbering only goes to 11, even though there are 22 chromosomes, because each diploid cell has two copies of chromosome 1, two copies of chromosome 2, and so on.
The illustration above shows this for a hypothetical plant’s somatic cell’s nucleus containing 6 chromosomes. On the left side, the chromosomes are rearranged into three pairs of homologs. The matching chromosomes from the two different sets (for instance, the two copies of chromosome 1) are called homologous chromosomes or homologs. Homologs carry, at the same location on the chromosome, the genetic information that affects the same characteristic or function. The version of the information can be different between the homologous chromosomes — that is, the sequence of base pairs may be somewhat different because one homolog came from the female and the other from the male.
The homologs look identical and carry genetic information about particular cell functions at identical places on the chromosome (shown using dark bands at specific locations on the chromosome), but the exact base pair sequences at those locations may differ, resulting in different alleles and gene function. The parental combinations are shown at the right, and are the haploid contribution that resulted from meiosis. The 50% reduction in the sex cells ensures that offspring have the proper diploid chromosome number and matching homologs that are the full compliment of the plants genome.
A cell in the plant’s apical meristem that is preparing to divide is a somatic cell, so it is diploid, and contains two sets of chromosomes. When it undergoes mitosis, the outcome will be two identical diploid sister cells. Each of these sister cells will also be diploid, and will contain exact copies of the two sets of chromosomes that were in the original cell. “Daughter” and “sister” cells refer to the same thing — the new cells that arise as the result of mitosis.
From our study of meristems, you know that growth is the result of the formation of new cells, and the subsequent elongation of those cells. Mitosis is the process that results in the formation of new cells. Cells undergo mitosis, therefore, as part of plant growth.
Review questions
1. Somatic cells of beans have 22 chromosomes. How many chromosomes in a bean sperm cell?
2. Corn egg cells have 10 chromosomes. How many chromosomes are found in a corn seed’s endosperm cells?
3. Why do cells undergo mitosis? Is it important?
Synthesis
If a cell that undergoes mitosis divides into two cells, how can both of these new cells be identical to each other and to the original cell? Won’t the chromosomes in the original parent cell be divided in half during division? Won’t the resulting cells be haploid instead of diploid? No. The number of chromosomes isn’t reduced during mitotic cell division because, prior to division, each of the chromosomes replicates (duplicates), meaning that the cell makes an exact copy of each chromosome. This replication process happens during the synthesis (S) phase of the cell cycle.
Remember that G1, S, and G2 phases of the cell cycle are collectively called interphase. Most cells in the plant go about their business in the G1 phase. Only those cells called upon to divide make the next step, which is to replicate their chromosomes in the S phase. Once the chromosomes are replicated, the cell moves into the G2 phase of interphase and awaits mitosis. The S phase is called synthesis because making a copy of the chromosome requires new DNA production, or synthesis.
The two chromosomes that are exact copies are called sister chromatids and remain connected at one spot along their length; this spot is called the centromere, as shown in the illustration.
Review questions
1. If a diploid cell enters S phase with 2n=20 chromosomes, how many sister chromatids are in the cell when it enters G2?
2. Are the replicated sister chromatids independent or are they connected in some physical way?
Stages of mitosis
This video provides a view of the fluidity of mitosis in a cell where 2N = 8 chromosomes, 4 pairs = 4 paternal + 4 maternal.
Below is an illustration and a corresponding micrograph for each stage in mitosis, showing a hypothetical plant cell where 2n=4 (two sets of chromosomes, two chromosomes per set).
The micrographs below are onion (Allium cepa) root tip cells. Onion has 2n=16 chromosomes. Each of the cells has two sets of chromosomes where each set is made up of eight chromosomes. The micrographs are real examples of the illustrations above.
Interphase
The lefthand frame of the illustration shows interphase cells. The deep red stained structures in the center of the onion cell micrograph are the chromosomes. They are corralled together within the nuclear membrane. Recall that during interphase the chromosomes are relaxed rather than highly condensed (that is, not extensively coiled or folded), and during the S phase of interphase each chromosome replicates. It makes sense that the chromosomes are relaxed because they can’t go through the replication process if they are tightly coiled, and because chromosomes only need to be coiled so that they can withstand movement and not break. They aren’t moving, just replicating, so being in a relaxed state is perfect. The two identical copies are called sister chromatids and they are held together at a site called the centromere. Note that sister chromatids are not the same as homologs. Homologs are corresponding chromosomes, one contributed through the sperm, the other through the egg. Sister chromatids are chromosomes that have replicated, are identical to each other, and are held together at centromeres. You can’t distinguish individual chromosomes in the picture because they are relaxed rather than tightly coiled and folded, making them so fine that they are difficult to see.
Prophase
Prophase is the first stage of the M phase. In prophase the chromatin begins to coil and condense to form chromosomes. They are coiling because they are preparing to move around. You can begin to notice that each chromosome appears to have two strands (sister chromatids) and that these sister chromatids are attached to each other at a centromere. In prophase the nuclear membrane disappears and the chromosomes spread out to fill up much of the cell. During this phase, the spindle apparatus begins to appear. The spindles are microtubules associated with movement of the chromosomes during division.
Metaphase
In metastage the spindle grows and forms attachments to the pairs of sister chromatids at the centromere that connects the sister chromatids. This point of attachment is called the kinetochore. The sister chromatids move to an imaginary equatorial plate (called the metaphase plate), which is formed along the midline of the cell between the poles. The sister chromatids are in their most condensed state at metaphase.
Anaphase
The sister chromatids begin to separate at anaphase. When the sister chromatids separate, the centromeres divide so that one sister chromatid migrates to one pole, and the other migrates to the opposite pole. The chromatids that formed back in the S phase of interphase, when the chromosome replicated, now separate, and the spindle fibers shorten. With the sister chromatids separated, we can return to calling them chromosomes. Anaphase is the stage where the chromosomes carrying the DNA code are divided precisely so that each of the resulting cells has exactly the same chromosomes that were in the mother cell prior to division. One complete diploid complement of chromosomes (two sets) is delivered to each daughter cell.
Telophase
In telophase, the nuclear membrane forms around the chromosomes in each of the daughter cells, a cell plate forms between these cells, and cell walls separate the newly formed cells in a process called cytokinesis. The chromosomes decondense and again become relaxed chromatin. Telophase is the last stage of the M phase. After telophase and cytokinesis, the cells return to G1 of interphase.
Review questions
1. When do the sister chromatids separate from each other?
2. Do the chromosomes replicate during mitosis or during interphase?
3. Why are the chromosomes in their most condensed state during metaphase and retain this condensed state through chromatid migration in anaphase?
Review
Recall that the outcome of mitosis is two cells with DNA identical to that in the original cell. There are three keys to understanding how two cells are formed from one, both with the same DNA as the original cell:
1. The DNA is completely replicated during the S stage of interphase. This replication results in twice as many sister chromatids as there were chromosomes, and once these sister chromatids separate and are evenly allocated to the two new sister cells, both sister cells have the diploid number of chromosomes, just like the original cell prior to division.
2. As the cell prepares to divide, the DNA condenses. This packaging helps keep the very thin DNA helices from being broken, and keeps the DNA organized into a tight package so that the cell can keep track of it and move it around.
3. The process is very organized. For instance, the sister chromatids all line up in the middle of the cell at metaphase, split at the centromere, and half the chromatids go to one side of the cell, half to the other. This orderly separation of the sister chromatids ensures that the right number of chromosomes is packaged into each of the new sister cells.
There are many sites online that illustrate mitosis, but particularly relevant here are ones that show micrographs of plant cells. You may discover that there are some details about the spindles and their apparent site of origin that differ between descriptions of mitosis in animal and plant cells; not everything online pertains to plants. Any mention of a structure called a “centriole” refers to animal cell mitosis, not plants (as plants don’t have centrioles).
John H. Wahlert and Mary Jean Holland, of Baruch College, authored this site showing stages of mitosis in onion. (You can ignore the stages of whitefish mitosis in the second half of the site unless you are interested in the differences between plant and animal mitosis.) | textbooks/bio/Botany/The_Science_of_Plants_-_Understanding_Plants_and_How_They_Grow_(Michaels_et_al.)/13%3A_Sexual_Reproduction/13.02%3A_Mitosis.txt |
Learning objectives
By the end of this lesson you will:
• Understand how meiosis starts with one diploid cell and results in four haploid cells.
• Know how meiosis produces gametes that are genetically diverse.
• Be able to model the stages of meiosis.
• Be able tompare the similarities and differences in the mechanics of mitosis and meiosis.
Review of sexual and asexual propagation
As seen earlier, there are two broad categories of plant propagation: sexual and asexual. When new plants are produced from existing plant parts, like pieces of leaf, stem, or root, reproduction is asexual and the only type of cell division that has taken place is mitosis, where one diploid cell produces two identical diploid cells.
If new plants are instead produced from seeds, this is a strong indication (but not a certainty…optionally read about apomixis) that reproduction was sexual. Plants that practice sexual reproduction use mitotic cell division when increasing the diploid vegetative parts of the plant like stem, leaf, and root, but use meiotic cell division to initiate the haploid stage of the plant that ultimately results in production of egg and sperm cells central to sexual reproduction. Instead of two diploid cells from one diploid cell (the outcome of mitosis), the outcome of meiosis is four haploid cells from one diploid cell.
Plant growth is divided into two generations that are diploid (2n) and haploid (1n). Higher plants (angiosperms) have a long-lived sporophytic generation that is the diploid sporophyte. The sporophyte is the growth you would easily recognize as a plant. Through the process of meiosis, the sporophyte produces haploid spores in the flower. The spores are the gametophytic generation. Meiosis occurs in the male flower parts to produce pollen (represented by the green circle) and the female floral organs produce egg cells (represented by the white circle). Spores grow by mitosis producing more haploid cells, this is the gametophytic generation. We get a brief glimpse of the gametophytic generation when pollen is released from the flower, the female gametes are hidden from direct view in the ovary. When the haploid gametes (male pollen and female egg cells) unite they reform the sporophytic generation producing a diploid (2n) zygote. The zygote grows into the embryo of the seed and eventually into the plant we see. Lower plants, mosses and ferns that are not flowering plants, also alternate generations, but the gametophytic generation is longer lived and separate from the sporophytic generation.
The plant doesn’t magically transition to being haploid, but instead particular parts of the flower in the androecium and gynoecium develop and protect a limited number of haploid cells, called the male gametophyte and female gametophyte. A later chapter addresses how the male and female gametophyte include the haploid egg and sperm cells that must unite to form the diploid embryo in seeds. For now, know that meiosis is the gateway into the haploid phase. Meiosis is the type of cell division that starts with diploid cells and results in haploid cells. Without meiosis there is no egg and sperm, and thus no sexual reproduction.
Propagation and natural selection
From the natural selection perspective, how do asexual and sexual reproduction differ?
In asexual reproduction, the plants are genetic copies of the parent plant. Cell division is strictly mitosis. Except for rare mutations, the resulting progeny are identical to the parents. The fitness of the progeny will mirror the fitness of the parent. The downside of this type of propagation is that there is no genetic variance among progeny that might result in selection for plants that have greater fitness than the parent for characteristics such as increased cold hardiness, drought tolerance, or disease resistance. The upside is that if the parent has high fitness to begin with (and it must have had reasonable fitness to reach reproductive age), all progeny will also have that high level of fitness. If the environment remains the same as it was for the parent, the progeny will stand a good chance of reproductive success. But if the environment changes, the fitness of the progeny may no longer be optimum.
In sexual reproduction, since one gamete comes from the male parent and one from the female, and because in a population of cross-pollinating wild plants there are many potential parents, each with different genotypes, there are many potential genetic combinations of male and female gametes. Not only are the plants producing the gametes each genetically different, but each gamete from each plant is potentially unique. The many combinations of male and female gametes, and the uniqueness of gametes from the same plant, result in a substantial genetic variation among the progeny of plants that sexually reproduce. Some of these progeny will have greater fitness than others, and will be favored by natural selection — some will survive to reproductive age and have more progeny than other plants, while the rest will either not survive to reproduce or, if they do reproduce, it will be with low frequency. The DNA of the fittest plants will thus be represented more frequently in the next generation of plants than the DNA of the least fit plants, which may never survive to reproduce and pass on their DNA. This is the process of natural selection. The DNA of reproductively successful parents is passed on the next generation, while the DNA of reproductively unsuccessful parents is not.
Sex generates genetic variation. Genetic variation, generated by meiosis and sexual reproduction, is the fuel for the engine of natural selection.
Ploidy review
To review: if you count the number of chromosomes in a somatic cell, for instance a root tip cell, you will find that there is always an even number. These are diploid 2n cells that arose from mitotic cell divisions tracking all the way back to the zygote that formed the embryo of the seed. Listed below are the numbers of chromosomes found in somatic, diploid, 2n cells of a few commonly grown plants. Note that the number of chromosomes is even, never odd, and that it doesn’t imply anything about the size or type of plant:
• Corn = 20
• Rice = 24
• Soybean = 40
• Green bean = 22
• Tomato = 24
• Potato = 48
• Apple = 34
• Rose = 14
Diploid cells always contain an even number of chromosomes because there are two copies of each chromosome, one contributed by the male sperm and one by the female egg. If you number each type of corn chromosome 1 through 10, there would be two 1s (a maternal and a paternal), two 2s, etc. Recall that the two (donated from the male and female) versions of the same chromosome in a diploid cell are called homologous chromosomes or homologs. In a diploid cell like corn where 2n=20, there are 10 pairs of homologous chromosomes.
Also recall that the number of chromosomes in a gamete is half the number of chromosomes found in a somatic cell of the same plant. The gamete cells are haploid, abbreviated n. There may be an even or odd number of haploid chromosomes, depending on the diploid chromosome number. Beans have a diploid number of 22, so the gametes have an odd number of chromosomes (11). Tomato has a diploid number of 24, so the gametes have an even number of chromosomes (12).
When two gametes fuse and form a zygote, the zygote has the 2n chromosome number restored. From then on, the cell divisions that allow a plant to grow from zygote to full size are all mitosis, and all the cells are copies of the zygote formed by fusion of the two gametes.
Review questions
1. In what sense is meiosis the gateway into the haploid or gametophytic stage of alternation of generations?
2. Why does a diploid plant cell always have an even number of chromosomes?
3. A diploid rose cell has 14 chromosomes. How many pairs of homologous chromosomes will you find in that diploid cell?
Meiosis mechanics
Meiosis starts with a diploid cell and results in haploid (n) cells that we could correctly call spores. In the illustration above, note that starting with one diploid cell and meiosis yields four haploid cells.
Below are the stages of meiosis. It won’t be difficult to memorize them because you already know the stages of mitosis, and meiosis builds on mitosis. The illustration shows a hypothetical species with two pairs of chromosomes (2n=4) in the starting cell and n=2 in the resulting gamete cells. Meiosis has two chromosome divisions, so the stages are labeled I for those stages associated with the first division (e.g., Metaphase I) and II for those associated with the second division (e.g., Metaphase II).
As in mitosis, the cell division process starts when the chromosomes replicate in the S phase of interphase.
Prophase I — the nuclear membrane disintegrates, and we see that the chromosomes have already replicated (in “S” of interphase) so that the now condensed chromosomes are made up of two sister chromatids attached at the centromere. New, however, is that in this stage the homologous chromosomes pair up and form structures called tetrads because they are groupings of four sister chromatids (two sister chromatids per homolog). This process of pairing and tetrad formation promotes chiasma (seen under the microscope as the point where sister chromatids of homologs lay over each other, forming an “X” shape) and crossing over between sister chromatids of homologous chromosomes. Crossing over results in an exchange of DNA between homologs and is another contributor to genetic variation in the gametes and resulting organisms.
Reread the preceding paragraph, making sure you understand how homologs pair, form chiasma, and cross over between sister chromatids. This type of pairing of homologs and subsequent chiasma formation doesn’t happen in mitosis — a very important and essential difference between the two types of cell division.
Metaphase I — the tetrads are lining up on the metaphase plate, ready to divide. Recall that they are called tetrads because they are made up of four sister chromatids.
Anaphase I — the tetrads divide and homologs go to opposite poles. Note that sister chromatids stay intact and the centromeres do not divide yet. It is the homologous chromosomes that separate at Anaphase I. The sister chromatids may differ in some places along their arms due to crossing over that causes exchange of DNA between homologs.
Telophase I — the nuclear membrane reappears to separate the products of the first division.
The DNA relaxes in Interphase I, but no replication occurs. DNA condenses again in Prophase II, and we can see the chromosomes.
Metaphase II — the chromosomes (which are in the form of sister chromatids still connected at the centromere) line up at the metaphase plate, as in metaphase of mitosis.
Anaphase II — also like anaphase in mitosis, the centromeres split and sister chromatids are pulled to opposite poles.
Telophase II — nuclear membrane reforms, cytokinesis takes place, just like the telophase of mitosis. Note that the “II” stages of meiosis are just like the corresponding stages of mitosis, making them easy to remember.
Review questions
1. Do the chromosomes replicate prior to meiosis?
2. What happens during crossing over?
3. The illustration above shows that some of the sister chromatids are combinations of red and blue rather than being all red or all blue. What does that represent?
4. What separates in Anaphase I?
5. What separates in Anaphase II?
Division
Memorizing this process helps you focus on clearly understanding the mechanics of the process, and recognize how it is that meiosis results in four n haploid cells instead of the two 2n cells that result from mitosis. You get four n haploid cells because the initial cell undergoes two divisions. The cell first divides into two nuclei, then those two divide again into four. The chromosome number drops from 2n in the original cell to n in each of the four haploid cells because the number of sets of chromosomes is reduced from 2 to 1 (that is, homologs separated to opposite poles) in the first meiotic division, and then the sister chromatids separated in the mitosis-like second meiotic division. There was chromosome replication before the first division, but no replication before the second division.
Here’s a summary of what is dividing and when:
Two divisions:
Homologs separate in Anaphase I. Centromeres holding the chromatids do not split.
Chromatids separate in Anaphase II. Centromeres holding the chromatids do split.
Genetic variation among gametes
Each gamete ends up with one of the homologs of the pair, not both.
• Imagine that there are two or three or even 30 pairs of homologous chromosomes. Each homolog pair making up the tetrad in Metaphase I separates in Anaphase I. One homolog from the pair heads to one pole and the other heads to the opposite pole. Each pair of homologs moves independently of all the other homolog pairs that are also separating. That is, all the paternal-source chromosomes making up the homologous pairs don’t go to one pole and all the maternal-source go to the other pole (this is possible, but since it would be by chance the probability is very low). Instead, paternal-source homologs of some chromosomes and maternal-source homologs of the other chromosomes are pulled to the poles, so that eventually there is a mix of maternal- and paternal-source chromosomes in the gametes, and that mix of maternal and paternal is generally thought to be random.
• This principle, where homologs move to poles independently, is called independent assortment, and leads to differences in the genotype of the gametes — one source of genetic variation among gametes.
Crossing over and exchange of DNA between homologous sister chromatids in Prophase I is another source of variation in gametes. If two cells in the sporangia are undergoing meiosis, the crossing over in each cell will probably happen in different places on the chromosome in each cell, resulting in exchanges taking place at different locations on the DNA backbone so that the gametes resulting from different cells going through meiosis will all be unique.
What is crossing over?
The illustration above shows a tetrad where the red and blue homologous chromosomes of the same chromosome type are pairing. Each homolog here consists of two sister chromatids joined at the centromere. Note that the chromosomes have already replicated in interphase prior to the start of Prophase I.
In Prophase I, homologous chromosome pairs come together (synapsis).
Arms of sister chromatids from different homologs overlap (chiasma) and exchange DNA (crossing over).
Note that all four of the resulting sister chromatids are now genetically different, with each potentially having a different DNA sequence.
Summary
• Meiosis is a type of cell division that starts with a diploid, 2n cell.
• The process includes two chromosome divisions and produces four haploid, n cells.
• The haploid cells are genetically different from each other due to crossing over in Prophase I and independent assortment in Anaphase I.
• Homologs separate in Anaphase I while sister chromatids separate (the centromeres divide) in Anaphase II.
Review questions
1. Why does independent assortment during meiosis contribute to genetic variability of gametes?
2. Why does crossing over contribute to genetic variability of gametes? | textbooks/bio/Botany/The_Science_of_Plants_-_Understanding_Plants_and_How_They_Grow_(Michaels_et_al.)/13%3A_Sexual_Reproduction/13.03%3A_Meiosis.txt |
Chapter 13 flashcards
Alternation of generations Cycle of diploid, asexual, vegetative generation alternating with the haploid, sexual generation.
Anaphase Third phase of mitosis; the sister chromatids separate (now chromosomes) and the centromeres divide, pulling the chromosomes to opposite poles.
Antipodal cells Three cells sequestered at the opposite end of the mature female gametophyte from the egg and synergid cells.
Cell cycle Cycle which cells go through in their lifetime; consists of interphase and mitosis.
Centromere Constricted spot where sister chromatids attach.
Chiasma Point where sister chromatids of homologs lay over each other, forming an “X” shape.
Chromosome Structure within the nucleus of a cell that contains the genes; made up of DNA that has looped around histone proteins and then coils and folds.
Crossing over Exchange of arms of DNA between sister chromatids of homologous chromosomes that can take place at the point of chiasma formation.
Cytokinesis Occurs directly after telophase; the cell plate forms between the two daughter cells and the cell walls separate the newly formed cells.
Diploid Term used for zygote cells, where the cell has two sets of chromosomes; abbreviated 2n.
DNA Basic biochemical compound that makes up the gene.
G1 stage of interphase First stage of interphase; “G” stands for Gap/Growth.
G2 stage of interphase Third and final stage of interphase; “G” stands for Gap/Growth.
Genetic code Order of the four different combinations of the bases in DNA; AT, TA, GC, or CG.
Haploid Term used for gamete cells that typically contain one set of each of the chromosomes; abbreviated n.
Histone protein Protein around which the DNA surrounds.
Homologous chromosomes (homologs) Matching chromosomes from the two different sets; carry the genetic information that affects the same characteristic or function at the same location on the chromosome; from sperm and egg cells.
Interphase One of the two major parts of the cell cycle; consists of G1, S, and G2 stages.
Kinetochore Point of attachment of the spindle and the centromere.
Metaphase Second stage of mitosis; the spindle fibers grow and form attachments to the pairs of sister chromatids at the centromeres.
Metaphase plate Equatorial plate formed along the midline of the cell between the poles.
Nucleosome Made up of eight histone proteins and wrapped by a segment of DNA.
Ploidy Number of sets of homologous chromosomes in a cell.
Polar nuclei Two haploid nuclei contained within one cell membrane in the mature female gametophyte. One sperm cell will unite with these two polar nuclei to establish the triploid endosperm tissue.
Prophase First stage of mitosis; chromatin begins to coil and condense to form chromosomes.
Purine Consists of the base pairs Adenine and Guanine and contains two rings of carbon atoms.
Pyrimidine Consists of the base pairs Cytosine and Thymine and contains one ring of carbon atoms.
Ribose-phosphate backbone Chain of alternating ribose and phosphate that make up the sides of the DNA structure.
S stage of interphase Second stage of interphase where the chromosomes replicate (DNA replicated).
Sister chromatids Two chromosomes that are exact copies and are created during the S stage of interphase.
Somatic cells Cells of flowering plants, other than the reproductive cells; always 2n.
Spindle apparatus Microtubules associated with movement of the chromosomes during division.
Sporangia Structures in the androecium and gynoecium where meiosis takes place and the gametophyte generation develops.
Spore Haploid single cell produced by meiosis in the sporangium of a diploid sporophyte.
Telophase Fourth and final stage of mitosis; the nuclear membrane forms around the chromosomes in each of the daughter cells.
Tetrads Groupings of four sister chromatids.
Triploid Term used for endosperm that has three sets of chromosomes; abbreviated 3n. | textbooks/bio/Botany/The_Science_of_Plants_-_Understanding_Plants_and_How_They_Grow_(Michaels_et_al.)/13%3A_Sexual_Reproduction/13.04%3A_Terms.txt |
Learning objectives
By the end of this lesson you will be able to:
• Identify the source and mechanisms that produce gametes.
• Explain double fertilization and the production of a zygote, embryo, and other seed structures.
• Contrast the difference between simple/qualitative and complex/quantitative inheritance and the basis of that difference.
• Predict the types of F1 and F2 offspring expected when crossing two parents with known genotypes and phenotypes.
• Understand how heritability is a measure of genetic influence, relative to other non-genetic influences.
Plant propagation relies on gametogenesis for fertilization and the formation of fruit and seeds. Unlike asexual propagation, seeds from a single pollination can generation tremendous variation, depending on the diversity that exists within each parent. Geneticists take advantage of this diversity to understand how genes control the plant’s phenotypes and to make improved varieties that are tastier and have improved disease resistance.
Thumbnail: Helleborus foetidus cross-section. Simon Garbutt. Public domain
14: Variation and Plant Breeding
Learning objectives
By the end of this lesson you will be able to:
• Identify where sporangia are found in the angiosperm flower.
• Describe how the male gametophyte is formed.
• Describe how the female gametophyte is formed.
• List which cells unite during double fertilization.
• Explain how the embryo goes through developmental stages that are identified according to the developing embryo’s shape.
Recall, as shown below, that the flower is made up of a compressed, four-node stem called the receptacle that supports four whorls of modified leaves: calyx (sepals), corolla (petals), androecium (stamens), and gynoecium (carpels). The two whorls nearest the tip of the receptacle, the androecium and gynoecium, contain structures housing the (micro- and mega-) sporangia, where meiosis takes place and the gametophyte generations develop.
Sporangia
The sporangia of angiosperm plants are found in two places within the flower depending, on whether they lead to a female or male gametophyte. The sporangium in the anther (where the male gametophyte will be formed) is called the microsporangium. The sporangium in the ovary (where the female gametophyte will be formed) is called the megasporangium. Diploid microspore mother cells in the microsporangium and diploid megaspore mother cells in the megasporangium divide by meiosis to form four haploid micro- or mega- spores. These spores initiate the gametophyte phase. Two (male) to three (female) mitotic divisions later, the mature micro- and mega- gametophytes have been formed. Note how few divisions take place to form the gametophyte after the meiotic division of the microspore or megaspore mother cell, and that those two or three additional divisions are mitotic divisions. One round of meiosis is sufficient to generate haploid cells. From there on the divisions are mitotic, but in this case mitosis starts with one haploid cell and generates two haploid cells.
The images above provide a visual orientation to the micro- and megasporangia. In the photo, the bud in the horizontal cross section shows the three chambers in the fused carpels as well as a number of anther cross sections. In the center of the vertical cross section of the flower bud you’ll see a carpel with ovary, locule (interior chamber), and ovule within the locule. Also note the anther cross sections containing pollen.
Microsporogenesis
The illustration below shows the development of the male gametophyte within the anther. The process, called microsporogenesis, or male gametogenesis, starts in the top left hand corner. Study these steps and be able to draw them. Red “2n” or “n” notations indicate the ploidy of the nuclei and blue notations show where the mitotic cell divisions occur. To this point we’ve learned that mitosis starts with one diploid cell and results in two diploid cells. We’ll modify that now to say that mitosis starts with a cell and results in two cells that are exact copies of the original cell. If the starting cell is diploid, there will be two diploid copies. If the starting cell is haploid, there will be two haploid copies.
The result of microsporogenesis, shown on the bottom row of the illustration above, is either a male gametophyte that is a two-celled pollen grain (with vegetative and generative cells), where the generative cell will later undergo another mitotic division to produce two sperm cells (shown to the right of the box), or, following mitosis of the generative cell and shown to the left of the box, a three-celled pollen grain with a vegetative (or tube) cell plus two sperm cells.
Below is a cross section of young anther showing the developing pollen grains in four chambers.
Below are tetrads of cells following meiosis of the microspore mother cell. Note the sets of four cells still attached together.
Below are nearly mature, two-celled pollen grains with the start of an exine coat. The exine coat is made up of protein and other compounds deposited by the inside wall of the anther, and it forms a protective coat around the three-celled microgametophyte.
In this micrograph the exine coat looks like rough, geometrically shaped plates on the surface of the pollen. The exine coat patterns are characteristic of the species and can be used to identify the species of plant that produced the pollen. For more forensic botany, see this optional link from the Botanical Society of America.
Below is a mature, dehiscing (split and releasing pollen) anther.
Review questions
• Where are the microsporangia located?
• Where is the mature male gametophyte in the Pollen Development and Growth illustration above?
• Starting with the microspore mother cell, how many meiotic and mitotic cell divisions are required to produce the mature male gametophyte?
Megasporogenesis
The illustration below shows the development of the female gametophyte, a process is called megasporogenesis or female gametogenesis. Study this diagram and be able to draw it.
The chambers within the ovary are the locules, and within the locules are the ovules. The ovule wall is made up of integument tissue, and it is from this integument tissue that diploid megaspore mother cells form. A diploid megaspore mother cell undergoes meiosis and initially produces four haploid megaspores. Three of the four spores formed through meiotic division of the megaspore mother cell disintegrate, as indicated by the “X” through three of the spores in the illustration. The lone surviving megaspore subsequently undergoes three mitotic divisions to form eight haploid cells that are held within the ovule in an embryo sac. These eight cells comprise the female gametophyte.
Only six of the nuclei are surrounded by their own cell membrane after the three rounds of mitosis. The two remaining nuclei are surrounded by one cell membrane. These two nuclei in one membrane become the polar nuclei and contribute two of the three nuclei to the endosperm tissue, with the other nucleus contributed by a sperm cell.
The megaspore mother cell is the swollen cell shown in the micrograph below. Note the linear tetrad of haploid megaspores resulting from meiosis of the megaspore mother cell. Three will disintegrate and one will undergo three rounds of mitosis.
The four cells in the embryo sac in the left-hand image below are from two mitotic divisions of the one surviving megaspore. After one more mitotic division (center image below), the embryo sac, or female gametophyte, contains 7 cells (with 8 nuclei), and their arrangement is shown in the rightmost image below. The egg and two synergids are positioned on the bottom, two polar nuclei are shown in the center, and three antipodal cells are positioned at the top.
Review questions
1. Where are the megasporangia located?
2. Where is the mature female gametophyte in the Development of the Female Gametophyte illustration above?
3. Is the female gametophyte diploid or haploid? Is the integument tissue diploid or haploid?
4. Starting with the megaspore mother cell, how many meiotic and mitotic cell divisions are required to produce the mature female gametophyte?
Fusion or fertilization
In the image below, pollen has fallen on the stigma and some grains are germinating. The next image shows the germination of pollen and tube growth in an artificial medium.
Think of the pollen tube as an extension of the cell membrane and cell wall of the pollen grain. The pollen tube isn’t a long string of cells, but is one long skinny cell with two or three nuclei (one vegetative and either one generative or two sperm depending when the generative cell undergoes mitosis). The tube grows down the style through the intercellular (between cell) spaces rather than through cells. Pollen tube growth is an active area of study, with some work showing that the style cells are important for providing nutrients to the pollen tube and also apparently provide directional guidance to tube growth.
In the illustration below we see a generative nucleus in a pollen grain. This subsequently undergoes mitosis to form two sperm cells. As noted earlier, in some species this happens during pollen development before it is shed from the plant; in other species it occurs in the pollen tube. The image on the far left below identifies all of the cells in both the female and male gametophyte: in the female gametophyte are three antipodal cells at the top of the ovule, the polar nuclei in the middle, and at the bottom are two synergid cells flanking the egg. There are eight cells or nuclei in total.
In the illustration, you can see the three cells within the pollen tube: two sperm and one tube or vegetative nucleus. The tube finds its way to the embryo sac through the micropyle and ruptures, and the sperm are delivered to the egg and polar nuclei. The rightmost section of the illustration is a closeup of the ovule and shows double fertilization. One sperm nucleus has fused with the egg nucleus to form a 2n zygote. The other sperm nucleus has fused with the two polar nuclei to form the 3n endosperm.
Embryo growth
Embryo development is initiated when the zygote divides once mitotically to form an apical and a basal cell. The basal cell undergoes several additional mitotic divisions to form a suspensor that anchors the apical cell to the nucellus tissue on the inner surface of the maturing ovule wall (seed coat). Next, the apical cell begins to divide mitotically to form the embryo. The embryo goes through distinctive phases that look like particular shapes. This image shows the early embryo heart shape (second from right), and the torpedo shape (far right) stages. The lobes will become cotyledons. Between the lobes is the stem or shoot apical meristem, and at the base near the suspensor is the root apical meristem.
Below is a heart stage embryo. Note the endosperm developing in another part of the embryo sac.
Finally, a later stage embryo with cotyledons readily apparent. This lesson has brought you from flower to seed.
Review questions
1. How many nuclei are in the pollen tube?
2. Where is the egg cell of the embryo and what does it do?
3. A heart-shaped embryo has two swollen lobes that give it the shape of a heart. What will those lobes become when the embryo is mature?
4. You may recall that the ovule is attached to the placenta of the ovary by a stalk called the funiculus. What is the difference between the funiculus and the suspensor that is produced by mitotic divisions of the basal cell? | textbooks/bio/Botany/The_Science_of_Plants_-_Understanding_Plants_and_How_They_Grow_(Michaels_et_al.)/14%3A_Variation_and_Plant_Breeding/14.01%3A_Gametogenesis.txt |
Learning objectives
By the end of this lesson you will:
• Compare the difference between simple and complex inheritance and explain how that difference is based on the number of genes involved and on the influence of the environment.
• Predict the types of offspring expected when crossing two parents that differ for their alleles at one locus, or when self-pollinating an F1 hybrid.
• Predict the types of offspring expected when crossing two parents that differ for their alleles at two loci.
• Use a Punnett square to calculate the expected frequencies of different types of offspring.
Quantitative or qualitative differences?
This lesson and the next focus on the inheritance of characteristics that are passed down from parents to their offspring (also called progeny). This lesson focuses on the inheritance of large differences among plants that you can easily see or measure and can report in qualitative terms, such as red vs, yellow flowers, tall vs, short plants, or early vs, late maturity. The next addresses the inheritance of comparatively small differences that require more meticulous measurement and are reported in quantitative terms, such as seed yield in kg/ha, or milligrams of sucrose per gram of grape tissue. The expression of characteristics that are qualitatively inherited (larger, discrete differences) is influenced primarily by the plant’s genes. The environment has little effect on the plant for these characteristics. In contrast to qualitative inheritance, plant characteristics that are quantitatively inherited are influenced by the environment, and sometimes the influence of the environment overshadows that of the genes themselves.
Recall that the genetic code lies in the order of the purine (Adenine and Guanine) and pyrimidine (Cytosine and Thymine) bases in the DNA double helix. Some of these base sequences don’t appear to have a function, but others are translated into structural and enzymatic proteins that influence cell and plant growth. The sequences that are translated into proteins that influence cell and plant growth are called genes. In corn, for example, the sucrose manufactured in the leaves through photosynthesis is transported through the phloem to the ear and into the developing seed or kernel. There the sucrose is broken down to simpler sugars like glucose that are linked together into starch for storage in the corn kernel’s endosperm. The starch synthesis process is catalyzed by a series of enzymes that are produced as a result of expression of a set of corn genes. If even one of those genes is defective and doesn’t produce an enzyme used in the sequence of reactions leading to starch, starch production could be halted.
Shrunken-2 (Sh2) corn contains a DNA sequence (gene) mutation that renders nonfunctional an enzyme that is key to normal starch biosynthesis. Starch biosynthesis is interrupted at an early stage of kernel growth, so instead of accumulating starch, the kernel accumulates sucrose in the endosperm. Shrunken-2 (sh2) corn has high kernel sucrose levels and is one of the common types of “supersweet” sweet corn. This is an example of a large difference (a qualitative trait), because you can easily distinguish the difference between a bite of starchy field corn from a bite of sweet corn, and because the difference in sweetness is the result of just one mutant gene. This mutation is not, however, good for the vigor of the plant in the early spring. A seed that has accumulated sucrose rather than starch is very susceptible to fungus infection at planting time in comparison to the starchy seed of field (commonly called dent) corn. Sweet corn is not nearly as vigorous during germination as regular dent corn, as the dent corn has stored high amounts of starch in its endosperm while the sweet corn has not.
The principles of qualitative inheritance are consistent with the concepts of DNA structure, with genes and meiotic divisions resulting in segregation, and independent assortment of chromosomes. These principles of inheritance were actually worked out before knowledge of DNA, genes, and meiosis, using carefully controlled experimentation, crosses between contrasting parents, observation of progeny, and genius in developing and testing hypotheses.
Review questions
• Let’s say a carrot breeder is showing us one of her carrot experiments. She planted 20 different types of carrots. If we see that some of the varieties have red tap roots, some have white roots, and others have the usual orange roots, do we suspect that the genetic control of red, orange, and white root colors is qualitatively (large, discrete differences) or quantitatively (smaller differences requiring measurement) inherited?
• If, later in the season, we inspect the data on root yield for each of these 20 varieties, and see that all of the varieties have a fairly similar yield in kilograms per hectare (the highest yielding carrot is perhaps 20% higher than that of the lowest yielding carrot), do we suspect that the genetic control of root yield is qualitatively or quantitatively inherited?
Phenotype, genotype, and environment
This simple arithmetic expression highlights a central concept of how genes and environment combine to influence a plant’s appearance:
Phenotype = Genotype + Environment
Phenotype means the characteristics we actually observe about the plant. Is it tall? Short? Green? Yellow? Starchy? Sweet? The starchiness or sweetness of corn from a garden is one example of a phenotype. Phenotype is the actual expression of a characteristic in the plant that can be measured or expressed in some way.
Genotype is the genetic composition of a plant, including chromosomes of the nucleus and the DNA in chloroplasts and mitochondria. The genotype of a plant is subdivided into genes, which are the hereditary units consisting of a sequence of DNA that occupies a specific location on a chromosome (locus) and determines a particular characteristic in an organism. Genes undergo mutation when their DNA sequence changes, which results in changes in a gene, for example a flower color gene that mutates from red to white in color. The alternative versions of the DNA sequences making up the gene are called alleles. Shrunken-2, introduced above, is a gene. That gene is found at a particular location of a chromosome, and that location is called the gene’s locus. At that locus will be one of the gene’s alleles. It will either be the allele for the normal enzyme that facilitates starch formation, or the mutant allele that blocks starch formation and leads to supersweet corn. The sequence of the purine (A, G) and pyrimidine (C, T) bases along the DNA strand and the differences the sequence imparts to the genetic code produce differences among gene alleles.
Environment is the total influence of known and unknown factors, other than genotype, that might affect this trait, like rainfall, soil type and fertility, temperature, insect predation, and other influences that we may not recognize, but might still affect the phenotype.
Phenotype is then the sum of the genotypic and environmental effects. If you are a sociologist, then you might be familiar with arguments about whether a certain type of human behavior is due to “nature” or “nurture.” Roughly, “nature” corresponds to genotype while “nurture” corresponds to environment. A shorthand representation for the equation introduced above is P = G + E, which roughly corresponds to
Behavior = Nature + Nurture
For more on genotype and environment influences on a plant’s phenotype, see this Wikipedia page (optional).
Genotype (G) has a much larger influence on phenotype (P) than does environment (E) when considering simply inherited characteristics that result in large, qualitative differences. Supersweet sweet corn is going to be sweet corn and not starchy field corn regardless of whether it is grown in Minnesota, California, or in a greenhouse on Mars. The exact amount of sucrose may differ a bit depending on environmental stresses, like how hot or cool the growing season is (hot seasons tend to result in slightly more sugar), but the genotype has a much larger impact on the sweet phenotype than the environment. It is quite common for large differences to be inherited through a single gene that has a large impact. This is called simple inheritance, major gene inheritance, or qualitative inheritance.
In contrast, environmental effects typically have a major impact on phenotype when considering inherited characteristics that are expressed as smaller, quantitative differences, such as those you might find when comparing common bean cultivated varieties (cultivars) for their seed yield, or spinach cultivars for the amount of chlorophyll in their leaves. The impact of the environment might even be larger than the effect of genotype. For example, the rank order of bean yield for three kidney bean cultivars grown in Minnesota might be Cultivar A > Cultivar B > Cultivar C, but if you grow them in Pennsylvania, it could be the reverse, due to a change in environment. It is common for small differences to be inherited through many genes each with a very small impact, where the cumulative effect of their acting together is noticeable. This is sometimes called complex inheritance, minor gene inheritance, or quantitative inheritance, because many genes each with small effect are involved.
Review question
1. Thinking back to the carrot questions above, will environment have a greater impact on root yield or root color?
Inheritance of a qualitative trait
Gregor Johann Mendel, who lived from 1822 to 1884, was an Austrian monk and scientist who studied the simple inheritance of large, obvious differences among pea plants and developed the fundamental principles of modern genetics. He demonstrated that the large differences passed from parents to progeny are transmitted between generations through discrete units or packets of information that control the expression of specific characteristics, and that these discrete units are independently inherited. Take a look at this web page (optional) for background on Mendel, or browse here.
As noted above, Mendel chose pea, Pisum sativum L., as his model organism. Pea usually self-pollinates. It is one of those plants where the pollen is shed and the stigma is receptive even before the flower opens (recall that this is called cleistogamy). Egg and sperm come from the same plant and, following fertilization, form the embryo. The flower is conveniently large enough though that if you very carefully open up a flower bud a few days before the pollen sheds, you can remove the anthers and pollinate the stigma with pollen from another plant, making it fairly easy to cross if you emasculate the flower and supply another source of pollen. If left to its own devices, however, the pea flower self-pollinates.
Mendel looked at a number of qualitative traits controlled by single genes, including:
Gene Phenotype
Seed shape smooth vs wrinkled
Seed color green vs yellow
Flower color purple vs white
Several other obvious pod and plant characteristics that can be seen by eye
Mendel crossed a parent plant grown from a smooth seed (P1) to another parent (P2) grown from a wrinkled seed. These parents were selected because they were true breeding, meaning that if they allowed to self pollinate they always produced the same type of seed. When P1 was pollinated (crossed) with P2, all of the seeds resulting from the cross (called F1, short for first filial generation) were smooth-seeded.
Here’s a summary of the experiment so far:
P1 (smooth) X P2 (wrinkled) → F1 (all smooth)
Mendel then planted the F1 seeds, let them naturally self-pollinate, and collected the seeds produced by these plants. He counted a total of 7324 F2 (second filial generation) seeds and found that 5474 were smooth and 1850 wrinkled. This is roughly a ratio of 3 smooth : 1 wrinkled. This, and other similar results, led him to the development of a model where seed plumpness is controlled by one gene with two different versions (or alleles) of the genetic code for that gene. Furthermore, based on the results, when one of each allele was present in the F1 progeny, the allele donated from the smooth seeded P1 parent was dominant to the recessive allele donated from the wrinkled-seeded P2 parent. Dominant here means that if two different alleles are present in an organism, but only one is expressed (like the smooth seed being expressed even though alleles for both smooth and wrinkled are present), the allele that is expressed is called the dominant allele, and the allele that is not expressed is called recessive. Recessive alleles are only expressed if no dominant alleles are present.
If we signify the dominant allele for smooth seeds as the upper case S and the recessive allele that codes for a wrinkled shape as lower case s, the three different possible genotypes are:
• SS diploids that are smooth (homozygous dominant).
• Ss diploids that are also smooth. Here, in the heterozygous genotype, you can tell which allele is dominant to the other. Both alleles are present (S and s), but only one is expressed — the S — so S must be dominant to s.
• ss diploids that are wrinkled (homozygous recessive).
Note that, by convention, the designation for the allele ( like S or s) and the genotype (like Ss) is underlined.
Above is a diagram showing the smooth (SS) and wrinkled (ss) parents crossing to form Ss (smooth) F1 progeny. Recall that if an SS parent goes through meiosis, only an S type of gamete is formed. There cannot be any s gametes, because the parent only has the S allele. Likewise, only s gametes are possible when an ss parent undergoes meiosis and forms gametes. So Ss progeny is the only possible result from crossing an SS parent to an ss parent. The phenotype of all of these progeny will be smooth because S is dominant to s. Notice that, in this example, which is one of big, qualitative differences, there is no influence of the environment, so Phenotype = Genotype.
The next step in the experiment is to allow the smooth, Ss F1 progeny to self-pollinate. The lower part of the above diagram shows that the F1 plant will produce two types of gametes, S and s, in equal numbers. Think back to meiosis and gametogenesis. Just before a diploid cell with genotype Ss heads into meiosis, the homologous chromosomes (one carrying the S allele and the other carrying the s allele) replicate in interphase so that there are four sister chromatids, two with the S allele and two with the s allele. The illustration to the left shows how the S and s alleles segregate. The process of meiotic cell division will result in each of these sister chromatids winding up in a separate spore, so of the four male gametes formed during microgametogenesis, two are carrying S and two are carrying s. The one surviving gamete from megagametogenesis has an equal probability of being either S or s (recall that of the four spores, only one survives), so if you consider many egg cells, roughly half will be S and half will be s. Mendel’s results, and his explanation, are thus consistent with what we know about meiosis.
You can use a simple tool called a Punnett Square to visualize the types of zygotes, and their expected frequency, formed from the male and female gametes resulting from self-pollination of an Ss individual, as shown below:
The male gametes, S and s are shown in the two columns across the top of the square, and the female gametes, also S and s, are listed down the left margin. Each cell shows the contribution of one male gamete and one female gamete.
In this example, self-pollinating (also called selfing) an Ss F1 plant means that we list S and s as possible male gametes and also as possible female gametes, since both sperm and egg are from the same F1 plant. The potential zygotes are shown in the four cells inside the square.
If you count up the results of from the Punnett square, you find that the genotypic ratios of the F2 progeny are:
1 SS : 2 Ss : 1 ss
and the phenotypic ratios are:
3 S- (Smooth) : 1 ss (Wrinkled)
which is precisely the ratio that Mendel found between smooth and wrinkled seeds in his F2 pea generation. Recall that the difference between the genotypic and phenotypic ratios occurs because S is dominant to s so you can’t tell the phenotypic difference between SS and Ss genotypes.
Mendel's First Law — the law of segregation — states that during gamete formation each member of the allelic pair separates from the other member to form the genetic constitution of the gamete. That is, in the F1, the Ss diploid produces S and s gametes, not Ss gametes. Mendel’s work paved the way for figuring out this process.
Review question
1. Using the Punnett square diagram above, explain why the expected frequencies for the three possible genotypes should indeed be 1 SS : 2 Ss : 1 ss.
Simultaneous inheritance of two qualitative traits
Here is a slightly more complex situation, but one that can still be understood through your knowledge of meiosis. We’ll simultaneously consider seed shape (or plumpness) and another characteristic, seed color, that Mendel studied. Like seed shape, seed color is controlled by one gene with two alleles where:
• YY diploids are yellow
• Yy diploids are also yellow
• yy diploids are green
You can tell from the heterozygote Yy that the Y allele for yellow color is dominant to the recessive y allele for green.
Note that the gene for seed shape is on a different chromosome than the gene for seed color. Mendel didn’t know this, as the concept of chromosomes had not yet been proposed. Because they are on separate chromosomes, seed color and seed shape will assort independently.
Let’s start by crossing a plant that grew from a smooth, yellow seed known to have the genotype SSYY to a plant that grew from a wrinkled green seed with genotype ssyy.
SSYY X ssyy → ?
The only type of gamete that can be produced by the SSYY parent is SY, and the only type that can be produced from the ssyy parent is sy. The F1 progeny can only be the double heterozygote SsYy, which has smooth, yellow seeds.
SSYY X ssyySsYy
Next, allow the SsYy F1 progeny to self pollinate. Below is a diagram of key stages of meiosis for a cell with genotype SsYy. Note that the seed shape gene is on one type of chromosome (straight) and the seed color on another (squiggled).
• At Prophase I the chromosomes are replicated and show sister chromatids.
• At Metaphase I we see that the homologs have synapsed and lined up on the metaphase plate. There are two ways that the recessive and dominant alleles can line up on a metaphase plate. The left side of Metaphase I shows that both dominant gene homologs are on the same side; the alternative alignment on the right side shows that the dominant homolog for one gene could just as likely line up with the recessive homolog for the other gene.
• The way they line up at Metaphase I determines how they separate at Anaphase I, so the diagram of Anaphase I shows two alternatives for how the homologs migrate to the poles. This has an impact on the types of spores produced in Telophase II.
• In the Telophase II frame above, the left side shows that. based on one of the Anaphase I alternatives, the result can be for the dominant S and the dominant Y to be together in one type of spore and both recessive genes together in other spores. Equally likely, as shown on the right, the result can b eone dominant gene with one recessive gene.
Meiosis and gamete formation in the SsYy F1 thus results in an equal likelihood of four types of gametes: SY, sY, Sy and sy. If we create another Punnett Square to model self pollination of the SsYy F1 and put these four gametes both across the top and down the margin (since we are allowing the plant to self pollinate, and the frequency and genotype of the gametes will be the same whether egg or sperm), we get the results shown.
Looking at the diagrams of the seeds in each cell, you can count the number of times each of the four possible phenotypes appears. The phenotypic ratios are:
9 S-Y- (smooth yellow) : 3 S-yy (smooth green) : 3 ssY- (wrinkled yellow) : 1 ssyy (wrinkled green)
The dash “-” in the genotype, like S-, means that the allele represented by the “-” could be either the dominant or the recessive allele because, regardless of which allele is there, the phenotype remains the same. So S- means both SS and Ss genotypes.
Don’t memorize these ratios, but understand how they were obtained using the Punnett Square. When Mendel conducted this experiment and counted the seeds of each phenotype he obtained, he found:
315 smooth yellow, 108 smooth green, 101 wrinkled yellow, and 32 wrinkled green
which is pretty close to a 9:3:3:1 ratio.
This result for two genes on different chromosomes led to Mendel's Second Law — the Law of Independent Assortment. During gamete formation, the segregation of the alleles of one allelic pair is independent of the segregation of the alleles of another allelic pair (illustrated above with the alternative alignments at Metaphase I). That is, when gametes form from an SsYy F1, and receive either S or s (as stated in the first law of segregation), whether Y goes with S to make up a SY gamete or whether y goes with S to make up a Sy gamete is completely by chance. Remember the mechanics behind this, from learning how homologs separate through independent assortment in Anaphase I of meiosis.
Mendel’s initial insights on segregation and independent assortment are the foundation of genetics. He uncovered the core principles that were only later confirmed by our understanding of chromosomes, genes, alleles, and cell division. For another optional look at Mendel’s laws, and another take on this material, see Phil McClean’s (a Prof at NDSU) web site on Mendelian Genetics.
Review question
1. Cover up the Punnett Square above, and without peeking, fill in the cells on your own and derive the genotype and phenotype ratios from selfing the SsYy hybrid.
2. What are the differences between the law of segregation and the law of independent assortment? | textbooks/bio/Botany/The_Science_of_Plants_-_Understanding_Plants_and_How_They_Grow_(Michaels_et_al.)/14%3A_Variation_and_Plant_Breeding/14.02%3A_Inheritance_of_Big_Differences.txt |
Learning objectives
By the end of this section you will:
• Know the meaning of linkage and the impact of crossing over on linked loci.
• Recognize the difference between qualitative and quantitative inheritance.
• Understand how heritability is a measure of the genetic influence over a quantitative trait, relative to other non-genetic influences.
Review
The previous section included examples of simple inheritance, where large, obvious, discrete differences among plants are controlled by one gene and where one of the alleles is completely dominant over the other. Based on the inheritance patterns of round vs. wrinkled pea seeds described in that lesson, Mendel developed the Law of Segregation.
Often called Mendel’s First Law, the Law of Segregation in modern terms states that, during gamete formation, the two alleles for the gene of interest (recall that in diploid cells there are two homologs for each type of chromosome, so there are potentially two versions or alleles of each gene) separate from each other during meiosis and are passed individually to the next generation through the egg and sperm. This is apparent in the mechanics of meiosis, where the homologs separate and migrate to opposite poles in Anaphase I and, following the separation of sister chromatids in Anaphase II, are packaged into separate gametes. In the self-pollination of a Smooth x Wrinkled F1 pea example, the Ss diploid produces S and s gametes, not Ss gametes. The S and s are segregated into separate gametes.
The previous lesson also tracked the joint inheritance of two genes on separate chromosomes that affect different traits (Smooth vs Wrinkled seeds and Yellow vs Green seeds), which leads to Mendel’s Second Law — the Law of Independent Assortment. In modern terms, this law roughly states that, during gamete formation, the allocation of the alleles of a gene on one chromosome is independent of the allocation of the alleles of a different gene on a different (non-homologous) chromosome. So when gametes form from an SsYy F1, and the gametes receive either S or s (as stated in the First Law of Segregation), then whether Y goes with S to make up a SY gamete, or whether y goes with S to make up a Sy gamete, is completely by chance. This is also seen in the diagram of meiosis and how the chromosomes divide at Anaphase I. Homologs separate at Anaphase I, and in the case of two different pairs of homologs, the way in which the first pair of homologs splits doesn’t influence how the second pair of homologs splits. What Mendel discovered by examining segregation ratios (the ratios of each genotype resulting from a particular cross) can thus also be explained through the mechanics of meiosis. Mendel’s thinking was revolutionary at the time, and a great example of thinking carefully about the outcomes of an experiment and developing a model of the process that explains the observed data.
Linkage
What if those two genes are positioned closely on the same chromosome rather than on separate chromosomes, as in the pea shape/pea color example? This situation is called linkage.
Imagine a case in which the hypothetical gene “A” (with alleles “A” and “a“) and gene “B” (with alleles “B” and “b“) occur at loci near each other on the same chromosome. Imagine further that one of the chromosomes has the dominant “A” and the dominant “B” allele while its homolog has both recessive “a” and “b” alleles. This situation is illustrated below.
When these chromosomes go through meiosis the alleles at the two loci cannot independently assort because they are on the same chromosome — they are physically connected. As a result, the gametes will be either AB or ab. There will be no Ab or aB gametes, as you would normally expect from independent assortment, because the A allele is physically attached to the B allele, and the a allele attached to the b allele — they are on the same chromosome. The only way to get Ab or aB gametes together is through a physical breakage in the chromosomes between the two genes and the exchange of arms between homologs; recall that this is called crossing over.
The illustration shows homologs in Prophase I following synapsis (pairing) and where sister chromatids crossed over, with the cross-over event occurring between the loci for the two genes. The chromatids cross over and will exchange arms. When they separate at Anaphase I, the homolog that migrates to the left side will have one sister chromatid with the alleles AB and one with aB. The homolog that migrates to the right will have one chromatid that is Ab and another that is ab.
The frequency of crossing over is one way to describe the distance between the two genes on the chromosome. If crossing over is very infrequent — in this example, if there are very few Ab and aB gametes — the two genes must be very close to each other. This situation is called a tight linkage. If crossing over is quite frequent, approaching 50%, the two genes must be very far apart. If it appears that AB, ab, Ab, and aB gametes have equal frequency, this indicates that the genes are located on different chromosomes or are on the same chromosome, but separated so much that the frequency of crossing over is 50%, which has the same result as if they were on separate chromosomes.
The Wikipedia site on linkage provides a bit of additional information.
Review questions
1. Why can two linked genes NOT independently assort?
2. In the example above, will tight linkage result in many or few Ab gametes?
3. Would you expect the frequency of aB gametes to be roughly the same or quite different from the frequency of Ab gametes?
Quantitative traits — inheritance of small differences
Recall that inheritance does not always involve large, qualitative differences. Inheritance of small differences that require more meticulous measurement and are reported in quantitative terms such as seed yield in kg/ha, number of chloroplasts per mesophyll cell, and grape sucrose content are very important in horticulture. Indeed, these small differences, when accumulated, can be more important than the large qualitative differences in horticultural food crops. Quantitative traits result in higher yield, earlier maturity, and greater cold tolerance, all of which, with patient intercrossing and persistent selection over many years, leads to continuous crop improvement.
In contrast to qualitative traits, the inheritance of quantitative traits may be influenced substantially by the environment. Recall the equation
Phenotype = Genotype + Environment
For quantitative traits, the Genotype component, or the influence of each of these quantitative genes, is quite small, and the influence of the Environment can be large relative to the contribution of Genotype.
You can visualize the difference between quantitative and qualitative inheritance by measuring a large set of plants of the same species (we’ll call it a population of plants) for a particular characteristic (we’ll use flower number per plant as an example). Using that data set containing flower numbers for a large number of plants, you can
• count the number of plants in the population that have one flower,
• count the number of plants with two flowers,
• count the number of plants with three flowers, and so on,
then calculate the frequency of each of these flower number classes in the population by dividing the number of plants with one flower by the total number of plants in the population, and so on for each of your flower number classes.
Next, you can make a graph plotting the flower number on the X axis against the frequency of plants with that flower number on the Y axis, giving a figure called a frequency distribution.
As an example, below are two databases containing hypothetical flower number data taken on 60 plants in two different populations. The first table is a hypothetical database illustrating what the population structure might look like if flower number was controlled by quantitative inheritance, and the second illustrates what the population might look like if flower number was controlled by qualitative inheritance. Both tables have three columns; the first shows the number of flowers, ranging from 1 to 15 per plant; the second shows the number of plants in the sample of 60 with the corresponding number of flowers; and the third shows the frequency of plants in the sample with the corresponding number of flowers per plant. In the quantitative database on the left, in the row corresponding to plants with four flowers, read across to see that there were two of these plants, and that their frequency was 2/60 = 0.0333, rounded to 0.03. This is called a frequency distribution table because it shows the frequency of plants with a particular class of a characteristic, in this case flower number per plant.
Notice that the frequencies in the quantitative table are spread out over a wide range of flower numbers, with a peak around seven flowers per plant. In the qualitative table, in contrast, the frequencies are clustered around two discrete flower numbers, with one large peak at about five flowers and a smaller peak at 13.
Quantitative example Qualitative example
# Flowers # Plants Frequency # Flowers # Plants Frequency
1 0 0 1 0 0
2 0 0 2 0 0
3 1 .02 3 0 0
4 2 .03 4 3 .05
5 5 .08 5 30 .50
6 7 .12 6 9 .15
7 16 .27 7 3 .05
8 15 .25 8 0 0
9 6 .10 9 0 0
10 4 .07 10 0 0
11 2 .03 11 1 .02
12 2 .03 12 1 .02
13 0 0 13 12 .20
14 0 0 14 1 .02
15 0 0 15 0 0
Total 60 1.0 Total 60 1.0
These data are easier to understand in a graph, with the flower number on the X axis and the frequencies on the Y axis:
Notice that the magenta line illustrating the qualitative inheritance distribution has two peaks at 5 and 13 flowers per plant, and that the dispersion around those peaks is quite narrow. Most values are either 5 or 13. In contrast, the blue line illustrating quantitative inheritance has a peak in the 7–8 flower per plant region, and there is a great deal of dispersion. There are many different values of flowers per plant, although the most frequent is in the 7–8 range.
The dispersion around the peaks is in part due to the influence of the environment. For qualitative traits (magenta line), this influence is small. For quantitative traits (blue line), it is larger. Also notice that if you added up the frequencies under the two magenta curves, you would find that the curve with the peak at five flowers has three times the frequency of plants as the curve peaking at 13 plants. This 3:1 ratio is indicative of a single qualitative gene where the dominant allele is associated with, on average, five flowers per plant.
Review questions
1. Would you expect that a frequency distribution with two sharp peaks represents a qualitative or quantitative trait?
2. Would you expect that a frequency distribution which looks like a mound with one high point represents a qualitative or quantitative trait?
3. Would you expect that a frequency distribution with four sharp peaks represents a qualitative or quantitative trait? (hint: 9:3:3:1)
Heritability
Inheritance of quantitative traits is often associated with the term heritability. If a parent and its offspring have very similar values for a quantitative trait, the trait is considered to be highly heritable. Highly heritable traits tend to be under strong genetic control with little influence from the environment. In contrast, if the offspring values don’t seem to have any relationship to that of the parent, the trait is considered to have low heritability. Low heritability usually results when the influence of the environment is quite high relative to the impact of the genotype on the trait being studied. If you are trying to improve a plant characteristic through breeding, you’ll have much greater gain from selection if the trait has high heritability rather than low heritability. If a plant characteristic has high heritability, dramatic changes to the population from natural selection will also be more rapid (require fewer generations) than for a characteristic that has low heritability. See the graph below.
The X axis represents the number of flowers on the parent plant, while the Y axis represents the average number of flowers on the offspring of those parents. A dot represents each parent-offspring data pair. For example, the maroon dot with the black arrow pointing to it represents a data point for a parent with 10 flowers whose offspring had, on average, two flowers (read the 2 off the Y axis).
The gold dots represent cases where the trait has high heritability. Note that you can draw a line with a positive slope through the gold dots, with the dots being relatively close to the line. This indicates high heritability, and means that the offspring’s performance can be predicted based on the performance of the parent. If the parent has a high flower number, the offspring will as well. Plant breeders can make selections with the expectation that if they save seeds from superior plants, the offspring growing from those plants will exhibit the same superiority.
The maroon dots, in contrast, represent the situation of low or zero heritability, and have no line of good fit. Some parents with high flower numbers had offspring with low flower numbers and others with high flower numbers had offspring with high numbers. You can’t predict the offspring flower numbers based on the parent flower numbers. This represents a nightmare for breeders. Some offspring of superior plants will be good as the parents, others will be better, and others will be wildly inferior.
Review questions
1. Would a breeder anticipate making greater gain from selection for a trait that has high heritability or low heritability?
2. If a characteristic is very heavily influenced by the environment and exhibits very little control by genotype, will the heritability be close to 0 (very low heritability) or close to 1 (very high heritability)? | textbooks/bio/Botany/The_Science_of_Plants_-_Understanding_Plants_and_How_They_Grow_(Michaels_et_al.)/14%3A_Variation_and_Plant_Breeding/14.03%3A_Linkage_and_Inheritance_of_Small_Differences.txt |
Learning objectives
By the end of this lesson you will:
• Understand how to get started breeding two common ornamental and food species.
• Know the purpose of emasculation when making hybridizations (crosses) between parents.
• Recognize the difference that propagation method makes in a plant breeding program.
Overview
This lesson presents examples of plant breeding of two common garden plants, rose and tomato. The strategies for the two plants differ because of how the final plant will be propagated. Roses are propagated asexually, while tomatoes are propagated by seed. For both, breeding starts with a cross between two different plants (called a bi-parental cross).
General information about rose
Rose (genus Rosa with many species) is a perennial, mostly deciduous (they annually lose their leaves), mostly temperate-climate shrub in the Rosaceae family. The rose flower is perfect. The calyx, corolla, and androecium whorls are fused at their bases to form a small cup-shaped structure called a hypanthium that surrounds the ovary. (Refer to Chapter 8 if these are not familiar terms.) The base of the hypanthium is attached to the receptacle. The hypanthium is the structure that ripens into a bright red or red-orange fruit called a “hip,” recall that this is also the tissue that forms the fleshy part of the apple. Within the hypanthium are hard achenes containing the rose seeds. In summary, the rose hip is an accessory fruit (parts other than ovary wall constitute the fleshy ripe portion) and an aggregate fruit (one flower, many carpels forming separate fruits) where the subsidiary fruits are achenes (optional).
The species of rose differ in their chromosome number, or ploidy. Roses have seven different types of chromosomes, so the total number of chromosomes in a rose is normally a multiple of seven. Some species, particularly wild species, are diploids with two sets of chromosomes, and so have a total of 14 (2 x 7 = 14) chromosomes. The large-flowered hybrid tea roses have four sets of chromosomes, so they are tetraploids with 28 (4 x 7 = 28) chromosomes. There are even triploid roses with 21 chromosomes. This optional journal article by Cédric Grossi & Maurice Jay on Chromosomes studies of rose cultivars provides more information on chromosome numbers. Some roses are sterile because of triploidy or an imbalance in chromosome numbers, and never form rose hips. Sterile roses cannot be used to breed new roses. From a practical standpoint, if the rose is fertile you can use it in backyard breeding without much concern about whether it is diploid or tetraploid.
Roses can self-pollinate or cross-pollinate. A breeding project should be started with a cross. Because the flowers are perfect, you need to emasculate (remove the anthers from) the flowers you intend to use as the female. Emasculation happens at the bud stage before the pollen has been released and before the stigma is receptive. If you wait too long, the pollen will be shed and the stigma may have received pollen from its own anthers. The commercial roses that you grow in your garden are normally the result of cross-pollination and are genetically highly heterozygous (the opposite of inbred), which in this case refers to most of the loci of plant being in a heterozygous condition or having two different alleles. High heterozygosity results in a more vigorous plant because the genome has increased diversity. Roses are asexually propagated by rooting or grafting cuttings of desirable plants so that superior genotypes are maintained and not broken up by meiotic cell division, as would happen through seed propagation.
General information about tomato
Tomato, Solanum lycopersicon, is a member of the Solenaceae family, the same family that contains potato, pepper, tobacco, and nightshade. The crop has a fascinating history, starting with its likely origin in Peru, importation to Europe with returning explorers, gradual introduction into European cuisine (some cultures associated tomato with nightshade and considered it poisonous), and introduction to North America. This optional tomato history page describes one version of this history.
The tomato flower is perfect (in the botanical sense). The anthers form a cone that completely surrounds the gynoecium. In wild tomatoes, the stigma and style protrude up above the cone of anthers, so these wild types tend to cross-pollinate. The stigma of domesticated tomatoes is either just slightly above the cone, or buried within the cone. Domesticated tomatoes self-pollinate, so we will also need to emasculate the female plants in our crosses. The pistil is made up of several fused carpels, and the mature fruit is a berry.
In contrast to rose, all tomatoes, whether wild or domesticated, are diploids where 2n = 24. They will all cross with each other. Domesticated tomatoes that you grow in your garden are either highly homozygous (inbred) or are F1 hybrids and highly heterozygous. Heirloom and older style tomatoes are typically inbreds (sometimes called pure lines or [incorrectly] open pollinated in seed catalogs), while modern and commercial tomatoes are F1 hybrids. You can use either heirloom or commercial hybrid types in your breeding experiments. Tomatoes are propagated by seeds.
Review questions
1. Compare and contrast rose and tomato for their ploidy and method of propagation.
2. How does the variation in ploidy affect rose breeding? Does it have the same impact on tomato breeding?
3. What is emasculation and why is it done? Which parent do you emasculate, or do you emasculate both parents?
Rose breeding
The overall strategy:
• Identify your objective.
• Choose your parents.
• Make controlled crosses among parents.
• Plant the F1 seeds.
• Evaluate the offspring over a few years.
• Keep seeds from the best plants and compost the rest.
• Asexually propagate the very best one or two by stem cuttings.
• Sell the rights to your award-winning rose to a nursery who distributes it worldwide.
You should start a breeding project with an objective in mind. At first, your objective will probably be just to see if the process works. Later, you will have specific characteristics in mind that you would like to emphasize in the progeny from the cross. Step two is to choose your parents; at least one of the parents should have the trait you are interested in — like flower color, disease resistance, or cold hardiness for surviving Minnesota winters. The other parent should have complementary traits, like size, branching, floral scent, or long vase life.
In a rose, you might choose as the female a nice shrub rose with an attractive red flower and that has made it through several winters without special care. If it has nice full rose hips at the end of the year, you know it’s fertile. Perhaps you’d like the new rose to have the same flower type and color, but in a dwarf plant. And perhaps your neighbor has a dwarf rose that sets hips and must be fertile, and you can use some pollen from that rose even though you don’t like the color of its flower. Hopefully, you’ll get some offspring that show the same red as your female, but in the dwarf growth habit. (You’ll probably get some sprawling, gangly rose plants with ugly flowers as well, but you can toss them in the compost.)
Try the cross in the opposite direction as well (switch which plant is male and which is female). This is called a reciprocal cross. Sometimes the cross is easier to make in one “direction” (A x B vs B x A) than the other. When writing a pedigree for the cross, which shows the names of the two parents, remember to write the female first — cross A x B, for instance, means plant A was the female. Breeders sometimes write the pedigree with a slash (“/”) rather than an “X:” A/B.
By making several crosses that meet your objectives, you increase your chance of obtaining the specific combination of alleles for the specific traits. If a plant meets your objectives it can be asexually propagated, not by seed, so that you keep the genotype intact in your propagules.
Rose hybridization
The main steps in crossing are:
• Choose buds at the right stage.
• Emasculate the female.
• Collect pollen from the male.
• Transfer pollen from anther of male to stigma of female.
• Identify the cross with a tag.
• Protect the carpel until the ovary begins to swell.
Rose hybridization is a sufficiently popular hobby among gardeners that there are websites with reasonably easy-to-follow instructions. This is a good example from a rose breeding project (12:18 min).
The Santa Clarita Rose Society in California has an informative hybridization page, with photos and descriptions of the rose flower before and after emasculation, pollen transfer with an artist’s brush, and the resulting hips and achenes.
While you may get your first bloom when your new hybrid is just a seedling, you won’t know whether you have a really good rose until you have grown it outdoors for two or three years. Once you think you have something you want to propagate, use stem cuttings to propagate the selected plant.
Roses are a good example of a common garden plant you can hybridize. You germinate the resulting seeds, evaluate the progeny, and then asexually propagate the plants you like. It will take at least three years or more to identify plants that maintain the traits you desire to continue through multiple years and environments.
Review questions
1. When making a cross, why is staging the flower development important for emasculation and pollination?
2. In the cross MN5125 / ND163 which of the two parents do you emasculate?
3. What is a reciprocal cross?
Tomato breeding
The overall strategy:
• Identify your objective.
• Choose your parents.
• Make controlled crosses among parents.
• Plant the F1 seeds.
• Evaluate the offspring for the characteristics you are most interested in.
• Keep the seed from the best plants and begin inbreeding.
• Grow the seed from the best plants next spring or in a greenhouse.
• Select the best plants, allow their flowers to self, and keep the seed.
• Repeat the last two steps for about 5–7 generations. Notice that the progeny are now very similar to each other.
• Somewhere around year 5 or 6, identify the best plant that will be the founder of your new, pure line (true breeding) tomato cultivar.
• Sell the rights to your award-winning tomato to a seed company who distributes it worldwide.
Notice that the rose and tomato strategy lists are not identical. With roses, we planted out the seeds from the hybridization, took a few years identifying the best plants, and propagated them asexually. With tomatoes, we want to develop pure lines by inbreeding. Inbreeding is producing seed by selfing over 5–7 generations to develop plants that are highly homozygous at most loci in their genomes. Homozygosity results in identical plants propagated by seed. This is done so the resulting progeny look more and more alike until, after 4–6 years, plants grown from seeds harvested off the same plant are indistinguishable from each other. At that point you have an inbred pure line that will be true breeding if self-pollinated, and you can be pretty sure that you know what you’re going to get when you plant seed from year to year. The seed from inbred pure lines are the same because all loci are homozygous, so all gametes are the same and fertilization produces clonal seeds.
Again, identify your objectives and then choose the parents. You might like the cherry tomato that you’ve been growing on the patio because the fruits are perfect for salads. But being a loyal Gopher, you’d like a gold fruit rather than one that’s Badger red. So you reciprocally cross the red patio tomato with the gold beefsteak type tomato and begin assessing progeny.
Tomato hybridization
• Choose buds at the right stage.
• Emasculate the female.
• Collect pollen from the male.
• Transfer pollen from anther of male to stigma of female.
• Identify the cross with a tag.
• Collect seed at maturity.
This is a practical video on crossing tomatoes (2:18 min).
Review the information on this site on tomato hybridization.
Tomato is a diploid. This series of web pages (optional) walks you through the outcomes of meiosis in a diploid (click on the links at the bottom of the page to get the whole story), and has graphics illustrating how self-pollination leads to inbred pure lines. There is also a page that runs you through calculations to estimate the number of plants you will need to have a reasonable probability of finding the combination of characteristics you seek. Don’t sweat the probabilities of success. Despite the statistics, some of breeding is a chance event at combining the correct set of alleles. Choose your parents wisely, make the cross, evaluate your progeny, and plant out seed from crossing the best progeny the next year. Keep it simple.
Be sure to keep accurate notes, and to tag and identify your crosses, seeds, and plants. Recall the rose breeding website, and how the breeder clipped the sepals of the female flower he was pollinating so he could tell which rosehip contained hybridized seeds. That’s an efficient way of avoiding self-pollinated seed.
Dehybridizing
Most new commercial tomatoes, including new garden tomatoes, are F1 hybrids. The seeds you plant in the field are the result of crossing two parents, as described above. By planting the F1 hybrid, the grower capitalizes on the extra vigor associated with a highly heterozygous hybrid genotype. This website (optional) discusses hybrid tomatoes vs. saving the seed from the hybrid to plant. It’s an interesting discussion, but remember that science is a systematic study and requires replications, something you don’t get from planting seeds from a hybrid in a single year. If you collect seed from a hybrid tomato fruit, whether from a hybrid plant in your garden or a fruit from the grocery store, those seeds are F2 seeds. By planting those seeds out, selecting the most vigorous seedlings, and later in the year keeping seeds from the plants with the best fruits, you are following the same steps laid out in the tomato breeding section, except that you fast-forwarded past the crossing and F1 grow-out stage and went directly to the F2. If you continue to grow out the seed and select the best plants for a few more years, you will end up with a stable variety of your own. This process is called dehybridizing because you are starting with a hybrid, but after several generations of production, selection, and seed saving you are creating new pure lines from that hybrid.
This approach will work well with hybrid tomatoes and hybrid peppers because they are naturally self-pollinating. Garden catalogs will tell you whether the seed you are buying is hybrid. If you are getting your fruits from the store, you can count on them being hybrids unless they are marked as heirloom. The upside of dehybridizing is that it’s the easiest way to breed your own crop because you don’t have to emasculate and cross. The downside is that you are breeding “blind.” You didn’t choose the parents for the F1 cross to achieve your objective, and you don’t know the parents’ characteristics, so the phenotypes that you get from dehybridizing are anyone’s guess.
Review questions
1. Why do you have to allow tomato to self-pollinate for several generations after you make the hybridization?
2. Why dehybridize? What type of crop (naturally inbreeding or naturally outcrossing) would you be most likely to dehybridize? What is the downside of dehybridizing?
14.05: Terms
Chapter 14 flashcards
Dominant allele When one allele is expressed over the other alleles present.
Generative nucleus Nucleus in the immature male gametophyte that will later divide by mitosis to produce two sperm cells.
Genes Hereditary units consisting of a sequence of DNA that occupies a specific location on a chromosome (locus) and determines a particular characteristic in an organism. Genes undergo mutation when their DNA sequence changes.
Genotype Genetic composition of an organism, including chromosomes of the nucleus and the DNA in chloroplasts and mitochondria.
Heritability Measurement of a quantitative trait that passes from parent to offspring and is measured in high and low; high being similar between parent and offspring and low being dissimilar between parent and offspring.
Heterozygote Plant with two different alleles of a particular gene and giving rise to varying offspring; offspring are generally more vigorous than offspring from homozygote.
Homozygote Plant with identical alleles of a particular gene; gives rise to identical, or nearly identical, offspring.
Integument Cells that form the ovary wall. Nucellus cells on the interior of the ovule wall develop into megaspore mother cells.
Linkage When two genes are on the same chromosome.
Locus Location on a chromosome where a particular gene is found.
Megaspornatium Place in the ovary where the female gametophyte will be formed.
Mendel’s First Law — the law of segregation Principle that during gamete formation each member of the allelic pair separates from the other member to form the genetic constitution of the gamete; e.g., Ss diploid produces S and s gametes.
Mendel’s Second Law — the law of independent assortment Principle that during gamete formation the segregation of the alleles of one allelic pair is independent of the segregation of the alleles of another allelic pair.
Microsporangium Place in the anther where the male gametophyte will be formed.
Phenotype Physical appearance of an organism; expressed as Phenotype = Genotype + Environment
Punnett square Simple database used to visualize the types of zygotes and their expected frequency that form from male and female gametes.
Qualitative differences Large differences that can easily be seen or measured in qualitative terms; e.g. fruit color.
Quantitative differences Small differences that are measured numerically; e.g. yield in kg/ha. Can be influenced by the environment.
Recessive allele Allele(s) that are not expressed if a dominant allele is present; will be expressed if there is no dominant allele.
Suspensor Produced by multiple mitotic cell divisions of the embryo’s basal cell; the suspensor anchors the apical cell of the embryo to the ovule wall.
Synergid cells Cells flanking the egg cell in the mature female gametophyte.
Tube nucleus, or vegetative nucleus Nucleus in the male gametophyte that is associated with pollen tube growth. | textbooks/bio/Botany/The_Science_of_Plants_-_Understanding_Plants_and_How_They_Grow_(Michaels_et_al.)/14%3A_Variation_and_Plant_Breeding/14.04%3A_Plant_Breeding.txt |
Learning objectives
• Define what GMO technology is and how it is applied to plant improvement.
• Discuss why GMO technology is controversial and develop an informed opinion about it.
• Know several examples of non-native invasive plants and their impact on the environment.
Although the discovery of DNA as the genetic material seems like a long time ago (~1928), plant genetic modification has been going on for thousands of years as farmers make selections of individuals to tailor crops to their needs. We continue manipulating plants in the discipline of plant breeding. Genetically Modified Organisms (GMOs) are very recent, but offer a new way to improve plants. Although GMO technology is controversial, it has been rapidly adopted by farmers.
A short lesson on invasive plants introduces this issue and discusses how plant propagators can help. As consumers we must be aware of potential risks some plants pose to the environment.
Thumbnail: Tansy. Robert Flogaus-FaustCC BY 4.0
15: Invasive plants and GMOs
Learning objectives
By the end of this lesson you will:
• Be able to explain the consequences of introducing non-native plants that become invasive.
• Be able to map how some plants become invasive.
• Know several examples of non-native invasive plants in Minnesota.
Overview
This lesson introduces some of the features and impacts of non-native invasive plants, using a Minnesota perspective. Be aware, however, that just as a plant native to an exotic continent may become a weedy invasive plant in Minnesota, some plants native to Minnesota have been taken to other continents and become invasive in their new homes. Invasive plants are defined by the U.S. Department of Agriculture as those non-native to an ecosystem whose introduction causes or is likely to cause economic or environmental harm or harm to human health. One example is the oriental bittersweet (Celasturs orbiculatus); the photo below shows, from near Red Wing, Minnesota, shows it smothering ground and tree vegetation.
Invasive plant species have contributed to the decline of about half of the endangered and threatened plant species in the U.S. Their impacts include, but are not limited to, the following:
• Competition with native plant species for moisture, sunlight, nutrients, and space.
• Decrease in biodiversity.
• Degradation of wildlife habitat, agriculture lands, and water quality.
• Increase in soil erosion.
• Decrease in recreational opportunities.
• If sexually compatible native plants are present in the invaded regions, hybrids can form resulting in genetic contamination or pollution to native environments.
This lesson reviews some of the common features of invasive plants in Minnesota, and includes specific information about several species.
Where do invasive plants come from?
People and plants have a close relationship, evolving a co-dependence over thousands of years. As people move around the globe they bring with them the plants that are useful for fuel, food, feed for their animals, enhancing the aesthetics of their new home, and providing fiber for clothing and construction. While most of these plants have been positive forces in the lives of people and do relatively no harm, some escape from cultivation and become invasive. In Minnesota, for example, the most reported invasive plant is common tansy (Tanacetum vulgare). It was likely first brought to the U.S. by John Winthrop, Governor of the Massachusetts Bay colony, about 400 years ago. Although humans are a primary dispersal means for invasive plants and often move them intentionally, such plants may also arrive unintentionally as contaminants in food plants or as seed contaminants in fodder that travels with people and their animals.
The graph above shows the relationship between an invasive plant’s spread and time. Initially, the spread is slow and is in a “lag phase” due to the small number of plants in the initial introduction. This lag phase (left third of the graph) is a period in which, if the plant is detected and addressed, control could result in its eradication. Most invasive plants, however, have a high rate of reproduction, either asexual or sexual. In many cases they spread by prolific fleshy fruit production (as with the bittersweet shown above) that is eaten by birds and other animals. As numbers of the invasive plant increase, it enters the exponential rate of spread (middle third of the graph). Think of exponential spread as a rate similar to 2, 4, 16, 256, 65536. If left unchecked, as some invasive plants are, spread will reach a maximum (shown in the last third of the graph). The horticultural industry is a common entry point for many invasive plants. The properties that make a plant attractive to growers and consumers for their yard or garden — including novelty, robust growth, abundant flowering over a long period of time, and easy sexual or asexual propagation — are the very qualities that make many ornamental introductions invasive.
In addition to large quantities of seed, invasive characteristics listed by the U.S. Department of Agriculture’s Invasive Plant website include:
• Thriving on disturbed soil.
• Distribution by birds, wind, or humans over great distances.
• Aggressive root systems that spread long distances from a single plant.
• Root systems that grow so densely that they smother the root systems of surrounding vegetation.
• Production of chemicals in leaves or root systems that inhibit the growth of other plants around them (referred to as allelopathy).
As invasive plants spread they displace native vegetation, and can dramatically impact the ecosystem into which they are introduced.
Review questions
1. What is an invasive plant?
2. What is happening during the three phases of invasive plant spread?
3. What impacts do invasive plants have on the environment?
4. What are common properties of an invasive plant?
5. If genetic pollution occurred, could it be reversed?
Invasive plant examples
Common tansy (Tanacetum vulgare)
Tansy, an herbaceous perennial in the family Asteraceae, is the most reported invasive plant in Minnesota. It was introduced to North America from Eurasia about 400 years ago, and has been used as a medicinal plant and a funerary herb because of its aroma. Rumor has it that the first president of Harvard University was buried with tansy, and when his grave was moved almost 200 years later, the tansy was still fragrant. Tansy’s invasion of pasture lands is problematic due to its toxicity to mammals. For more information on common tansy see the Minnesota Department of Agriculture website.
Oriental bittersweet (Celastrus orbiculatus)
Oriental bittersweet was intentionally introduced as an ornamental for dried floral arrangements and fall decorations (left-hand photo, below). It is a woody vine that climbs trees and structures and is capable of girdling the trees as the vines tighten around the truck (right-hand photo). Girdling plus the accumulated growth of heavy vines can bring down large trees. Oriental bittersweet thrives in a wide range of habitats, light levels, and soil types, and can grow to over 20 meters (65 ft) in length. Although it is on the Minnesota Department of Agriculture’s list of plants that are prohibited and must be eradicated, it is still grown and propagated in Wisconsin for use in floral arrangements.
Knotweeds (Fallopia sp.)
The knotweed complex consists of two species and their hybrid, includes Japanese knotweed (Fallopia japonica), giant knotweed (F. sachalinense), and their hybrid Bohemian knotweed (F. × bohemica). (Remember that an “×” between the genus and specific epithet indicates an interspecific hybrid.) The knotweed was originally imported as a novel ornamental. With its fast growth and late fall flowering it can make a very showy specimen planting. Each taxa of knotweed has very rapid growth. As an herbaceous perennial it resumes growth from large rhizomes (an underground stem) that produce prolific shoots and adventitious roots, making it difficult to control with herbicides.
Knotweeds can also cause damage to structures. With their long-lived rhizomes capable of adventitious rooting, and dioecious flowers capable of prolific seed set, knotweeds are a double threat to native plants and the environment.
Japanese barberry (Berberis thunbergii)
As a popular landscape plant, Japanese barberry (Berberis thunbergii) has been extensively bred, and many crosses have been made with related and sexually compatible barberries. It is planted in most areas of the University of Minnesota Twin Cities campuses. Barberry produces a fleshy drupe that is consumed and dispersed by birds. It has many sharp spines along the shoots and forms dense thickets. These thickets can prevent students from cutting across landscapes and provide excellent protection to small rodents (mice). As barberry populations increase, so do those of mice and other small rodents. Increased mouse populations are associated with increased tick populations (ticks are small, blood-sucking parasitic bugs) that may increase tick-borne diseases.
Winged burning bush or winged euonymus (Euonymus alatus)
Winged burning bush or winged euonymus (Euonymus alatus) is small tree or shrub from eastern Russia, central China, Korea, and Japan. It is very popular for the interesting wings on its stems and its brilliant red fall foliage. Its popularity for shade or sun landscape planting and ability to escape from cultivation means that escaped populations often occur in nature. This video shows a paddling trip to the Tellico River in Tennessee and the discovery of a large winged euonymus escaped from cultivation. Winged euonymus is adaptable to many growing conditions and forms dense canopies, reduces native native plant diversity. It is a popular landscape plant and still being propagated and sold in Minnesota. Fortunately, several researchers are breeding Euonymus cultivars with reduced or no seed set. How might these cultivars be propagated if they were sterile?
Common buckthorn (Rhamnus cathartica)
Common buckthorn is native to Europe and Asia and is a highly invasive perennial understory shrub or tree. Although propagation and sale of common buckthorn (Rhamnus cathartica) are prohibited in Minnesota, it is common in both urban and natural habitats. There is, for example, a large and very old male buckthorn tree (a dioecious plant) at the corner of Cleveland Avenue North and Buford Avenue on “The Lawn” of the St. Paul Campus of the University of Minnesota.
Buckthorn was introduced to North America as an ornamental shrub and used for living fence rows and wildlife habitat. It has since spread aggressively across most of the northeast and upper Midwest through production and distribution of prolific fleshy fruit (middle photo, above). Common buckthorn has become a serious threat to native forest understory habitats, where it outcompetes native plant species. With such a large distribution, novel control methods are being tested such as goat grazing (above), which is showing success and has a reduced environmental impact compared to herbicide control.
These examples are a small sample of the plants that are known to be invasive in Minnesota. Fortunately for the horticulture industry, consumers, many scientists, and communities are engaged in eliminating invasive plants that have escaped into their environments. | textbooks/bio/Botany/The_Science_of_Plants_-_Understanding_Plants_and_How_They_Grow_(Michaels_et_al.)/15%3A_Invasive_plants_and_GMOs/15.01%3A_Invasive_plants.txt |
Learning objectives
By the end of this lesson you will:
• Understand why and how GMO technology is applied to plant improvement.
• List examples of GMO crops and explain why they were adopted.
• Explain why GMO technology is controversial.
Overview
A GMO is a genetically modified organism — a plant carrying one or more transgenes as part of its genome. GMOs are produced through genetic engineering, where a transgene from any organism is manipulated to produce a trait in a plant after it has been introduced. Transgenes are DNA that are manipulated to function in a plant to produce a specific trait. They can originate from any other organism, and the new DNA need not be introduced through sexual reproduction as in making crosses for plant breeding. (In non-GMO crops, all genes originate from sexual reproduction.) As discussed in the chapter on DNA, the genetic code is the sequence of bases along a strand of DNA, and is universal among all living organisms, enabling the transfer of a gene from a bacteria, virus, or any organism to a plant. )A transfer of DNA across kingdoms would never occur by sexual reproduction, because interkingdom crosses cannot be made.) GMO technology offers, for example, the possibility of engineering resistance to the corn rootworm by introducing a bacterial transgene into corn or the ability to test a gene from any source in a plant.
This lesson offers insight into how GMOs offer a novel mechanism for plant improvement that can add significant traits to forestry, agronomy, and horticulture crops. Their contributions include herbicide tolerance for improved weed control, resistance to insect and viral pests, and improved health benefits for crops.
Unlike rose and apple breeding, in which hobbyists can breed new crops in their gardens, GMO technology integrates knowledge from genetics, molecular biology, and tissue culture to produce a new GMO crop. These skills would be difficult to combine in the garden, but the plants that are produced are propagated identically to their conventional counterparts. It would be difficult to distinguish the GMO “Innate” potato from a non-GMO potato, unless they were tested for browning, acrylamide production, or disease resistance. GMO potatoes look and behave like other potatoes. Adoption of GMO technology by a farmer requires no new equipment or cultivation techniques.
What is a GMO?
GMOs begin where plant breeding ends. An excellent example of GMO technology occurred after the introduction of Papaya Ringspot Virus (PRSV) to Hawaii. PRSV devastated papaya production to the where point growers could not produce a crop. Attempts to use plant breeding to produce a virus-resistant plant were unsuccessful. No sexually compatible plant with resistance to PRSV could be located, so no amount of traditional plant breeding by crossing would produce resistance. This viral disease prevented papaya production in Hawaii until Dennis Gonsalves, of the US Department of Agriculture, adopted a GMO strategy that had previously been used to produce potatoes resistant to several viruses, and made papayas resistant to PRSV. Today, any papaya produced in Hawaii is likely to be either “SunUp” or “Rainbow,” the GMO cultivars. Although the virus-resistant papaya seems like a win for growers and consumers, it is very controversial. In the 1980s, the early development of GMO technology was tied to large agricultural companies that patented and used the technology in corn, soybeans, and cotton. Others see the “unnatural” movement of a gene from a bacteria to a plant as a process that we should not use.
The GMO papaya is a good example for presenting the process involved in producing a GMO. A first step in developing GMO papaya was to understand the virus, its genome, and its replication. Virologists, those devoting their lives to the study of virus biology, knew that the virus’ genome had a gene encoding a coat protein that surrounded the virus’ genetic material and that was essential to its infection of plant cells. The GMO strategy added a copy of the viral coat protein gene into the plant’s chromosomes. The coat protein protects the virus as it is transmitted from plant to plant, and is essential for replication. The viral gene is engineered to be in the opposite orientation from its orientation in the virus. This opposite orientation of the viral gene, now acting as plant gene, effectively shuts down viral replication before it can cause disease, making the plant resistant.
To introduce the engineered viral gene into the plant’s chromosome without crossing, horticulturist John Sanford invented a means of introducing genes into plant cells by literally shooting the gene into the nucleus of a cell. (John graduated in 1976 from the University of Minnesota with a BS in horticulture, and continued in horticulture to become a professor and researcher at Cornell University.) In this process, DNA of the gene of interest is coated onto particles much smaller than the plant cell’s nucleus. The gun works off of compressed air, similar to a BB gun. The particle coated with the DNA (gene of interest), now in the nucleus, diffuses away from the particle and integrates into the plant’s chromosome. The gene is then expressed and is hertible in the same qualitative manner as other single gene traits. The process of introducing a transgene into a plant is called transformation. The plant cell or the whole plant carrying the engineered gene is said to be transformed or transgenic (synonyms for GMO).
Could this process ever happen in nature? Agrobacterium tumefaciens is a bacterial plant pathogen that produces crown gall disease. This bacterium transfers a small amount of its DNA (several genes) to the plant as part of its pathogen attack. The photo to the left shows a large gall on a redwood that may have been caused by Agrobacterium. The pathogen’s genes have been engineered through evolution to take over the plant cell’s normal regulation and produce a gall — a callus of rapidly dividing undifferentiated cells similar to a callus. The introduced bacterial genes, now functioning in the gall or callus, produce compounds that feed the Agrobacterium, which produces more pathogenic cells to infect other plants. This is crown gall disease of plants. Biologists studying Agrobacterium’s life cycle realized they could use the natural DNA transfer process to introduce genes into plants by piggy-backing a gene of interest from any organism onto the Agrobacterium’s transfer process. This has been very successful, and is the most used method of gene introduction into many crops. Although the genes to produce a GMO virus-resistant papaya were introduced with the gene gun, most of those in GMO crops were introduced using Agrobacterium.
The gene gun (above) and Agrobacterium-mediated gene introductions are inefficient processes that introduce the gene into only a very small number of plant cells. Since only a single cell receives the gene, plant tissue culture is used to regenerate an entire plant from that single cell. Plant tissue culture uses synthetic growth media to provide the environment for mitotic cell divisions and organization of those cells into shoot and root meristems. When the meristems are formed, the tiny plants can be removed from tissue culture and transferred to soil. This is possible because plant cells are totipotent — they can regenerate a whole plant from a single cell. (Think about about adventitious rooting, where parenchyma cells can divide and differentiate into a root meristem when buried in potting mix.) This capability has been identified in only a few plant species using very specific components in the tissue culture medium to coax the cells to divide and regenerate a whole plant.
As in plant breeding, GMO plants must be assessed and selected for the traits of interest. Introducing a single gene into a plant can produce a large phenotypic change — as in the naturally occuring Shrunken-2 allele that transforms field corn to sweet corn, or the introduction of the Papaya Ringspot Virus coat protein gene to provide virus resistance. Introducing a new gene using GMO technology does not, however, change other genes or traits of the plant’s genome. Being able to maintain all of a cultivar’s characteristics and add a gene for resistance from any organism is a major advantage of GMO technology.
The art of GMO technology is discovering how non-plant organisms (virus, bacteria, fungi, insects, and so on) might contribute a gene to improve a plant, be it through weed control, increased nutrition in foods, or resistance to pests or viruses. GMO crops are produced by interdisciplinary teams with members expert in gene identification, gene engineering, plant breeding, gene introduction, and tissue culture. These skills mimic the steps required for GMO technology: identifying a gene or genes and their source to solve a problem, engineering the gene for plant expression, using the gene gun or A. tumefaciens to introduce into the crop of interest, and assessing the new plant. It is possible that the predicted gene action may not occur and that other genes or gene modifications are necessary. All genes used in crop production today have been through several iterations that improved the outcome after introduction. When a plant has the introduced gene integrated into its chromosomes, it can be crossed with other plants to move the new gene and its traits into other varieties.
Review questions
1. What is a GMO?
2. What are the two significant advantages of GMO technologies over traditional plant breeding?
3. What are the differences between the two processes used to introduce a novel gene into a plant?
4. Can a GMO seed, seedling, or mature plant be distinguished from a non-GMO one just by looking at it? What distinguishes the two, either visibly or genetically?
5. Where do transgenes come from and how are they introduced into a GMO crop?
Why do farmers pay extra for GMO seeds?
GMO technology has been rapidly adopted by farmers in the US and worldwide (the graph below shows adoption rates for the US in 1996–2018). In the US, corn, soybean, and sugar beet crops are GMO for herbicide tolerance (which allows for improved weed control), insect-resistant GMO cotton is extensively adopted to prevent boll weevil damage. For a more comprehensive list of crops and GMO traits, see the GM Approval Database from the ISAAA.
As it implies, the “approval” in the name of this database indicates that GMO crops must go through extensive testing and a review process before being allowed into production and into our food stream. The rapid adoption of GMO technology triggered questions of risks that resulted in a review process for all GMO crops by the US Department of Agriculture, the Food and Drug Administration, and the Environmental Protection Agency. The overwhelming scientific evidence indicates GMO crops are safe for the environment and for humans. To read more (optional) on the safety of GMO technology, see the Academics Review’s site on Genetic Roulette for science-based information and critical review of GMO technology risks.
GMO crops have economic, environmental, and convenience advantages for farmers. Several economic analyses have shown that increased yields from GMO crops are a major impetus for adoption by farmers, even though GMO seeds cost more than conventional seeds. A good example is the rapid adoption of GMO sugar beets that were modified for resistance to the non-selective herbicide Roundup. This allowed the beets to be sprayed with Roundup, killing weeds in the field and leaving the beets unharmed. A 2008 survey of GMO sugar beet growers showed the highest weed control ratings in the history of the survey and the near elimination of mechanical and manual weeding. Weed control had previously been inefficient, requiring herbicide and mechanical controls. Making beets herbicide tolerant increased yield and made weed control convenient. Adoption was greater than 90% one year after the GMO herbicide tolerant seed was made available.
The most significant environmental benefits of GMO technology come from GMO insect resistance. Most insecticides are non-specific, killing beneficial insects as well as the pest, and are toxic to humans, birds, fish, and other organisms. The basis of GMO resistance is the introduction of the Bacillus thuringiensis gene, Bt, into the plant, so the plant produces Bt. You may have heard of Bt as an insect control used in organic food production or mosquito control. Bt has a very low environmental impact because it is highly specific for the target insect, unlike conventional insecticides that can have wide ranging collateral damage when applied. Bt is also very labile, breaking down rapidly in the soil. The Bt gene from B. thuringiensis has been introduced into several crops. Currently, Bt crops include corn (field and sweet), cotton, potato, eggplant, tobacco, and soybean for control of several insect pests. Each crop has a specific Bt that targets the insect pest in that crop. Where the GMO crop is grown in place of conventional crops, insecticide applications have been greatly reduced. The battle continues, however, as insects develop resistance to Bt, leaving the crop susceptible to insect damage.
Although using GMO technology requires a significant investment to develop a crop, propagation and use by a farmer is identical to that of conventional counterparts. The simplicity and effectiveness of GMO crops has accelerated their adoption by farmers. GMO herbicide tolerance, for example, allows for a single post-germination application that provides improved weed control, eliminating the need to apply several different herbicides at different times and to use mechanical weed removal. This single application reduces fuel cost for farmers, reduces carbon emission, and provides excellent weed control. It is called herbicide tolerance because genes are introduced into the crop to make it tolerant (resistant) to a specific herbicide that kills weeds. The convenience to the farmer comes from using a single herbicide with flexible timing of application to the crop.
Review questions
1. What advantages does a GMO crop present to a farmer?
2. Do any of the advantages of a GMO crop for a farmer translate to advantages to the consumer?
3. Why were GMO crops adopted so rapidly by farmers?
4. What are two examples of GMO crops that were rapidly adopted?
5. What does a farmer need to do to adopt a GMO crop with insect resistance?
GMO crops benefiting human health
Early in the technology’s development, most GMO work focused on the farmer and/or on production problems. Herbicide tolerance, insecticide resistance, and virus resistance each protected the crop or made farming easier. There are now, however, several GMO crops developed primarily for the consumer. The iconic, increased-nutrition GMO crop is Golden Rice. It contains introduced genes that synthesize carotene in the endosperm. You can easily distinguish Golden Rice from conventional rice by its yellow color from the accumulated carotene, the same pigment found in carrots (see photo below). When humans consume the carotene in Golden Rice, it is converted to vitamin A, an essential vitamin for human health. Conventional milled-rice contains no vitamin A, which results in vitamin A deficiencies in millions of adults and children who consume most of their calories by eating rice. The Golden Rice Project estimates the number of child deaths caused by vitamin A deficiency at 1.15 million/year. Vitamin A deficiency also causes loss of sight, increased susceptibility to a number of diseases, and reduced intellectual development. While Golden Rice would greatly mitigate the problem and has been crossed into many regional cultivars, adoption has been slowed or blocked by anti-GMO organizations. Research continues with the development of golden bananas and cassava.
A recently approved GMO crop for production, the “Innate” potato has introduced genes that reduce the production of the neurotoxin acrylamide. Acrylamide forms in many cooked foods from the reaction of amino acids, sugars, and heat. The risk of consuming acrylamide is somewhat controversial, but the fact that it is a neurotoxin makes this an important improvement to the potato. The “Innate” potato has two other introduced genes that make it resistant to the potato blight fungus and prevents browning of the tuber after being cut or bruised. It remains to be seen whether this potato is accepted by consumers and the fast food industry, where many potatoes are consumed. One of the first GMO crops marketed was the “New Leaf” potato, which had both insect and virus resistance. Consumers and the fast food industry, led by anti-GMO organizations, mounted a campaign of GMO fear that effectively ended cultivation of this potato. The “Innate” potato reopens the discussion of GMO foods.
Review questions
1. What are the differences in traits that benefit the farmer vs. benefiting consumers?
2. What human health issues can be addressed using GMO technology?
Why are GMOs controversial?
The overwhelming evidence from peer-reviewed science is that GMO crops are safe for growers, consumers, and the environment. There are several anti-GMO organizations that have been effective in sensationalizing concerns and controversy concerning GMO technology. The first concern about GMOs is that the technology is not natural. A gene from a bacteria would have slim chances of integrating into a plant’s chromosome without technology intervening — or would it? Concerns have been raised about genetic pollution, where genes from GMO crops would escape to conventional crops or weedy relatives, producing superweeds. The second leading cause of controversy is that several large chemical and agricultural companies invested heavily in GMO technology, and then produced the first GMO crops. GMO technology was patented by these large companies, increasing concerns due to the environmental records of these companies. The lack of a federal requirement to label foods as GMO also fanned fears of potential risks.
Other concerns have originated in the technical nature and rapid development of GMOs, which many argue prevented a full assessment of risk. Arguments centered around a new technology’s potential to have unintended or unknown consequences. Some speculated on the possibility that the introduced genes could lead to the production of toxins, allergens, or carcinogens, despite thorough testing for these compounds in the review process. Adding to these concerns was the US Department of Agriculture’s decision to not require labeling of food from or containing GMO plants. Additionally, growers’ concerns led to the rejection of GMO crops in certified organic production. Each of these issues has been amplified by anti-GMO organizations such as the Non-GMO Project, the Center for Food Safety, and Greenpeace. The message from these organizations was and continues to be that GMO foods are unsafe for people and the environment, despite the overwhelming scientific evidence to the contrary. This is the partial story of the development and adoption and controversy of GMO crops. You can look forward to hearing more about the GMOs, especially the “Pinkglow” that Jimmy Kimmel says “tastes exactly like a pineapple.”
Review questions
1. What issues contribute to the GMO technology being controversial?
2. What are the most significant advantages of using GMO technology vs. conventional plant breeding?
3. Why are crops produced from GMO technology reviewed by federal agencies, and what risks might they pose?
15.03: Terms
Chapter 15 flashcards
Bi-parental cross Cross between two different plants.
Conventional crop Crop that is not GMO, with all of its genes originating from sexual reproduction.
Emasculate Act of removing the anthers before pollen has been shed from a flower that is used as the female in breeding; used to reduce self-pollination when wanting to cross.
Exponential spread Very rapid spread of an invasive plant as numbers and reproductive rates accelerate.
Genetic engineering Manipulation and introduction of a transgene into a plant for a specific trait.
Genetic pollution Where genes from GMO crops may escape to conventional crops or weedy relatives.
GMO Genetically engineered organism or a plant containing a transgene.
Inbreeding Producing seed by selfing over 5–7 generations to develop pure lines.
Invasive plant Plant that is non-native to an ecosystem, and whose introduction causes or is likely to cause economic or environmental harm or harm to human health.
Lag phase Phase during invasive plant spread that is slow due to a low number of plants being introduced.
Plant tissue culture Method that uses synthetic growth media to provide the environment for mitotic cell divisions of plants and is used to regenerate a single cell into a whole plant.
Ploidy Number of sets of homologous chromosomes in a cell.
Pure line True breeding plant produced by inbreeding so it is homozygous at most loci and produces identical plants by seed.
Reciprocal cross Matching cross where the pollinator becomes the female and female of the former cross becomes the pollen donor.
Rhizome Horizontal stem growing just below the soil surface.
Super weed Weed produced by crossing with a GMO crop; inherits the GMO trait, like herbicide tolerance.
Totipotent Ability of a single plant cell to grow into a whole plant.
Transformation Process of using the gene gun or Agrobacterium tumefaciens to introduce a transgene into a plant.
Transformed Synonym for GMO, or plant carrying a transgene.
Transgene Gene introduced into a plant from another organism, not through sexual reproduction.
Transgenic Synonym for GMO, or plant carrying a transgene.
Viral coat protein Protein that surrounds the viral genome, protecting it; essential to virus replication. | textbooks/bio/Botany/The_Science_of_Plants_-_Understanding_Plants_and_How_They_Grow_(Michaels_et_al.)/15%3A_Invasive_plants_and_GMOs/15.02%3A_GMOs.txt |
Learning Objectives
When you have mastered the information in this chapter, you should be able to:
1. compare and contrast hypotheses and theories and place them and other elements of the scientific enterprise into their place in the cycle of the scientific method.
2. compare and contrast structures common to and that distinguish prokaryotes, eukaryotes and archaea, and groups within these domains.
3. articulate the function of different cellular substructures.
4. explain how prokaryotes and eukaryotes accomplish the same functions, i.e. have the same properties of life, even though prokaryotes lack most of the structures.
5. outline a procedure to study a specific cell organelle or other substructure.
6. describe how the different structures (particularly in eukaryotic cells) relate/interact with each other to accomplish specific functions.
7. describe some structural and functional features that distinguish prokaryotes (eubacteria), eukaryotes and archaea.
8. place cellular organelles and other substructures in their evolutionary context, i.e., describe their origins and the selective pressures that led to their evolution.
9. distinguish between the random nature of mutation and natural selection in evolution
10. relate archaea to other life forms and speculate on their origins in evolution.
11. suggest why evolution leads to more complex ways of sustaining life,
12. explain how fungi are more like animals than plants.
• 1.1: Introduction
"... Many of these studies revealed common structural features including a nucleus, a boundary wall and a common organization of cells into groups to form multicellular structures of plants and animals and even lower life forms. These studies led to the first two precepts of Cell Theory"
• 1.2: Scientific Method – The Practice of Science
Long before the word scientist began to define someone who investigated natural phenomena beyond simple observation (i.e., by doing experiments), philosophers developed formal rules of deductive and inferential logic to try to understand nature, humanity’s relationship to nature, and the relationship of humans to each other.
• 1.3: Domains of Life
The three domains of life (Archaea, Eubacteria and Eukarya) quickly supplanted the older division of living things into Five Kingdoms, the Monera (prokaryotes), Protista, Fungi, Plants, and Animals (all eukaryotes!). In a final surprise, the sequences of archaebacterial genes clearly indicate a common ancestry of archaea and eukarya.
• 1.4: Tour of the Eukaryotic Cell
An exploration of the organelles that makeup a eukaryotic cell.
• 1.5: How We Know the Functions of Cellular Organelles and Structures- Cell Fractionation
We can see and describe cell parts in the light or electron microscope, but we could not definitively know their function until it became possible to release them from cells and separate them from one another. This became possible with the advent of differential centrifugation. Under centrifugal force generated by a spinning centrifuge, subcellular structures separate by differences in mass. Structures that are more massive reach the bottom of the centrifuge tube before less massive ones.
• 1.6: The Origins, Evolution, Speciation, Diversity and Unity of Life
The question of how life began has been with us since the beginnings or recorded history. It is now accepted that there was a time, however brief or long, when the earth was a lifeless (prebiotic) planet. Life’s origins on earth date to some 3.7-4.1 billion years ago under conditions that favored the formation of the first cell, the first entity with all of the properties of life.
• 1.7: Microscopy Reveals Life’s Diversity of Structure and Form
Broadly speaking, there are two kinds of microscopy. In Light Microscopy, the specimen on the slide is viewed through optical glass lenses. In Electron Microscopy, the viewer is looking at an image on a screen created by electrons passing through, or reflected from the specimen. For a sampling of light and electron micrographs, check out this Gallery of Micrographs. Here we compare and contrast different microscopic techniques.
• 1.8: Key Words and Terms
Thumbnail: Life cycle of the cell. (CC BY-SA 4.0; BruceBlaus).
01: Cell Tour Lifes Properties and Evolution Studying Cells
You will read in this book about experiments that revealed secrets of cell and molecular biology, many of which earned their researchers Nobel and other prizes. But let’s begin here with a Tale of Roberts, two among many giants of science in the renaissance and age of enlightenment whose seminal studies came too early to win a Nobel Prize.
One of these, Robert Boyle, was born in 1627 to wealthy, aristocrat parents. In his teens, after the customary Grand Tour of renaissance Europe (Greece, Italy…) and the death of his father, he returned to England in 1644, heir to great wealth. In the mid-1650s he moved from his estates to Oxford where he set about studying physics and chemistry. He built a laboratory with his own money in order to do experiments on the behavior of gasses under pressure, and with a little help, discovered Boyle’s Law, confirming that the gasses obey mathematical rules. He is also credited with showing that light and sound could travel through a vacuum, that something in air enables combustion, that sound travels through air in waves, that heat and particulate motion were related, and that the practice of alchemy was bogus! In fact, Boyle pretty much converted alchemy to chemistry by doing chemical analysis, a term he coined. As a chemist, he also rejected the old Greek concept of earth, air, fire and water elements. Instead, he defined elements as we still do today: the element is the smallest component of a substance that cannot be further chemically subdivided. He did this a century before Antoine Lavoisier listed and define the first elements! Based on his physical studies and chemical analysis, Boyle even believed that the indivisible unit of elements were atoms, and that the behavior of elements could be explained by the motion of atoms. Boyle later codified in print the scientific method that made him a successful experimental scientist.
The second of our renaissance Roberts was Robert Hooke, born in 1635. In contrast to Boyle parents, Hooke’s were of modest means. They managed nonetheless to nurture their son’s interest in things mechanical. While he never took the Grand Tour, he learned well and began studies of chemistry and astronomy at Christ Church College, Oxford in 1653. To earn a living, he took a position as Robert Boyle’s assistant. It was with Hooke’s assistance that Boyle did the experiments leading to the formulation of Boyle’s Law. While at Oxford, he made friends and useful connections. One friend was the architect Christopher Wren. In 1662, Boyle, a founding member of the Royal Society of London, supported Hooke to become the society’s curator of experiments. However, to support himself, Hooke hired on as professor of geometry at Gresham College (London). After “the great fire” of London in 1666, Hooke, as city surveyor and builder, participated with Christopher Wren in the design and reconstruction of the city. Always interested in things mechanical, he also studied the elastic property of springs. This led him to Hooke’s Law, which said that the force required to compress a spring was proportional to the length the spring was compressed. In later years these studies led Hooke to imagine how a coil spring might be used (instead of a pendulum) to regulate a clock. While he never invented such a clock, he was appointed to a Royal Commission to find the first reliable method to determine longitude at sea. He must have been gratified to know that the solution to accurate determination of longitude at sea turned out to involve a coil- spring clock! Along the way in his ‘practical’ studies, he also looked at little things, publishing his observations in Micrographia in 1665. Therein, he described microscopic structures of animal parts and even snowflakes. He also described fossils as having once been alive, and compared structures in thin slices of cork that he saw in his microscope to monk’s cells (rooms, chambers) in a monastery. Hooke is best remembered for his law of elasticity, and of course, for coining the word cell, which we now understand as the smallest unit of living things.
Now fast-forward almost 200 years to observations of plant and animal cells early in the 19th century. Many of these studies revealed common structural features including a nucleus, a boundary wall and a common organization of cells into groups to form multicellular structures of plants and animals and even lower life forms. These studies led to the first two precepts of Cell Theory:
Cell Theory
1. Cells are the basic unit of living things;
2. Cells can have an independent existence.
Later in the century when Louis Pasteur disproved notions of spontaneous generation, and German histologists observed mitosis and meiosis (the underlying events of cell division in eukaryotes) a third precept rounded out Cell Theory: They reproduce.
cell theory
1. Cells come from pre-existing cells.
We begin this chapter with a reminder of the scientific method, that way of thinking about our world that emerged formally in the 17th century. Then we take a tour of the cell, reminding ourselves of basic structures and organelles. After the ‘tour’, we consider the origin of life from a common ancestral cell and the subsequent evolution of cellular complexity and the incredible diversity of life forms. Finally, we consider some of the methods we use to study cells. Since cells are small, several techniques of microscopy, cell dissection and functional/biochemical analysis are described to illustrate how we come to understand cell function. | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/01%3A_Cell_Tour_Lifes_Properties_and_Evolution_Studying_Cells/1.01%3A_Introduction.txt |
For an amusing look at how scientists think, check out The Pleasure of Finding Things Out: The Best Short Works of Richard Feynman (1999, New York, Harper Collins). Here we focus on the essentials of the scientific method originally inspired by Robert Boyle, and then look at how science is practiced today. Scientific method refers to a standardized protocol for observing, asking questions about, and investigating natural phenomena. Simply put, it says look/listen, infer a cause and test your inference. As captured by the Oxford English Dictionary, the essential inviolable commonality of all scientific practice is that it relies on “systematic observation, measurement, and experiment, and the formulation, testing and modification of hypotheses."
A. The Method
Adherence to the method is not strict, and may sometimes breach adherence to protocol! In the end, scientific method in actual practice recognizes human biases and prejudices and allows deviations from the protocol. Nevertheless, an understanding of scientific method will guides the prudent investigator to balance personal bias against the leaps of intuition that successful science requires. The practice of scientific method by most scientists would indeed be considered a success by almost any measure. Science “as a way of knowing” the world around us constantly tests, confirms, rejects and ultimately reveals new knowledge, integrating that knowledge into our worldview.
Here in the usual order are the key elements of the scientific method:
1. Observe natural phenomena (includes reading the science of others).
2. Infer and propose an hypothesis (explanation) based on objectivity and reason. Hypotheses are declarative sentences that sound like a fact, but aren’t! Good hypotheses are testable, easily turned into if/then (predictive) yes-or-no questions.
3. Design an experiment to test the hypothesis: results must be measurable evidence for or against the hypothesis.
4. Perform the experiment and then observe, measure, collect data and test for statistical validity (where applicable). Then, repeat the experiment.
5. Consider how your data supports or does not support your hypothesis and then integrate your experimental results with earlier hypotheses and prior knowledge.
But, how do theories and laws fit into the scientific method?
A scientific theory, contrary to what many people think, is not a guess. Rather, a theory is a statement well supported by experimental evidence and widely accepted by the scientific community. One of the most enduring, tested theories is of course the theory of evolution. Among scientists, theories might be thought of as ‘fact’ in common parlance, but we recognize that they are still subject to testing and, modification, and may even be overturned. While some of Darwin’s notions have been modified over time, in this case, those modifications have only strengthened our understanding that species diversity is the result of natural selection. You can check out some of Darwin’s own work (1859, 1860; The Origin of Species] at Origin of Species. For more recent commentary on the evolutionary underpinnings of science, check out Dobzhansky T (1973, Nothing in biology makes sense except in the light of evolution. Am. Biol. Teach. 35:125-129) and Gould, S.J. (2002, The Structure of Evolutionary Theory. Boston, Harvard University Press).
A scientific Law is thought of as universal and even closer to ‘fact’ than a theory! Scientific laws are most common in math and physics. In life sciences, we recognize Mendel’s Law of Segregation and Law of Independent Assortment as much in his honor as for their universal and enduring explanation of genetic inheritance in living things. But Laws are not facts! Laws too, are always subject to experimental test.
Astrophysicists are actively testing universally accepted laws of physics. Strictly speaking, even Mendel’s Law of Independent Assortment should not be called a law. Indeed, it is not true as he stated it! Check the Mendelian Genetics section of an introductory textbook to see how chromosomal crossing over violates this law.
In describing how we do science, the Wikipedia entry states: “the goal of a scientific inquiry is to obtain knowledge in the form of testable explanations (hypotheses) that can predict the results of future experiments. This allows scientists to gain an understanding of reality, and later use that understanding to intervene in its causal mechanisms (such as to cure disease).” The better an hypothesis is at making predictions, the more useful it is, and the more likely it is to be correct. In the last analysis, think of Hypotheses as educated guesses and think of Theories and/or Laws as one or more experimentally supported hypothesis that everyone agrees should serve as guideposts to help us evaluate new observations and hypotheses.
A good hypothesis is a rational guess that explains scientific observations or experimental measurements. Therefore by definition, hypotheses are testable based on predictions based on logic. Additional observation can refine or change the original hypothesis, and/or lead to new hypothesis whose predictive value can also be tested. If you get the impression that scientific discovery is a cyclic process, that’s the point! Exploring scientific questions reveals more questions than answers!
We now recognize that a key component of the scientific method is the requirement that the work of the scientist be disseminated by publication! In this way, shared data and experimental methods can be repeated and evaluated by other scientists.
B. Origins of the Scientific Method
Long before the word scientist began to define someone who investigated natural phenomena beyond simple observation (i.e., by doing experiments), philosophers developed formal rules of deductive and inferential logic to try to understand nature, humanity’s relationship to nature, and the relationship of humans to each other. In fact, Boyle was not alone in doing experimental science. We therefore owe the logical underpinnings of science to philosophers who came up with systems of deductive and inductive logic so integral to the scientific method. The scientific method grew from those beginnings, along with increasing empirical observation and experimentation. We recognize these origins when we award the Ph.D. (Doctor of Philosophy), our highest academic degree! We are about to learn about the life of cells, their structure and function, and their classification, or grouping based on those structures and functions. Everything we know about life comes from applying the principles of scientific method. | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/01%3A_Cell_Tour_Lifes_Properties_and_Evolution_Studying_Cells/1.02%3A_Scientific_Method__The_Practice_of_Science.txt |
We believe with good reason that all life on earth evolved from a common ancestral cell that existed soon after the origins of life on our planet. Too long ago, not all life was divided into two groups: the true bacteria and everything else!
Now we group life into one of three domains:
They are among the first descendants of that common ancestral cell. They lack nuclei (pro meaning before and karyon meaning kernel, or nucleus). They include bacteria and cyanobacteria (blue-green algae).
Include all higher life forms, characterized by cells with true nuclei (Eu, true; karyon, nucleus)
(meaning “old” bacteria) include many extremophile bacteria (‘lovers’ of life at extreme high temperatures, salinity, etc.). Originally classified as ancient prokaryotes, Archaebacteria were shown by 1990 to be separate from prokaryotes and eukaryotes, a third domain of life.
The archaea are found in such inhospitable environments as boiling hot springs or arctic ice, although some also live in conditions that are more temperate. Carl Woese compared the DNA sequences of genes for ribosomal RNAs in normal bacteria and extremophiles. Based on sequence similarities and differences, he concluded that the latter are in fact a domain separate from the rest of the bacteria as well as from eukaryotes. For a review, see (Woese, C. 2004; A new biology for a new century. Microbiol. Mol. Biol. Rev. 68:173-186)
The three domains of life (Archaea, Eubacteria and Eukarya) quickly supplanted the older division of living things into Five Kingdoms, the Monera (prokaryotes), Protista, Fungi, Plants, and Animals (all eukaryotes!). In a final surprise, the sequences of archaebacterial genes clearly indicate a common ancestry of archaea and eukarya.
Thus, Archaea are not true bacteria! They share genes and proteins as well as metabolic pathways found in eukaryotes but not in bacteria, supporting their close evolutionary relationship to eukaryotes. That they also contain genes and proteins as well as metabolic pathways unique to the group is further testimony to their domain status. Understanding that all living organisms belong to one of three domains has dramatically changing our understanding of evolution. The evolution of the three domains is illustrated below.
A. The Prokaryotes (Eubacteria = Bacteria and Cyanobacteria)
Prokaryotic cells lack a nucleus and other organelles such as mitochondria, chloroplasts, endoplasmic reticulum, and assorted eukaryotic vesicles and internal membranes. Bacteria do contain bacterial microcompartments (BMCs), but these are made up entirely of protein and are not surrounded by a phospholipid membrane.
These function for example in CO2 fixation to sequester metabolites toxic to the cells. Click Bacterial Organelles for more information. Bacteria are typically unicellular, although a few (like some cyanobacteria) live colonial lives at least some of the time. Transmission and scanning electron micrographs of rod-shaped bacteria are shown in the example below at the left. A diagram of bacterial structure is also shown (right).
1. Bacterial Reproduction
Without the compartments afforded by the internal membrane systems common to eukaryotic cells, intracellular chemistries, from DNA replication, transcription, translation, and all the metabolic biochemistry of life, happen in the cytoplasm of the cell. DNA is a circular double helix that duplicates as the cell grows. While not enclosed in a nucleus, bacterial DNA is concentrated in a region of the cell called the nucleoid. When not crowded at high density, bacteria replicate their DNA throughout the life of the cell, dividing by binary fission. The result is the equal partition of duplicated bacterial “chromosomes” into new cells. The bacterial chromosome is essentially naked DNA, unassociated with proteins.
2. Cell Motility and the Possibility of a Cytoskeleton
Movement of bacteria is typically by chemotaxis, a response to environmental chemicals. Some may respond to other stimuli such as light (phototaxy). They can move to or away from nutrients, noxious/toxic substances, light, etc., and achieve motility in several ways. For example, many move using flagella made up largely of the protein flagellin. Flagellin is absent from eukaryotic cells. On the other hand, the cytoplasm of eukaryotic cells is organized by a complex cytoskeleton of rods and tubes made of actin and tubulin proteins. Prokaryotes were long thought to lack these or similar cytoskeletal components. However, two bacterial genes that encode proteins homologous to eukaryotic actin and tubulin were recently discovered. The MreB protein forms a cortical ring in bacteria undergoing binary fission, similar to the actin cortical ring that pinches dividing eukaryotic cells during cytokinesis (the actual division of a single cell into two smaller daughter cells). This is modeled below in the cross-section (right) near the middle of a dividing bacterium (left).
The FtsZ gene encodes a homolog of tubulin proteins. It seems that together with flagellin, the MreB and FtsZ proteins may be part of a primitive prokaryotic cytoskeleton involved in cell structure and motility.
3. Some Bacteria Have Internal Membranes
While bacteria lack organelles (the membrane-bound structures of eukaryotic cells), internal membranes in some bacteria form as inward extensions (invaginations) of plasma membrane. Some of these capture energy from sunlight (photosynthesis) or from inorganic molecules (chemolithotrophy). Carboxysomes are membrane bound photosynthetic vesicles in which CO2 is fixed (reduced) in cyanobacteria (shown below).
CC-BY; From: en.Wikipedia.org/wiki/File:Carboxysomes_EM.jpg
Photosynthetic bacteria have less elaborate internal membrane systems.
4. Bacterial Ribosomes Do the Same Thing as Eukaryotic Ribosomes… and Look Like Them!
Ribosomes are the protein synthesizing machines of life. Ribosomes of prokaryotes are smaller than those of eukaryotes, but are able to translate eukaryotic messenger RNA (mRNA) in vitro. Underlying this common basic function is the fact that the ribosomal RNAs of all species share base sequence and structural similarities indicating a long evolutionary relationship. Recall similarities revealed the closer relationship of archaea to eukarya than prokarya.
Clearly, the prokarya (Eubacteria) are a diverse group of organisms, occupying almost every wet, dry, hot or cold nook and cranny of our planet. Despite this diversity, all prokaryotic cells share many structural and functional metabolic properties with each other… and with the archaea and eukaryotes! As we have seen with ribosomes, shared structural and functional properties support the common ancestry of all life. Finally, we not only share common ancestry with prokaryotes, we even share living arrangements with them. Our gut bacteria represent up to 10X more cells than our own! Read more at The NIH Human Microbiome Project. Also check out the following link for A Relationship Between Microbiomes, Diet and Disease.
B. The Archaebacteria (Archaea)
Allessandro Volta, a physicist who gave his name to the Volt, discovered methane producing bacteria (methanogens) way back in 1776! He found them living in the extreme environment at the bottom of Lago Maggiore, a lake shared by Italy and Switzerland. These unusual bacteria are cheomoautotrophs that get energy from H2 and CO2 and also generate methane gas in the process. It was not until the 1960s that Thomas Brock (from the University of Wisconsin-Madison) discovered thermophilic bacteria living at temperatures approaching 100oC in Yellowstone National Park in Wyoming. Organisms living in any extreme environment were soon nicknamed extremophiles. One of the thermophilic bacteria, now called Thermus aquaticus, became the source of Taq polymerase, the heat-stable DNA polymerase that made the polymerase chain reaction (PCR) a household name in labs around the world!
Extremophile and “normal” bacteria are similar in size and shape(s) and lack nuclei. This initially suggested that most extremophiles were prokaryotes. But as Carl Woese demonstrated, it is the archaea and eukarya that share a more recent common ancestry! While some bacteria and eukaryotes can live in extreme environments, the archaea include the most diverse extremophiles. Here are some examples of extremophiles:
Acidophiles: grow at acidic (low) pH.
Alkaliphiles: grow at high pH.
Halophiles: require high salt concentrations; see Halobacterium salinarium below.
Methanogens: produce methane; a cross section of Methanosarcina acetivorans is shown above (right). Note the absence of significant internal structure.
Barophiles: grow best at high hydrostatic pressure.
Psychrophiles: grow best at temperature 15 °C or lower.
Xerophiles: growth at very low water activity (drought or near drought conditions).
Thermophiles and hyperthermophiles: organisms that grow best at 40°C or higher, or 80°C or higher, respectively. Pyrolobus fumarii, a hyperthermophile, can live at a temperature 113°C. Another thermophile Thermus aquaticus, noted for its role in developing the polymerase chain reaction, is shown below.
Toxicolerants: grow in the presence of high levels of damaging elements (e.g., pools of benzene, nuclear waste).
Archaea were originally seen as oddities of life, thriving in unfriendly environments. They also include organisms living in less extreme environments, including soils, marshes and even in the human colon. They are also abundant in the oceans where they are a major part of plankton, participating in the carbon and nitrogen cycles. In the guts of cows, humans and other mammals, methanogens facilitate digestion, generating methane gas in the process. In fact, cows have even been cited as a major cause of global warming because of their prodigious methane emissions! On the plus side, methanogenic Archaea are being exploited to create biogas and to treat sewage. Other extremophiles are the source of enzymes that function at high temperatures or in organic solvents. As already noted, some of these have become part of the biotechnology toolbox.
C. The Eukaryotes
1. Large Compartmentalized Cells
The volume of a typical eukaryotic cell is some 1000 times that of a typical bacterial cell. Eukaryotic life would not even have been possible if not for a division of labor of eukaryotic cells among different organelles (membrane-bound structures). Imagine a bacterium as a 100 square foot room (the size of a small bedroom, or a large walk-in closet!) with one door. Now imagine a room 1000 times as big. That is, imagine a 100,000 square foot ‘room’. You would expect many smaller rooms inside such a large space, each with its own door(s). The eukaryotic cell is a lot like that large space, with lots of interior “rooms” (i.e., organelles) with their own entryways and exits. The smaller prokaryotic “room” has a much larger plasma membrane surface area/volume ratio than a typical eukaryotic cell, enabling required environmental chemicals to enter and quickly diffuse throughout the cytoplasm of the bacterial cell. Chemical communication between parts of a small cell is therefore rapid. In contrast, the communication over a larger expanse of cytoplasm inside a eukaryotic cell requires the coordinated activities of subcellular compartments. Such communication might be relatively slow. In fact, eukaryotic cells have lower rates of metabolism, growth and reproduction than do prokaryotic cells. The existence of large cells required the evolution of a division of labor supported by compartmentalization.
2. Animal and Plant Cell Structure Overview
Typical animal and plant cells with their organelles and other structures are illustrated below.
A plasma (cell) membrane surrounds all cells. A cell wall further surrounds prokaryotic, algal, fungal and plant cells, creating rigid structure around the cell membrane and supporting cell shape. Bacterial cell walls are composed of peptidoglycan, long polysaccharide chains attached to polypeptide (amino acid) chains. Cellulose, hemicellulose, and pectin are major polysaccharides of the plant cell wall. Fungal cells contain a wall, whose principal component is chitin. Chitin is the same material that makes up the exoskeleton or arthropods (including insects and lobsters!). Fungi, more closely related to animal than plant cells, are a curious beast for a number of reasons! For one thing, the organization of fungi and fungal cells is somewhat less defined than animal cells. Structures between cells called septa separate fungal hyphae, allow passage of cytoplasm and even organelles between cells. Some primitive fungi have few or no septa, in effect creating coenocytes, which are single giant cells, with multiple nuclei.
We end this look at the domains of life by noting that, while eukaryotes are a tiny minority of all living species, “their collective worldwide biomass is estimated at about equal to that of prokaryotes” (Wikipedia). On the other hand, our bodies contain 10 times as many microbial cells as human cells! In fact, it is becoming increasingly clear that a human owes as much of its existence to its microbiota (see above) as it does to its human cells. Keeping in mind that plants and animal cells share many internal structures and organelles that perform the same or similar functions, let’s look at them and briefly describe their functions. | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/01%3A_Cell_Tour_Lifes_Properties_and_Evolution_Studying_Cells/1.03%3A_Domains_of_Life.txt |
A. The Nucleus
The nucleus separates the genetic blueprint, i.e., DNA from the cell cytoplasm. Although the eukaryotic nucleus breaks down during mitosis and meiosis as chromosomes form and cells divide, it spends most of its time in interphase, the time between cell divisions. This is where the status of genes (and therefore of the proteins produced in the cell) is regulated. rRNA, tRNA and mRNA are transcribed from genes, processed in the nucleus, and exported to the cytoplasm through nuclear pores. Some other RNAs remain in the nucleus, typically participating in the regulation of gene activity. In all organisms, dividing cells must produce and partition copies of their duplicated genetic material equally between new daughter cells. Let’s look first at the structural organization of the nucleus, and then at its role in the genetics of the cell and of the whole organism.
1. Structure of the Interphase Nucleus
The nucleus is the largest organelle in the cell. A typical electron microscope image of a nucleus, the largest eukaryotic organelle in a cell, is shown below.
This cross-section of an interphase nucleus reveals its double membrane, or nuclear envelope. The outer membrane of the nuclear envelope is continuous with the RER (rough endoplasmic reticulum). Thus, the lumen of the RER iscontinuous with the space separating the nuclear envelope membranes. The electron micrograph also shows a prominent nucleolus (labeled n) and a darkly granular RER surrounding the nucleus. Zoom in on the micrograph; you may see the double membrane of the nuclear envelope. You can also make out ribosomes (small granules) bound to both the RER and the outer nuclear membrane. Nuclear envelope pores (illustrated in the cartoon at the right) allow large molecules and even particles to move in and out of the nucleus across both membranes.
The nucleus is not an unorganized space surrounded by the nuclear envelope, as seems to appear in the transmission electron micrographs. The nucleolus is just the largest of several nuclear inclusions that seem to segregate nuclear functions.
Santiago Ramón y Cajal reported more structures in the nuclei of neurons more than 100 years ago, drawing his observations before modern photomicrographic technology became widely available. See what he saw at Cajal's Nuclear Bodies, including the nucleolus and what came to be known as Cajal bodies (CBs). As we saw earlier, Ramón y Cajal shared the Nobel Prize in Physiology or Medicine 1906 with Camillo Golgi for their studies of nerve cell structure. Check out a gallery of Cajal’s hand-drawn micrographs of brain nerve cells in Cajal's Beautiful Brain Cells.
Later seen in an electron microscope, CBs look like coils of tangled thread, and were thus called coiled bodies (conveniently, also CBs). Other nuclear bodies since identified include Gems, PML bodies, nuclear speckles (or splicing speckles), histone locus bodies (HLBs) …, and more! Different nuclear bodies turn out to be associated with specific proteins. The localization of specific proteins to different nuclear bodies can be seen in the immunofluorescence micrograph below.
Nucleoli contain fibrillarin proteins and stain red because they have been treated with red-fluorescence-tagged antifibrillarin antibodies. CBs contain the protein coilin. They fluoresce pink because the nuclei were treated with fluorescence- tagged anticoilin antibodies. Green-fluorescent antibodies to the ASF/SF2 protein localize to nuclear speckles. As part of, or included in a nuclear matrix, nuclear bodies organize and regulate different aspects of nuclear activity and molecular function. The different nuclear bodies perform specific functions and interact with each other and with proteins DNA and RNA to do so. We will revisit some nuclear bodies in their working context in later chapters.
2. Every Cell (i.e., Every Nucleus) of an Organism Contains the Same Genes
We read earlier that bacteria are busy doubling and partitioning their naked DNA chromosomes at the same time as they grow and divide by binary fission. In eukaryotic cells, a cell cycle divides life into discrete consecutive events. During most of the cell cycle, cells are in interphase and DNA is wrapped up in proteins in a structure called chromatin. It is not merely the DNA, but chromatin that must be duplicated when cells reproduce. Duplication of DNA involves rearranging chromatin proteins. This occurs before cell division (mitosis and cytokinesis). As the time of cell division nears, chromatin associates with even more proteins, condensing to form chromosomes, while the nuclear envelope dissolves.
You may recall that every somatic cell of an organism contains paired homologous chromosomes, and therefore two copies of every gene an organism owns. On the other hand, sperm and eggs contain one of each pair of chromosomes, and thus one copy of each gene. Whether by mitosis or meiosis, cytokinesis separates duplicated chromosomes to daughter cells. In the fluorescence micrograph of a cell in the metaphase stage of mitosis (below), the chromosomes (blue) are just about to be pulled apart by microtubules of the spindle apparatus (green).
As the chromosomes separate and daughter cells form, nuclei reappear and chromosomes de-condense. These events mark the major visible difference between cell division in bacteria and eukaryotes. Cytokinesis begins near the end of mitosis. Sexual reproduction, a key characteristic of eukaryotes, involves meiosis rather than mitosis. The mechanism of meiosis, the division of germ cells leading to production of sperm and eggs, is similar to mitosis except that the ultimate daughter cells have just one each of the parental chromosomes, eventually to become the gametes (eggs or sperm).
A key take-home message here is that every cell in a multicellular organism, whether egg, sperm or somatic, contains the same genome (genes) in its nucleus. This was understood since mitosis and meiosis were first described in the late 19th century. However, it was finally demonstrated in 1962, when John Gurdon and Shinya Yamanaka transplanted nuclei from the intestinal cells the frog Xenopus laevis into enucleated eggs (eggs from which its own nucleus had been removed). These ‘eggs’ grew and developed into normal tadpoles, proving that no genes are lost during development, but just expressed differentially.
We will revisit animal cloning later in this book. But for now, it’s sufficient to know that Molly the cloned frog was followed in 1996 by Dolly, the first cloned sheep, and then other animals, all cloned from enucleated eggs transplanted with differentiated cell nuclei. Click Cloning Cuarteterra for the 60 Minutes story of the cloning of Cuarteterra, a champion polo mare whose clones are also champions! For their first animal cloning experiments, Gurdon and Yamanaka shared the 2012 Nobel Prize form Physiology or medicine.
B. Ribosomes
On the other end of the size spectrum, ribosomes are evolutionarily conserved protein synthesizing machines in all cells. They consist of a large and a small subunit, each made up of multiple proteins and one or more molecules of ribosomal RNA (rRNA). Ribosomes bind to messenger RNA (mRNA) molecules, moving along the mRNA as they translate 3-base code words (codons) to link amino acids into polypeptides. Multiple ribosomes can move along the same mRNA, becoming a polyribosome, simultaneously translating the same polypeptide encoded by the mRNA. The granular appearance of cytoplasm in electron micrographs is largely due to the ubiquitous distribution of ribosomal subunits and polysomes in cells.
The illustration below shows a ‘string’ of ribosomes, the polyribosome or polysome for short.
In the illustration, ribosomes assemble at the left of the messenger RNA (mRNA) to form the polysome. When they reach the end of the message, the ribosomes disassemble from the RNA and release the finished polypeptide.
In an electron micrograph of leaf cells from a quiescent desiccated dessert plant, Selaginella lepidophylla, you can make out randomly distributed ribosomes and ribosomal subunits (arrows, below left). In cells from a fully hydrated plant, you can see polysomes as more organized strings of ribosomes (arrows, below right).
Eukaryotic and prokaryotic ribosomes differ in the number of RNA and proteins in their large and small subunits, and thus in their overall size. Isolated ribosomes centrifuged in a sucrose density gradient move at a rate based on their size (or more specifically, their mass).
The illustration below shows the difference in ribosomal ‘size’, their protein composition and the number and sizes of their ribosomal RNAs.
The position of ribosomal subunits in the gradient is represented by an S value, after Svedborg, who first used sucrose density gradients to separate macromolecules and particles by mass. Note that the ribosomal RNAs themselves also separate on sucrose density gradients by size, hence their different S values.
101 Ribosomes & Polysomes
C. Internal membranes and the Endomembrane System
Microscopists of the 19th century saw many of these structures using the art of histology, staining cells to increase the visual contrast between cell parts. One of these, Camillo Golgi, an early neurobiologist, developed a silver (black) stain that first detected a network of vesicles we now call Golgi bodies (Golgi vesicles) in nerve cells. For their discoveries in cellular neuroscience, Golgi and Santiago Ramón y Cajal shared the 1906 Nobel prize for Medicine or Physiology.
Many vesicles and vacuoles in cells, including Golgi vesicles, are part of the endomembrane system. Proteins synthesized on the ribosomes of the RER (rough endoplasmic reticulum) can enter the interior space (lumen) or can become part of the RER membrane itself. Production of RER, SER (smooth endoplasmic reticulum), Golgi bodies, lysosomes, microbodies and other vesicular membranes, as well as their protein content all begin in the RER. The RER and protein contents bud into transport vesicles that fuse with Golgi Vesicles (G in the electron micrograph below).
In their journey through the endomembrane system, packaged proteins undergo stepwise modifications (maturation) before becoming biologically active (below).
102 Golgi Vesicles & the Endomembrane System
Some proteins made in the endomembrane system are secreted by exocytosis. Others end up in organelles like lysosomes that contain hydrolytic enzymes. These enzymes are activated when the lysosomes fuse with other organelles destined for degradation. Food vacuoles form when a plasma membrane invaginates, engulfing food particles. They then fuse with lysosomes to digest the engulfed nutrients.
Autophagosomes are small vesicles that surround and eventually encapsulate tired organelles (for example, worn out mitochondria), eventually merging with lysosomes whose enzymes degrade their contents. In 2016, Yoshinori Ohsumi earned the Nobel Prize in Physiology and Medicine for nearly 30 years of research unraveling the cell and molecular biology of autophagy. Microbodies are a class of vesicles smaller than lysosomes, but formed by a similar process. Among them are peroxisomes that break down toxic peroxides formed as a by-product of cellular biochemistry. Some vesicles emerging from the RER will become part of the SER, which has several different functions (e.g., alcohol detoxification in liver cells).
103 Smooth Endoplasmic Reticulum
Other organelles include the contractile vacuoles of freshwater protozoa that expel excess water that enters cells by osmosis. Some protozoa have extrusomes, vacuoles that release chemicals or structures that deter predators or enable prey capture. A large aqueous central vacuole dominates the volume of many higher plant cells. When filled with water, they will push all other structures against the plasma membrane. In a properly watered plant, this water-filled vacuole exerts osmotic pressure that among other things, keeps plant leaves from wilting and stems upright.
D. Mitochondria and Plastids
Nearly all eukaryotic cells contain mitochondria, shown below.
A double membrane surrounds the mitochondrion. Each contains and replicates its own DNA containing genes encoding some mitochondrial proteins. Note that the surface area of the inner mitochondrial membrane is increased by being folded into cristae, which are sites of cellular respiration (aerobic nutrient oxidation).
Earlier, we speculated eukaryotic organelles that could have originated within bacteria. Mitochondria most likely evolved from a complete aerobic bacterium (or proto- bacterium) that was engulfed by a primitive eukaryotic cell. The bacterium escaped destruction, becoming an endosymbiont in the host cell cytoplasm. Lynn Margulis first proposed the Endosymbiotic Theory (Margulis, L. [Sagan, L], 1967. On the origin of mitosing cells. Journal of Theoretical Biology 14 (3): 225–274; available at: Margulis L. Endosymbiotic theory). Margulis proposed that chloroplasts also started as endosymbionts. Like mitochondria, the plastids of plants and some algae have their own DNA, most likely originating as cyanobacteria engulfed by primitive eukaryotic cells. Living in symbiosis with the rest of the cell, they would eventually evolve into plastids, including chloroplasts. Detailed evidence for the Endosymbiotic Theory is discussed elsewhere.
A handful of protozoa were found lacking mitochondria and other organelles. This had suggested they might share ancestry with those primitive eukaryotes that acquired mitochondria by endosymbiosis. However, since such cells contain other organelles such as hydrogenosomes and mitosomes, it is thought more likely that these species once had, but then lost mitochondria. Therefore, descendants of ancient eukaryotic cells missing mitochondria probably no longer exist.
Chloroplasts and cyanobacteria contain chlorophyll and use a similar photosynthetic mechanism to make glucose. A typical chloroplast is shown in the micrograph below (left). A chloroplast beginning to store nutrient sugar as starch is at the right.
A leucoplast is a plastid a chloroplast that has become filled with starch granules. In the micrograph below, you can see that, because of starch accumulation, the grana have become dispersed and indistinct, forming a leucoplast.
105 Endosymbiosis-Mitochondria & Chloroplasts
E.Cytoskeletal structures
We have come to understand that the cytoplasm of a eukaryotic cell is highly structured, permeated by rods and tubules. The three main components of this cytoskeleton are microfilaments, intermediate filaments and microtubules.
Microtubules are composed of a- and b-tubulin protein monomers. Monomeric actin proteins make up microfilaments. Intermediate filament proteins are related to keratin, a protein found in hair, fingernails, bird feathers, etc. Cytoskeletal rods and tubules not only determine cell shape, but also play a role in cell motility. This includes the movement of cells from place to place and the movement of structures within cells.
We have already noted that a prokaryotic cytoskeleton is composed in part of proteins homologous to actins and tubulins. As in a eukaryotic cytoskeleton, these bacterial proteins may play a role in maintaining or changing cell shape. On the other hand, flagellum-powered movement in bacteria relies on flagellin, a protein not found in eukaryotic cells. A bacterial flagellum is actually a rigid hook-like structure attached to a molecular motor in the cell membrane that spins to propel the bacterium through a liquid medium.
In contrast, eukaryotic microtubules slide past one another causing a more flexible flagellum to undulate in wave-like motions. Likewise, the motion of a eukaryotic cilium is based on sliding microtubules, in this case causing the cilia to beat rather than undulate. Cilia are involved not only in motility, but also in feeding and sensation. The structures and assembly of the main cytoskeletal components are shown below.
Microtubules in eukaryotic flagella and cilia arise from a basal body (similar to kinetosomes or centrioles). Aligned in a flagellum or cilium, microtubules form an axoneme surrounded by plasma membrane. In electron micrographs of cross sections, a ciliary or flagellar axoneme is typically organized as a ring of nine paired microtubules (called doublets) around two singlet microtubules (illustrated below).
Centrioles are themselves comprised of a ring of microtubules. In animal cells they participate in spindle fiber formation during mitosis and are the point from which microtubules radiate thorough the cell to help form and maintain its shape. These structures do not involve axonemes. The spindle apparatus in plant cells, which typically lack centrioles, form from an amorphous structure called the MTOC, or MicroTubule Organizing Center, which serves the same purpose in mitosis and meiosis as centrioles do in animal cells.
106 Filaments & Tubules of the Cytoskeleton
Elsewhere, we describe how microfilaments and microtubules interact with motor proteins (dynein, kinesin, myosin, etc.) to generate force that results in the sliding of filaments and tubules to allow cellular movement. You will see that motor proteins can also carry cargo molecules from one place to another in a cell. | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/01%3A_Cell_Tour_Lifes_Properties_and_Evolution_Studying_Cells/1.04%3A_Tour_of_the_Eukaryotic_Cell.txt |
We can see and describe cell parts in the light or electron microscope, but we could not definitively know their function until it became possible to release them from cells and separate them from one another. This became possible with the advent of differential centrifugation. Under centrifugal force generated by a spinning centrifuge, subcellular structures separate by differences in mass. Structures that are more massive reach the bottom of the centrifuge tube before less massive ones. A cell fractionation scheme is illustrated below. Biochemical analysis of the isolated cell fractions can reveal what different organelles and cellular substructures do.
107 Dissecting the Cell; a Cell Fractionation Scheme
Cell fractionation separates cells into their constituent parts. The first step of a cell fractionation is to break open the cells and release their contents. This can be done by physical means such as grinding in a mortar and pestle, tissue grinder or similar device, exposure to ultrasound or high pressure, or exposure to enzymes or other chemicals that can selectively degrade the plasma membrane. The next step is to isolate the subcellular organelles and particles from the cytoplasm (i.e., cytosol) by differential centrifugation. As noted, centrifugation of broken cells at progressively higher centrifugal force separates particulate cell components based on their mass. At the end of this process, a researcher will have isolated mitochondria, chloroplasts, nuclei, ribosomes etc. After re-suspension, each pellet can be re-suspended and prepared for microscopy.
Below are electron micrographs of several isolated subcellular fractions.
These structures can be tentatively identified by microscopy based on their dimensions and appearance. Molecular analyses and biochemical tests on the cell fractions then help to confirm these identities.
Can you tell what organelles have been purified in each of these fractions based on the electron micrographs alone? Consider the structures on the left as an example. These were found in a low speed centrifugal pellet, implying that they are large structures. They look a bit like nuclei, which are also the largest structures in a eukaryotic cell. What biochemical or functional tests might you do to confirm that the four structures shown from left to right are isolated nuclei, rough endoplasmic reticulum, Golgi vesicles and mitochondria? Physical separation combined with biochemical-molecular analysis of subcellular structures has revealed their basic functions and continue to reveal previously un-noticed structures and functions in cells.
All of cell and molecular biology is devoted to understanding how prokaryotic and eukaryotic cells (and organisms) use their common structural and biochemical inheritance to meet very different survival strategies. As you progress in your studies, watch for experiments in which cell parts are separated and reassembled, or reconstituted. Reconstitution is one of the recurring experimental themes involving the functional analysis of cell components. Look for this theme as you continue your studies. Look also for another theme, namely how evolution can account for the common biochemistry and genetics of life…, and its structural diversity!
1.06: The Origins Evolution Speciation Diversity and Unity of Life
The question of how life began has been with us since the beginnings or recorded history. It is now accepted that there was a time, however brief or long, when the earth was a lifeless (prebiotic) planet. Life’s origins on earth date to some 3.7-4.1 billion years ago under conditions that favored the formation of the first cell, the first entity with all of the properties of life. But couldn’t those same conditions have spawned multiple cells independently, each with all of the properties of life? If so, from which of these did life, as we know it today, descend? Whether there were one or more different “first cells”, evolution (a property of life) only began with those cells.
115 Properties of Life
The fact that there is no evidence of cells of independent origin may reflect that they never existed. Alternatively, the cell we call our ancestor was evolutionarily successful at the expense of other life forms, which thus became extinct. In any event, whatever this successful ancestor may have looked like, its descendants would have evolved quite different appearances, chemistries and physiologies. These descendant cells would have found different genetic and biochemical solutions to achieving and maintaining life’s properties. One of these descendants evolved the solutions we see in force in all cells and organisms alive today, including a common (universal) genetic code to store life’s information, as well as a common mechanism for retrieving the encoded information. Francis Crick called is commonality the “Central Dogma” of biology. That ancestral cell is called our Last Universal Common Ancestor, or LUCA.
Elsewhere we consider in more detail how we think about the origins of life. For now, our focus is on evolution, the property of life that is the basis of speciation and life’s diversity.
Natural selection was Charles Darwin’s theory for how evolution led to the structural diversity of species. New species arise when beneficial traits are naturally selected from genetically different individuals in a population, with the concomitant culling of less fit individuals from populations over time. If natural selection acts on individuals, evolution results from the persistence and spread of selected, heritable changes through successive generations in a population. Evolution is reflected as an increase in diversity and complexity at all levels of biological organization, from species to individual organisms to molecules. For an easy read about the evolution of eyes (whose very existence according to creationists could only have formed by intelligent design by a creator), see the article in National Geographic by E. Yong (Feb., 2016, with beautiful photography by D. Littschwager).
Repeated speciation occurs with the continual divergence of life forms from an ancestral cell through natural selection and evolution. Our shared cellular structures, nucleic acid, protein and metabolic chemistries (the ‘unity’ of life) supports our common ancestry with all life. These shared features date back to our LUCA! Most living things even share some early behaviors. Take our biological clock, an adaptation to our planet’s 24 hour daily cycles of light and dark that have been around since the origins of life; all organisms studied so far seem to have one!. The discovery of the genetic and molecular underpinnings of circadian rhythms (those daily cycles) earned Jeffrey C. Hall, Michael Rosbash and Michael W. Young the 2017 Nobel Prize in Medicine or Physiology (click Molecular Studies of Circadian Rhythms wins Nobel Prize to learn more)!
The molecular relationships common to all living things largely confirm what we have learned from the species represented in the fossil record. Morphological, biochemical and genetic traits that are shared across species are defined as homologous, and can be used to reconstruct evolutionary histories. The biodiversity that scientists (in particular, environmentalists) try to protect is the result of millions of years of speciation and extinction. Biodiversity needs protection from the unwanted acceleration of evolution arising from human activity, including blatant extinctions (think passenger pigeon), and near extinctions (think American bison by the late 1800s). Think also of the consequences the introduction of invasive aquatic and terrestrial species and the effects of climate change.
Let’s look at the biochemical and genetic unity among livings things. We’ve already considered what happens when cells get larger in evolution when we tried to explain how larger cells divided their labors among smaller intracellular structures and organelles. When eukaryotic cells evolved into multicellular organisms, it became necessary for the different cells to communicate with each other and to respond to environmental cues.
Some cells evolved mechanisms to “talk” directly to adjacent cells and others evolved to transmit electrical (neural) signals to other cells and tissues. Still other cells produced hormones to communicate with cells to which they had no physical attachment. As species diversified to live in very different habitats, they also evolved very different nutritional requirements, along with more extensive and elaborate biochemical pathways to digest their nutrients and capture their chemical energy. Nevertheless, despite billions of years of obvious evolution and astonishing diversification, the underlying genetics and biochemistry of living things on this planet is remarkably unchanged. Early in the 20th century, Albert Kluyver first recognized that cells and organisms vary in form appearance in spite of the essential biochemical unity of all organisms (see Albert Kluyver in Wikipedia). This unity amidst the diversity of life is a paradox of life that we will probe further in this course.
A. Genetic Variation, the Basis of Natural Selection
DNA contains the genetic instructions for the structure and function of cells and organisms. When and where a cell or organism’s genetic instructions are used (i.e., to make RNA and proteins) are regulated. Genetic variation results from random mutations. Genetic diversity arising from mutations is in turn, the basis of natural selection during evolution.
119 The Random Basis of Evolution
B. The Genome: An Organism’s Complete Genetic Instructions
We’ve seen that every cell of an organism carries the DNA including gene sequences and other kinds of DNA. The genome of an organism is the entirety of its genetic material (DNA, or for some viruses, RNA). The genome of a common experimental strain of E. coli was sequenced by 1997 (Blattner FR et al. 1997The complete genome sequence of Escherichia coli K-12. Science 277:1452-1474). Sequencing of the human genome was completed by 2001, well ahead of the predicted schedule (Venter JC 2001The sequence of the human genome. Science 291:1304-1351). As we have seen in the re-classification of life from five kingdoms into three domains, nucleic acid sequence comparisons can tell us a great deal about evolution. We now know that evolution depends not only on gene sequences, but also, on a much grander scale, on the structure of genomes. Genome sequencing has confirmed not only genetic variation between species, but also considerable variation between individuals of the same species. Genetic variation within species is in fact the raw material of evolution. It is clear from genomic studies that genomes have been shaped and modeled (or remodeled) in evolution. We’ll consider genome remodeling in more detail elsewhere.
C. Genomic ‘Fossils’ Can Confirm Evolutionary relationships.
It had been known for some time that gene and protein sequencing could reveal evolutionary relationships and even familial relationships. Read about an early demonstration of such relationships based on amino acid sequence comparisons across evolutionary time in Zuckerkandl E and Pauling L. (1965) Molecules as documents of evolutionary theory. J. Theor. Biol. 8:357-366. It is now possible to extract DNA from fossil bones and teeth, allowing comparisons of extant and extinct species. DNA has been extracted from the fossil remains of humans, other hominids, and many animals. DNA sequencing reveals our relationship to each other, to our hominid ancestors and to animals from bugs to frogs to mice to chimps to Neanderthals to… Unfortunately, DNA from organisms much older than 10,000 years is typically so damaged or simply absent, that relationship building beyond that time is impossible. Now in a clever twist, using what we know from gene sequences of species alive today, investigators recently ‘constructed’ a genetic phylogeny suggesting the sequences of genes of some of our long-gone progenitors, including bacteria (click here to learn more: Deciphering Genomic Fossils). The comparison of these ‘reconstructed’ ancestral DNA sequences suggests when photosynthetic organisms diversified and when our oxygenic planet became a reality.
120 Genomic Fossils- Molecular Evolution | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/01%3A_Cell_Tour_Lifes_Properties_and_Evolution_Studying_Cells/1.05%3A_How_We_Know_the_Functions_of_Cellular_Organelles_and_Structures-_Cell_Frac.txt |
Broadly speaking, there are two kinds of microscopy. In Light Microscopy, the specimen on the slide is viewed through optical glass lenses. In Electron Microscopy, the viewer is looking at an image on a screen created by electrons passing through, or reflected from the specimen. For a sampling of light and electron micrographs, check out this Gallery of Micrographs. Here we compare and contrast different microscopic techniques.
A. Light Microscopy
Historically one form or other of light microscopy has revealed much of what we know of cellular diversity. Check out the Drawings of Mitosis for a reminder of how eukaryotic cells divide and then check out The Optical Microscope for descriptions of different variations of light microscopy (e.g., bright-field, dark field, phase-contrast, fluorescence, etc.). Limits of magnification and resolution of 1200X and 2 mm, (respectively) are common to all forms of light microscopy. The main variations of light microscopy are briefly described below.
1. Bright-Field microscopy is the most common kind of light microscopy, in which the specimen is illuminated from below. Contrast between regions of the specimen comes from the difference between light absorbed by the sample and light passing through it. Live specimens lack contrast in conventional bright-field microscopy because differences in refractive index between components of the specimen (e.g., organelles and cytoplasm in cells) diffuse the resolution of the magnified image. This is why Bright-Field microscopy is best suited to fixed and stained specimens.
2. In Dark-field illumination, light passing through the center of the specimen is blocked and the light passing through the periphery of the beam is diffracted (“scattered”) by the sample. The result is enhanced contrast for certain kinds of specimens, including live, unfixed and unstained ones.
3. In Polarized light microscopy, light is polarized before passing through the specimen, allowing the investigator to achieve the highest contrast by rotating the plane of polarized light passing through the sample. Samples can be unfixed, unstained or even live.
4. Phase-Contrast or Interference microscopy enhances contrast between parts of a specimen with higher refractive indices (e.g., cell organelles) and lower refractive indices (e.g., cytoplasm). Phase–Contrast microscopy optics shift the phase of the light entering the specimen from below by a half a wavelength to capture small differences in refractive index and thereby increase contrast. Phase–Contrast microscopy is a most cost-effective tool for examining live, unfixed and unstained specimens.
5. In a fluorescence microscope, short wavelength, high-energy (usually UV) light is passed through a specimen that has been treated with a fluorescing chemical covalently attached to other molecules (e.g., antibodies) that fluoresces when struck by the light source. This fluorescent tag was chosen to recognize and bind specific molecules or structures in a cell. Thus, in fluorescence microscopy, the visible color of fluorescence marks the location of the target molecule/structure in the cell.
6. Confocal microscopy is a variant of fluorescence microscopy that enables imaging through thick samples and sections. The result is often 3D-like, with much greater depth of focus than other light microscope methods. Click at Gallery of Confocal Microscopy Images to see a variety of confocal micrographs and related images; look mainly at the specimens.
7. Lattice Light-Sheet Microscopy is a 100 year old variant of light microscopy that allows us to follow subcellular structures and macromolecules moving about in living cells. It was recently applied to follow the movement and sub-cellular cellular location of RNA molecules associated with proteins in structures called RNA granules (check it out at RNA Organization in a New Light).
B. Electron Microscopy
Unlike light (optical) microscopy, electron microscopy generates an image by passing electrons through, or reflecting electrons from a specimen, and capturing the electron image on a screen. Transmission Electron Microscopy (TEM) can achieve much higher magnification (up to 106X) and resolution (2.0 nm) than any form of optical microscopy! Scanning Electron Microscopy (SEM) can magnify up to 105X with a resolution of 3.0-20.0 nm. TEM, together with biochemical and molecular biological studies, continues to reveal how different cell components work with each other. The higher voltage in High Voltage Electron microscopy is an adaptation that allows TEM through thicker sections than regular (low voltage) TEM. The result is micrographs with greater resolution, depth and contrast. SEM allows us to examine the surfaces of tissues, small organisms like insects, and even of cells and organelles. Check this link to Scanning Electron Microscopy for a description of scanning EM, and look at the gallery of SEM images at the end of the entry.
121 Electron Microscopy
1.08: Key Words and Terms
Actin
Eukaryotes
Nuclear envelope
Archaea
Eukaryotic flagella
Nuclear pores
Bacterial cell walls
Evolution
Nucleoid
Bacterial Flagella
Exocytosis
nucleolus
Binary fission
Extinction
Nucleus
Cell fractionation
Hypothesis
Optical microscopy
Cell theory
Inference
Plant cell walls
Chloroplasts
Intermediate filaments
Plasmid
chromatin
keratin
Progenote
Chromosomes
Kingdoms
Prokaryotes
Cilia
LUCA
Properties of life
Confocal microscopy
Lysosomes
Rough endoplasmic reticulum
Cytoplasm
Meiosis
Scanning electron microscopy
Cytoskeleton
Microbodies
Scientific method
Cytosol
Microfilaments
Secretion vesicles
Deduction
Microtubules
Smooth endoplasmic reticulum
Differential centrifugation
Mitochondria
Speciation
Diversity
Mitosis
Theory
Domains of life
Motor proteins
Tonoplast
Dynein
Mutation
Transmission electron microscopy
Endomembrane system
Natural selection
Tubulins | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/01%3A_Cell_Tour_Lifes_Properties_and_Evolution_Studying_Cells/1.07%3A_Microscopy_Reveals_Lifes_Diversity_of_Structure_and_Form.txt |
• 2.1: Introduction
In this chapter, we start with a review basic chemistry from atomic structure to molecular bonds to the structure and properties of water, followed by a review of key principles of organic chemistry - the chemistry of carbon-based molecules. You may find it useful to have your old general chemistry textbook handy, or check out the excellent introduction to general chemistry by Linus Pauling (1988, General Chemistry New York, Springer-Verlag).
• 2.2: Atoms and Basic Chemistry
The difference between elements and atoms is often confused in casual conversation. Both terms describe matter, substances with mass. Different elements are different kinds of matter distinguished by different physical and chemical properties. In turn, the atom is the fundamental unit of matter…, that is, of an element.
• 2.3: Chemical bonds
Atoms form bonds to make molecules. Covalent bonds are strong. They can involve unequal or equal sharing of a pair of electrons, leading to polar covalent bonds and non-polar covalent bonds respectively. Ionic bonds are weaker than covalent bonds, created by electrostatic interactions between elements that can gain or lose electrons. Hydrogen (H-) bonds are in a class by themselves! These electrostatic interactions account for the physical and chemical properties of water. They are also involved
• 2.4: A Close Look at Water Chemistry
Hydrogen bonds are a subcategory of electrostatic interaction (i.e., formed by the attraction of oppositely charges). As noted above, water molecules attract one another (cohere) because of strong electrostatic interactions that form H-bonds. Because of water’s polar covalent nature, it is able to attract positively and negatively charged groups of solutes, making it a good solvent.
• 2.5: Some Basic Biochemistry- Carbon, Monomers, Polymers and the Synthesis and Degradation of Macromolecules
Like evolution, the origin of life involved some prebiotic ‘natural selection’ of chemicals in the environment. As with evolution, this chemical selection would favor expanding possibility and diversity. In simple terms, atoms that could interact with a maximal number of other atoms to form the largest number of stable molecules would have been most likely to accumulate in the environment. The tetravalent C atom met these criteria for chemical selection, proving perfect for building an organic c
• 2.6: Key Words and Terms
Thumbnail: Oleic acid is a fatty acid that occurs naturally in various animal and vegetable fats and oils. I can have several conformer including cis and trans forms (Publci Domain; Benjah-bmm27 via Wikipedia)
02: Basic Chemistry Organic Chemistry and Biochemistry
In this chapter, we start with a review basic chemistry from atomic structure to molecular bonds to the structure and properties of water, followed by a review of key principles of organic chemistry - the chemistry of carbon-based molecules. You may find it useful to have your old general chemistry textbook handy, or check out the excellent introduction to general chemistry by Linus Pauling (1988, General Chemistry New York, Springer-Verlag). We’ll see how the polar covalent bonds define the structure and explain virtually all of properties of water. These range from the energy required to melt a gram of ice to vaporize a gram of water to its surface tension to its ability to hold heat…, not to mention its ability to dissolve a wide variety of solutes from salts to proteins and other macromolecules. We will distinguish water’s hydrophilic interactions with solutes from its hydrophobic interactions with fatty molecules. Then, we review some basic biochemistry. Well-known biological molecules include monomers (sugars, amino acids, nucleotides, lipids…) and polymers (polysaccharides, proteins, nucleic acids, fats…).
Biochemical reactions that link glucose monomers into polymers on the one hand, and break the polymers down on the other are essential reactions for life on earth. Photosynthetic organisms link glucose monomers into starch, a polysaccharide. Amylose is a simple starch, a large homopolymer of repeating glucose monomers. Likewise, polypeptides are heteropolymers of 20 different amino acids. DNA and RNA nucleic acids are also heteropolymers, made using only four different nucleotides.
When you eat, digestive enzymes in your gut catalyze the hydrolysis of the plant or animal polymers we ate back down to monomers. Hydrolysis adds a water molecule across the bonds linking the monomers in the polymer. Our cells then take up the monomers. Once in our cells, condensation (dehydration synthesis) reactions remove water molecules from participating monomers to grow new polymers that are more useful to us. While they are not, strictly speaking, macromolecules, triglycerides (fats) and phospholipids are also broken down by hydrolysis and synthesized in condensation reactions. Triglycerides are energy-rich molecules, while phospholipids (chemical relatives of triglycerides) are the basis of cellular membrane structure.
Relatively weak interactions between macromolecules, for example, hydrogen bonds (H-bonds), electrostatic interactions, Van der Waals forces, etc., hold many cellular structures and molecules together. Individually, these bonds are weak. But millions of them hold can the two complementary DNA strands tightly in a stable double helix. We will see this theme of strength in numbers repeated in other molecular and cellular structures. Monomers also serve other purposes related to energy metabolism, cell signaling etc. Depending on your chemistry background, you may find “Googling” these subjects interesting and useful. The short VOPs in this chapter might help as a guide to understanding the basic chemistry and biochemistry presented here.
Learning Objectives
When you have mastered the information in this chapter, you should be able to:
1. compare and contrast the definitions of atom, element and molecule.
2. List differences between atoms, elements and molecules and between energy and
position-based atomic models.
3. describe sub-atomic particle behavior when they absorb and release energy.
4. state the difference between atomic shells and orbitals.
5. state how kinetic and potential energy applies to atoms and molecules.
6. explain the behavior of atoms or molecules that fluoresce when excited by high- energy radiation…, and those that do not.
7. distinguish polar and non-polar covalent bonds and their physical-chemical properties.
8. predict the behavior of electrons in compounds held together by ionic interactions.
9. explain how the properties of water account for the solubility of salts and macromolecules and the role of H-bonds in support those properties.
10. consider why some salts are not soluble in water in terms of water’s properties.
11. describe how molecular linkages form during polymer metabolism and place hydrolytic and dehydration synthetic reactions in a metabolic context.
12. distinguish between chemical “bonds” and “linkages” in polymers.
13. categorize different chemical bonds based on their strengths. | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/02%3A_Basic_Chemistry_Organic_Chemistry_and_Biochemistry/2.01%3A_Introduction.txt |
A. Overview of Elements and Atoms
The difference between elements and atoms is often confused in casual conversation. Both terms describe matter, substances with mass. Different elements are different kinds of matter distinguished by different physical and chemical properties. In turn, the atom is the fundamental unit of matter…, that is, of an element.
The number of positively charged protons and neutral neutrons in an atomic nucleus account for most of the mass of an atom. Each negatively charged electron that orbits a nucleus is about 1/2000th of the mass of a proton or neutron. Thus, they do not add much to the mass of an atom. Electrons stay in atomic orbits because of electromagnetic forces, i.e., their attraction to the positively charged nuclei. Nuclear size (mass) and the cloud of electrons around its nucleus define structure of an atom. And that structure dictates the different properties of the elements.
Recall that atoms are chemically most stable when they are electrically uncharged, with an equal number of protons and electrons. Isotopes of the same element are atoms with the same number of protons and electrons, but a different number of neutrons. Therefore, isotopes are also chemically stable, but they may not be physically stable. For example, the most abundant isotope of hydrogen contains one proton, one electron and no neutrons. The nucleus of the deuterium isotope of hydrogen contains one neutron and that of tritium contains two neutrons. Both isotopes can be found in water molecules. Deuterium is stable. In contrast, the tritium atom is radioactive, subject to nuclear decay over time. Whether physically stable or not, all isotopes of an element share the same chemical and electromagnetic properties and behave the same way in chemical reactions.
The electromagnetic forces that keep electrons orbiting their nuclei allow the formation of chemical bonds in molecules. We model atoms to illustrate the average physical location of electrons (the orbital model) on one hand, and their potential energy levels (the Bohr, or shell model) on the other. Look at the models for helium illustrated below.
Up to two electrons move in a space defined as an orbital. In addition to occupying different areas around the nucleus, electrons exist at different energy levels, moving with different kinetic energy. Electrons can also absorb or lose energy, jumping or falling from one energy level to another.
A unique atomic number (number of protons) and atomic mass (usually measured in Daltons, or Da) characterize different elements. A unique symbol with a superscripted atomic number and a subscripted atomic mass number defines each element. Take the most common isotope of carbon (C) for example. Its atomic number is 6 (the number of protons in its nucleus) and its mass is 12 Da (6 protons and 6 neutrons at 1 Da each!). Remember that the mass of the electrons in a carbon (C) atom is negligible!
Find the C atom and look at some of the other atoms of elements in the partial periodic table below.
This partial periodic table shows the elements essential for all life in greater or lesser amounts, as well as some that may also be essential in humans.
122 Atoms and Elements
B. Electron Configuration – Shells and Subshells
The Bohr model of the atom reveals how electrons can absorb and release energy. The shells indicate the energy levels of electrons. Electrons can absorb different kinds of energy (radiation, light, electrical). For example, beaming UV light at atoms can excite electrons. If an electron absorbs a full quantum of energy (or a photon of radiant energy), it will be boosted from the ground state (the shell it normally occupies) into a higher shell, an excited state. Excited electrons move at greater speed around the nucleus, with more kinetic energy than it did at ground. Excited electrons also have more potential energy than ground state electrons. This is because they are unstable, releasing some of the energy gained during excitation as they return to ground, i.e., their starting energy level (shell), as shown below.
Electrons falling back to ground typically release excitation energy as heat. Atoms whose excited electrons release their energy as light fluoresce; they are fluorescent. A fluorescent light is an example of this phenomenon; electrical energy excites electrons out of atomic orbitals in molecules coating the interior surface of the bulb. As all those excited electrons return to ground state, they fluoresce, releasing light. These atoms can be repeatedly excited by electricity. As we shall see, biologists and chemists have turned fluorescence into tools of biochemistry, molecular biology and microscopy. The ground state is also called the resting state, but electrons at ground are by no means resting! They just move with less kinetic energy excited electrons.
123 Electron Energy & Fluorescence | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/02%3A_Basic_Chemistry_Organic_Chemistry_and_Biochemistry/2.02%3A_Atoms_and_Basic_Chemistry.txt |
Atoms form bonds to make molecules. Covalent bonds are strong. They can involve unequal or equal sharing of a pair of electrons, leading to polar covalent bonds and non-polar covalent bonds respectively. Ionic bonds are weaker than covalent bonds, created by electrostatic interactions between elements that can gain or lose electrons. Hydrogen (H-) bonds are in a class by themselves! These electrostatic interactions account for the physical and chemical properties of water. They are also involved in interactions between and within other molecules. While atoms can share, gain or lose electrons in chemical reactions, they will neither gain nor lose protons or neutrons. Let’s look more closely at chemical bonds and how even the weak bonds are essential to life.
A. Covalent Bonds
Electrons are shared in covalent bonds. Hydrogen gas (H2) is a molecule, not an atom! H atoms in the H2 molecule share their electrons equally. Likewise, the carbon atom in methane (CH4) shares electrons equally with four hydrogen atoms. The equal sharing of electrons in non-polar covalent bonds in H2 and CH4 is shown below.
A single pair of electrons in H2 forms the covalent bond between two H atoms in the hydrogen molecule. In methane, the carbon (C) atom has four electrons in its outer shell that it can share. Each H atom has a single electron to share. If the C atom shares its four electrons with the four electrons in the four H atoms, there will be four paired electrons (8 electrons in all) moving in filled orbitals around the nucleus of the C atom some of the time, and one pair moving around each of the H atomic nuclei some of the time. Thus, the outer shell of the C atom and each of the H atoms are filled at least some of the time. This stabilizes the molecule. Recall that atoms are most stable when their outer shells are filled and when each electron orbital is filled (i.e., with a pair of electrons).
Polar covalent bonds form when electrons in a molecule are shared unequally. This happens if the atomic nuclei in a molecule are very different in size. This is the case with water, shown below.
The larger nucleus of the oxygen atom in H2O attracts electrons more strongly than do either of the two H atoms. As a result, the shared electrons spend more of their time orbiting the O atom, such that the O atom carries a partial negative charge while each of the H atoms carry a partial positive charge. The Greek letter delta (d) indicates partial charges in polar covalent bonds. In the two illustrations above, compare the position of the paired electrons in water with those illustrated for hydrogen gas or methane.
Water’s polar covalent bonds allow it to attract and interact with other polar covalent molecules, including other water molecules. The polar covalent nature of water also goes a long way to explaining its physical and chemical properties, and why water is essential to life on this planet!
124 Covalent Bonds
Both polar and non-polar covalent bonds play a major role on the structure of macromolecules, like insulin, the protein hormone shown below.
The X-ray image of a space-filling model of the hexameric form of stored insulin (above left) emphasizes its tertiary structure in great detail. Regions of internal secondary structure are highlighted in the ribbon diagram on the right; as secreted from Islets of Langerhans cells of the pancreas, active insulin is a dimer of two polypeptides (A and B), shown here in blue and cyan respectively. The subunit structure and the interactions holding the subunits together result from many electrostatic interactions (including H-bonds) and other weak interactions. The disulfide bonds (bridges) seen as yellow ‘Vs’ in the ribbon diagram stabilize the associated A and B monomers. We will look at protein structure in more detail in an upcoming chapter.
B. Ionic Bonds
Atoms that gain or lose electrons to achieve a filled outer shell form ions, acquiring a negative or a positive charge, respectively. Despite being electrically charged, ions are stable because their outer electron shells are filled. Common table salt is a good example (illustrated below).
Na (sodium) can donate a single electron to Cl (chlorine) atoms, generating Na+ and Cl- ions. The oppositely charged ions then come together forming an ionic bond, an electrostatic interaction of opposite charges that holds the Na+ and Cl- ions together in crystal salt. Look up the Bohr models of these two elements and see how ionization of each leaves filled outer shells (energy levels) in the ions. | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/02%3A_Basic_Chemistry_Organic_Chemistry_and_Biochemistry/2.03%3A_Chemical_bonds.txt |
1. Hydrogen Bonds, the Polarity and Properties of Water
Hydrogen bonds are a subcategory of electrostatic interaction (i.e., formed by the attraction of oppositely charges). As noted above, water molecules attract one another (cohere) because of strong electrostatic interactions that form H-bonds. Because of water’s polar covalent nature, it is able to attract positively and negatively charged groups of solutes, making it a good solvent. Solutes (water-soluble molecules) or molecular surfaces attracted to water are hydrophilic. Lipids like fats and oils are not polar molecules and therefore do not dissolve in water; they are hydrophobic (from hydro, water; phobic, fearing).
Soluble salts like NaCl dissolve because the Cl- and Na+ ions more strongly attract the partial positive and negative charges (respectively) of water molecules. The result is that the ions separate. We call this separation of salt ionization. The ionization of NaCl dissolving in water is shown below.
Water is also a good solvent for macromolecules (proteins, nucleic acids) with exposed polar chemical groups on their surfaces that attract water molecules, as shown below.
125 Water, Hydrogen & ionic Bonds
In addition to being a good solvent, we recognize the following properties of water, all of which result from its polar nature and H-bonding abilities:
1. Cohesion: the ability of water molecules to stick together via H-bonds.
2. High Surface tension: water’s high cohesion means that it can be hard to break the surface; think the water strider, an insect that ‘walks’ on water.
3. Adhesion: this results from water’s electrostatic interactions with ions and the partial charges on polar covalent molecules or functional groups. Adhesion explains water’s solvent properties and (at least in part) capillary action where water molecules ‘crawl’ along hydrophilic surfaces, often against the force of gravity.
4. High specific heat: The cohesion of water molecules is so strong that it takes a lot of energy to separate the molecules and make them move faster, i.e., to heat water; specifically it takes 1 Kcal, (1 Calorie, with a capital C) to heat a gram of water 1oC. Incidentally, high specific heat also explains why water “holds its heat” (i.e., stays hotter longer that the pot that it’s in!).
5. High heat of vaporization: It takes even more energy per gram of water to turn it into water vapor!
2. Water Ionization and pH
One last property of water: it ionizes weakly to form H+ and OH- ions, - or more correctly, pairs of water molecules form H3O+ and OH- ions. You can think of this as happening in the following two reactions:
Acid molecules added to water dissociate and release protons. This drives reaction #2, forming more H3O+ ions in the solution, in turn driving reaction #1 forward. A pH meter measures the relative acidity or concentration of protons in a solution. Acidic solutions have a pH below 7.0 (neutrality).
Bases ionizing in water release OH- (hydroxyl) ions. The increase in OH- ions removes protons from the solution, driving both reaction in reverse and raising the pH of the solution.
To summarize acid-base chemistry:
When dissolved in water
1. Acids release H+
2. Bases accept H+
Since the pH of a solution is the negative logarithm of the hydrogen ion concentration,
PH and solution
1. at pH 7.0, a solution is neutral
2. below a pH of 7.0, a solution is acidic
3. above a pH of 7.0, a solution is basic
Check a basic chemistry book to remind yourself of the relationship between pH and the [H+] in a solution! | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/02%3A_Basic_Chemistry_Organic_Chemistry_and_Biochemistry/2.04%3A_A_Close_Look_at_Water_Chemistry.txt |
Like evolution, the origin of life involved some prebiotic ‘natural selection’ of chemicals in the environment. As with evolution, this chemical selection would favor expanding possibility and diversity. In simple terms, atoms that could interact with a maximal number of other atoms to form the largest number of stable molecules would have been most likely to accumulate in the environment. The tetravalent C atom met these criteria for chemical selection, proving perfect for building an organic chemistry set.
At the same time, water turned out to be the perfect place to launch prebiotic chemical selection experiments. Water persists as the life’s universal solvent, which by way, is why evidence of water in places beyond our earth gets us all excited!
A. Isomerism in Organic Molecules and the Diversity of Shape
The carbon skeleton is a perfect platform of organic molecule diversity. The differences in arrangement of atoms and functional chemical groups around C atom result in isomerism. Isomers of an organic molecule have the same chemical formula but different shapes (and so, potentially different chemical properties and biochemical function). The larger the carbon skeleton of an organic molecule, the greater the diversity of molecular shapes available for chemical selection.
Look at the examples of structural isomers and geometric isomers below.
It is easy to see that the structural isomers of C4H10 (above left and right) have different shapes. You cannot convert one structural isomer to the other without breaking covalent bonds. In the geometric isomers of C4H8 in the lower panel, the H atoms on the double-bonded C atoms can be on the same (cis) or opposite (trans) side of the planar double bond. Geometric isomers too, cannot be interconverted without breaking chemical bonds. Optical isomers are yet a third kind of isomer. They exist around optically active (asymmetric, or chiral) carbons. A chiral C is one that is covalently linked to four different atoms and/or molecular groups. The principle of chirality is illustrated below.
Optical isomers (also called enantiomers) also differ in shape, and just like structural and geometric isomers, they can’t be converted from one to the other without breaking and re-making covalent bonds. We say that optical isomers are optically active because they bend, or rotate light in opposite directions in a polarimeter. Light passing through a solution of one optical isomer is rotated in one direction while light passing through the other isomer is rotated in the opposite direction. These directions are referred to as l, or levo (meaning left) and d or dextro (meaning right). If a molecule has more than one chiral C (glucose for example has four chiral carbons), its behavior in a polarimeter will be based on the sum of optical activities of all the chiral carbons. The common isomer of glucose in our diet is d-glucose. The d- and l- isomers of glucose are illustrated below (showing chiral carbons in red).
Glucose enantiomers are also referred to as D and L respectively. This is a convention based on the configuration of the four different atoms or groups around the last optically active carbon in a molecule (5C in glucose). For glucose, d and l in fact correspond to D and L respectively. As we will see for some molecules, the upper case designation of a chiral molecule does not always indicate how it bends light in a polarimeter, while the lower case d and l always do!
Remember that the shape and chemical properties of any molecule dictates its function. Isomerism in organic (carbon-based) molecules increased the diversity of molecular shapes available for chemical selection. An early selection of isomers (and specific optical isomers in particular) during chemical evolution contributed greatly to chemical functions and reactions we recognize in cells… even before there was life on earth. That all life uses the same isomers of glucose in energy reactions and the same isomers of amino acids to build proteins confirms the prebiotic selection of those isomers!
B. Monomers to Polymers and Back: Dehydration Synthesis and Hydrolysis
All living things build and break down polymers (macromolecules) by dehydration synthesis (condensation reactions) and hydrolysis, respectively. Dehydration synthesis and hydrolysis reactions are essentially the reverse of each other, as illustrated below:
Condensation reactions build macromolecules by removing a water molecule from interacting monomers. The ‘bond’ that forms in a condensation reaction is not a single bond, but a linkage involving several bonds! The linkages form by removing an OH from one monomer and an H group from the other to form a water molecule.
126 Organic Molecules Monomers & Polymers
Repeated condensation reactions such as the one between two amino acids shown below form the peptide linkages that build polypeptides during translation.
Cells perform repeated condensation reactions to build other polymers, including polysaccharides and polynucleotides (the RNA and DNA nucleic acids). Consider the polymerization of glucose monomers into storage or structural polysaccharides for example. Cells use only (d)glucose is used by cells to make polysaccharides. Straight-chain (d)glucose with four chiral carbons becomes cyclic when dissolved in water, where the cyclic molecule acquires a fifth chiral carbon, shown below.
The fifth pair of enantiomers in solution are called a and b, or more correctly, a(d)glucose and b(d)glucose. Having selected d-glucose for most cellular energy metabolism, life then exploited the additional chiral carbon in cyclic d-glucose to make the different polysaccharide polymers we now find in plants and animals.
The condensation reactions shown below link glucose monomers, forming storage and structural polysaccharides.
The -OH (hydroxyl) groups on the #1 C of a(d)glucose are below the glucose rings. The condensation reaction removes a water molecule, linking the sugars by an a1,4 glycoside linkage in the dimer, connecting them by their # 1 and # 4 carbons. Other linkages are possible; diverse a-glycoside linkages characterize branched storage polysaccharides like glycogen in animals and the starches in plants. When b(d)glucose enantiomers polymerize, they form rigid structural polysaccharides such as those of cellulose in plant cell walls. A modified b-glucose called N-acetyl glucosamine (not shown) polymerizes to form chitin, the principal component of fungal cell walls and of the tough exoskeleton of arthropods (insects, crustacea). In another chapter, we’ll revisit the linkage of amino acids the in the process of translation to build a polypeptide, using only L amino acids to make their proteins! We’ll also look at the details of replication and transcription that cells use to catalyze condensation reactions to synthesizing DNA and RNA from nucleotide monomers.
To summarize:
1. Linkages in these biopolymers are broken and formed daily in our lives! After a protein- and carb-containing meal, digestion, the hydrolysis of glycoside and peptide linkages, begins in your mouth and continues in your stomach and small intestines. Then our cells use condensation reactions to complete the job of turning carrot- and cow-derived monomers into you or me!
2. Prebiotic chemical evolution has selected only one of the optical isomers (enantiomers) of glucose, amino acid and other monomers with which to build polymers. This is so even though some of the different isomers are available and even used for different purposes. The flexible a(d)glucose polymer was selected to be the storage polysaccharides that we use for energy, a selection probably made by cells themselves. Storage polysaccharides include the plant starches and animal glycogen. Likewise, the rigid inflexibility of b(d)glucose polymers would have been selected to reinforce cell structure and stability. Since all organisms store carbohydrate energy in a(d)glucose polymers and since b(d)glucose polymers are almost universally used to strengthen cell structure, these selections must have occurred early in the history of life.
127 Carbohydrates: Sugars & Polysaccharides
128 Lipids: Triglycerides & Phospholipids
129Proteins: Amino Acids & Polypeptides
130 DNA & RNA: Nucleotides & Nucleic Acids
To conclude this chapter and to emphasize the significance of chirality to life, here is what can happen when the wrong isomer ends up in the wrong place at the wrong time…
C. A Tale of Chirality Gone Awry
Consider the story of Thalidomide, a tragic example of what happens if we are unaware of enantiomeric possibilities. Introduced in 1957, Thalidomide sold as an over-the-counter anti-nausea drug for cancer treatments and as a very effective morning sickness remedy for pregnant women. However, by the early 1960s, the birth of about 10,000 infants with severely deformed limbs was connected to the drug. The half of the infants affected that survived did so with other defects as well. Of course, the response was to pull Thalidomide off the market.
Thalidomide is a teratogen. Teratogens are substances or conditions (drugs, chemicals, radiation, illness during pregnancy, etc.) that cause deformities during embryogenesis and fetal development. The chemical basis of Thalidomide’s effects are based on its enantiomeric (chiral) structure in which an amine-containing ring can exist in front of, or behind the rest of the molecule.
The structure of Thalidomide is shown below.
The two isomers are referred to as ‘S’ and ‘R’. Of these, the S isomer is the teratogen. While synthesis of pure R is possible, when used in treatment, R and S easily interconvert, creating a racemic mixture. In the mother, S is transferred to the embryo or fetus, with its terrible consequences. Remarkably, there were relatively few cases of Thalidomide-induced birth deformities in the United States because our FDA (Food and Drug Administration) had not yet approved the drug for clinical use. Of course, we already knew that cells synthesized polymers from specific optical isomers of their precursor monomers. So the sad Thalidomide story resulted from the untested effects of an unexpected optical isomer. Many countries quickly tightened their pre-approval drug testing regulations because of this tragedy.
In a more hopeful twist of the tale, Thalidomide has turned out to be effective in treating cancer, leprosy, rheumatoid arthritis and other autoimmune diseases. Such therapeutic benefits may be due to its anti-inflammatory effects. Its effects on tumor growth seems to be due to its inhibition of angiogenesis (development of blood vessels) in the tumors. Ironically, blockade of angiogenesis might also have contributed to the failure of proper limb growth during pregnancy.
To conclude, when all is normal, the shapes of molecules, particularly macromolecules, are essential for the specificity of reactions essential to life.
131 Shape & the Specificity of Molecular Interactions
2.06: Key Words and Terms
acids and bases
geometric isomers
polar covalent bonds
adhesion
glycogen
polymers
a-glucose
glycoside linkage
polynucleotides
amino acids
heat of vaporization
polypeptides
angiogenesis
hydrogen bonds
polysaccharides
atom
hydrolysis
potential energy
atomic mass
hydrophilic
properties of water
b-glucose
hydrophobic
protons
Bohr model
ionic bonds
quantum
carbohydrates
ionization
racemic mixture
cellulose
isomers
RNA
chirality
isotopes
salts
chiral carbon
kinetic energy
scanning tunneling microscope
chitin
lipids
sharing electrons
cohesion
macromolecules
solutes
condensation reaction
molecule
specific heat
dehydration synthesis
monomers
starches
digestion
neutrons
structural isomers
DNA
nucleotides
surface tension
electron shell
optical isomers
teratogen(ic)
electrons
orbitals
Thalidomide
electrostatic interaction
partial charge
triglycerides
element
peptide linkage
valence
enantiomers
pH
Van der Waals forces
ester linkage
phosphate ester linkage
water ions
excitation
phosphodiester linkage
water of hydration
fats
phospholipids
fluorescence
photon | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/02%3A_Basic_Chemistry_Organic_Chemistry_and_Biochemistry/2.05%3A_Some_Basic_Biochemistry-_Carbon_Monomers_Polymers_and_the_Synthesis_and_Degrada.txt |
• 3.1: Introduction
Proteins are the workhorses of cells, responsible for just about all aspects of life (look at oxytocin in the cartoon)! They are comprised of one or more polypeptides. In this chapter, we look at the different levels of protein structure…, in fact what it takes to be a functional protein.
• 3.2: Levels (Orders) of Protein Structure
• 3.3: Changes in Protein Shape Can Cause Disease
While the conformation of a protein determines its biological function, an allosteric change (change in shape) can moderate or disrupt its function. Under normal circumstances, cells use changes in protein shape to regulate metabolism. Such allosteric regulation is well documented in familiar biochemical pathways such as glycolysis and is discussed in more detail elsewhere. Less well understood is how (or why) is why conformational change in some proteins cells has devastating effects.
• 3.4: Quaternary Structure
Quaternary structure describes a protein composed of two or more polypeptides. Like tertiary structure, multimeric polypeptide are formed by the same kinds of non-covalent interactions and may be stabilized disulfide bonds. Specifically, a dimer contains two, a trimer three, a tetramer four polypeptides… and so on.
• 3.5: Some Proteins are Chemically Modified and Others Require Prosthetic Groups to be Biologically Active
Many polypeptides are modified after translation, for instance by phosphorylation or glycosylation (addition of one or more phosphates or sugars respectively to specific amino acids in the chain). These modifications account for and enhance the molecular and functional diversity of proteins within and across species.
• 3.6: Protein Domains, Motifs, and Folds in Protein Structure
These two and many other proteins have this domain, allowing them to bind a molecule of phosphatidyl-inositol triphosphate that is generated as part of a common cell-signaling pathway. The implication of this common domain is that a cell can have signaling pathways that allowing it to respond to different signals that lead to the same response, albeit under different conditions and probably at different times. Proteins are typically described as consisting of several distinct sub-structures, dis
• 3.7: Proteins, Genes and Evolution- How Many Proteins are We?
If evolution did not have to select totally new proteins for each new cellular function, then how many genes does it take to make an organism? The number of genes in an organism that encode proteins may be far fewer than the number of proteins they actually make. Current estimates suggest that it takes just 25,000 genes make and operate a human and all its proteins (check out Pertea and Salzberg at Estimating the number of genes in the human genome).
• 3.8: View 3D Animated Images of Proteins in the NCBI Database
We can’t see them with our own eyes, but viewed by X-Ray diffraction, proteins exhibit exquisite diversity. You can get an X-Ray eye’s view of protein structures at National Center for Biological Information’s Cn3D database. Here’s how to access three- dimensional animated images of proteins from the database:
• 3.9: Key Words and Terms
Thumbnail: An enzyme binding site that would normally bind substrate can alternatively bind a competitive inhibitor, preventing substrate access. Dihydrofolate reductase is inhibited by methotrexate which prevents binding of its substrate, folic acid. Binding site in blue, inhibitor in green, and substrate in black (PDB: 4QI9). (CC BY 4.0; Thomas Shafee).
03: Details of Protein Structure
Proteins are the workhorses of cells, responsible for just about all aspects of life (look at oxytocin in the cartoon)! Comprised of one or more polypeptides, they:
1. are the catalysts that make biochemical reactions possible.
2. are membrane components that selectively let substances in and out of the cell.
3. allow cell-cell communication and cell’s response to environmental change.
4. form the internal structure of cells (cytoskeleton) and nuclei (nucleoskeleton).
5. enable the motility of cells and things inside cells.
6. are in fact responsible for other cell functions too numerous to summarize here!
We owe much of what we know about biomolecular structure to the development of X-ray crystallography. In fact an early determination of the structure of insulin (as well as penicillin and vitamin B12) using X-ray crystallography earned Dorothy Hodgkins the 1964 Nobel Prize in Chemistry. In this chapter, we look at the different levels of protein structure…, in fact what it takes to be a functional protein.
The primary structure (1o structure) of a polypeptide is its amino acid sequence. Interactions between amino acids near each other in the sequence cause the polypeptide to fold into secondary (2o) structures, including a helix and b-, or pleated sheet conformations. Tertiary (3o) structures form when non-covalent interactions between amino acid side-chains at some distance from one another in the primary sequence cause the polypeptide further folds into more a complex 3-dimensional structure. Other proteins (called chaperones!) facilitate the accurate folding of a polypeptide into correct, bioactive, 3-dimensional conformations. Quaternary (4o) structure refers to proteins made up of two or more polypeptides. Refer to the four levels of structure on the next page as we explore how each level affects the shape and biological/biochemical function of the protein.
Covalent bonds between specific amino acids (e.g., cysteines) that end up near each other after folding may stabilize tertiary and quaternary structures. Many proteins also bind metal ions (e.g., Mg++, Mn++) or small organic molecules (e.g., heme) before they become functionally active. Finally, we look beyond these orders of structure at their domains and motifs that have evolved to perform one or another specific protein functions.
Clearly, in trying to understand molecular (especially macromolecular) function, a recurring theme emerges: the function of a protein depends on its conformation. In turn, protein conformation is based on the location and physical and chemical properties of critical functional groups, usually amino acid side chains. Watch for this theme as we look at enzyme catalysis, the movement of molecules in and out of cells, the response of cells their environment, the ability of cells and organelles to move, how DNA replicates, how gene transcription and protein synthesis are regulated…, just about everything a cell does! We will conclude this chapter with a look at some techniques for studying protein structure.
Learning Objectives
When you have mastered the information in this chapter, you should be able to:
1. define and distinguish between the orders of protein structure.
2. differentiate between beta sheet, alpha helix and random coil structure based on the atomic interactions involved on each.
3. trace the path to the formation of a polypeptide; define its primary structure and how it is determined by ‘protein sequencing’.
4. describe how globular proteins arise from the hydrophobic and hydrophilic interactions that drive protein folding and how changes in protein shape can cause disease.
5. formulate an hypothesis (or look one up) to explain why the amino acid glycine is a disruptor of alpha helical polypeptide structure.
6. compare and contrast motif and domain structure of proteins and polypeptides, and their contribution to protein function.
describe different techniques for studying proteins and the physical/chemical differences between proteins that make each technique possible. | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/03%3A_Details_of_Protein_Structure/3.01%3A_Introduction.txt |
A. Primary Structure
1. L amino acids and the C-N-C-N-… polypeptide backbone
The primary structure of a protein refers to the amino acid sequence of its polypeptide chain(s). Cells use only 20 amino acids to make polypeptides and proteins, although they do use a few additional amino acids for other purposes. Peptide linkages between amino acids in polypeptides form in condensation reactions in cells during protein synthesis (i.e., translation). The linkages involve multiple covalent bonds. They break and rearrange between the carboxyl and amino groups of amino acids during linkage formation.
The 20 amino acids found in proteins are shown below.
Except for glycine, the a-carbon in the 19 other amino acids is bound to four different groups, making them chiral or optically active.
Recall that chiral carbons allow for mirror image D and L or d and l optical isomers. Recall also that only the lower case d or l defines the optical properties of isomers. Just to make life interesting, L amino acids are actually dextrorotary in a polarimeter, making them d-amino acids! While both enantiomers exist in cells, only dextrorotary d (i.e., L) amino acids (along with glycine) are used by cells to build polypeptides and proteins. A partial polypeptide is illustrated below.
The result of translation in a cell is a polypeptide chain with a carboxyl end and an amino end. Amino acid side chains (circled above) end up alternating on opposite sides of a C-N-C-N-… polypeptide backbone because of the covalent bond angles along the backbone. You could prove this to yourself by assembling a short polypeptide with a molecular modeling kit, the kind you might have used in a chemistry class! The C-N-C-N-…backbone is the underlying basis of higher orders, or levels of protein structure (see below).
132 Amino Acid Sequence & Protein Primary Structure
2. Determining Protein Primary Structure - Polypeptide Sequencing
Frederick Sanger was the first to demonstrate a practical method for sequencing proteins when he reported the amino acid sequence of the two polypeptides of Bovine (cow) insulin. Briefly, the technique involves stepwise hydrolysis of polypeptide fragments, called an Edman Degradation. Each hydrolysis leaves behind a polypeptide fragment shortened by one amino acid that can be identified. Sanger received a Nobel Prize in 1958 for this feat. By convention, the display and counting of amino acids always starts at the amino-, or N-terminal end (the end with a free NH2-group). Primary structure is dictated directly by the gene encoding the protein. After transcription of a gene), a ribosome translates the resulting mRNA into a polypeptide.
For some time now, the sequencing of DNA has replaced most direct protein sequencing. The method of DNA sequencing, colloquially referred to as the Sanger dideoxy method, quickly became widespread and was eventually automated, enabling rapid gene (and even whole genome) sequencing. Now, instead of directly sequencing polypeptides, we can infer amino acid sequences from gene sequences isolated by cloning or revealed after complete genome sequencing projects. This is the same Sanger who first sequenced proteins, and yes…, he won a second Nobel Prize for the DNA sequencing work in 1980!
The different physical and chemical properties of amino acids themselves result from the side chains on their a-carbons. The unique physical and chemical properties of polypeptides and proteins are determined by their unique combination of amino acid side chains and their interactions within and between polypeptides. In this way, primary structure reflects the genetic underpinnings of polypeptide and protein function. The higher order structures that account for the functional motifs and domains of a mature protein derive from its primary structure. Christian Anfinsen won a half-share of the 1972 Nobel Prize in Chemistry for demonstrating that this was the case for the ribonuclease enzyme (Stanford Moore and William H. Stein earned their share of the prize for relating the structure of the active site of the enzyme to its catalytic function). See 1972 Nobel Prize in Chemistry for more.
B. Secondary Structure
Secondary structure refers to highly regular local structures within a polypeptide (e.g., a helix) and either within or between polypeptides (b-pleated sheets). Linus Pauling and coworkers suggested these two types of secondary structure in 1951. A little Linus Pauling history is would be relevant here! By 1932, Pauling had developed his Electronegativity Scale of the elements that could predict the strength of atomic bonds in molecules. He contributed much to our understanding of atomic orbitals and later to the structure of biological molecules. He earned the 1954 Nobel Prize in Chemistry for this work. He and his colleagues later discovered that sickle cell anemia was due to an abnormal hemoglobin, and went on to predict the alpha helical and pleated sheet secondary structure of proteins. While he did not earn a second Nobel for these novel molecular genetics studies, he did win the 1962 Nobel Peace prize for convincing almost 10,000 scientists to petition the United Nations to vote to ban atmospheric nuclear bomb tests. A more detailed review of his extraordinary life (e.g., at Linus Pauling-Short Biography) is worth a read!
Secondary structure conformations occur due to the spontaneous formation of hydrogen bonds between amino groups and oxygens along the polypeptide backbone, as shown in the two left panels in the drawing below. Note that amino acid side chains play no significant role in secondary structure.
133 Protein secondary structure
The a helix or b sheets are a most stable arrangement of H-bonds in the chain(s). These regions of ordered secondary structure in a polypeptide can be separated by varying lengths of less structured peptide called random coils. All three of these elements of secondary structure can occur in a single polypeptide or protein that has folded into its tertiary structure, as shown at the right in the illustration above. The pleated sheets are shown as ribbons with arrowheads representing N-to-C or C-to-N polarity of the sheets. As you can see, a pair of peptide regions forming a pleated sheet may do so either in the parallel or antiparallel directions (look at the arrowheads of the ribbons), which will depend on other influences dictating protein folding to form tertiary structure. Some polypeptides never go beyond their secondary structure, remaining fibrous and insoluble. Keratin is perhaps the best-known example of a fibrous protein, making up hair, fingernails, bird feathers, and even filaments of the cytoskeleton. Most polypeptides and proteins however, do fold and assume tertiary structure, becoming soluble globular proteins.
C. Tertiary Structure
Polypeptides acquire their tertiary structure when hydrophobic and non-polar side chains spontaneously come together to exclude water, aided by the formation of salt bridges and H-bonds between polar side chains that find themselves inside the globular polypeptide. In this way, a helices or b sheets are folded and incorporated into globular shapes. The forces that cooperate to form and stabilize 3-dimensional polypeptide and protein structures are illustrated below.
Polar (hydrophilic) side chains that can find no other side-chain partners are typically found on the outer surface of the ‘’globule’, where they interact with water and thus dissolve the protein (recall water of hydration). Based on non-covalent bonds, tertiary structures are nonetheless strong simply because of the large numbers of otherwise weak interactions that form them. Nonetheless, covalent disulfide bonds between cysteine amino acids in the polypeptide (shown above) can further stabilize tertiary structure. Disulfide bonds (bridges) form when cysteines far apart in the primary structure of the molecule end up near each other in a folded polypeptide. Then the –SH (sulfhydryl) groups in the cysteine side chains are oxidized, forming the disulfide (–S-S- ) bonds.
The sulfhydryl oxidation reaction is shown below.
134 Protein Tertiary (30) Structure
135 Disulfide Bridges Stabilize 30 Structure
To better understand how disulfide bridges can support the 3-dimensional structure of a protein, just imagine its physical and chemical environment. Changing the temperature or salt concentration surrounding a protein might disrupt non-covalent bonds involved in the 3D shape of the active protein. Unaffected by these changes, disulfide bridges limit the disruption and enable the protein to re-fold correctly and quickly when conditions return to normal (think homeostasis!). | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/03%3A_Details_of_Protein_Structure/3.02%3A_Levels_%28Orders%29_of_Protein_Structure.txt |
While the conformation of a protein determines its biological function, an allosteric change (change in shape) can moderate or disrupt its function. Under normal circumstances, cells use changes in protein shape to regulate metabolism. Such allosteric regulation is well documented in familiar biochemical pathways such as glycolysis and is discussed in more detail elsewhere. Less well understood is how (or why) is why conformational change in some proteins cells has devastating effects.
A. Sickle Cell Anemia
Mutant genes for globins can result in hemoglobin disorders characterized by inefficient oxygen delivery by blood. In the 1940s, the British biochemist J.B.S. Haldane made a correlation between southern African regions with high incidences hemoglobin disorders and malaria, suggesting that heterozygous individuals (i.e., those that had only one copy of a mutant hemoglobin gene), were somehow protected from malaria. Another well-known example of a hemoglobin disorder is sickle cell anemia, caused by a single base change in the gene for human b-hemoglobin, one of the polypeptides in hemoglobin. Since red blood cells are rich in hemoglobin, sickling hemoglobins can cause the cells themselves to become sickle-shape. Sickled cells disrupt capillary flow and oxygen delivery, resulting in the symptoms of anemia. Sickle cell anemia originated in Africa and spread to the United States during the slave trade. Once out of Africa and regions where malaria was epidemic, the mutation was of no value, and was just a source of disease. Individuals heterozygous for the sickle cell mutation have sickle cell trait and are generally unaffected because at least some of their hemoglobin is normal. Homozygous individuals make only the sickle cell variant of b-hemoglobin; they will suffer more frequent and severe suffer episodes of the disease. Stressors that can trigger sickling include infection or dehydration. Compare normal red blood cells to a sickle cell below.
The sickle cell gene affects perhaps more than 100 million people worldwide, including 8-10% of African Americans. For more demographic information, see Sickle Cell Trait Demographics Article and Sickle Cell Data from the CDC. In Africa, heterozygotes with sickle cell trait are protected from malaria, confirming Haldane’s hypothesis. But patients homozygous for the b-hemoglobin mutation derive little benefit from its anti- malarial effects.
In the meantime, despite a 33% reduction in cases of malaria, the disease (caused by a mosquito-borne parasite) still threatens half of the people on the planet, causing over a half-million deaths per year. There are treatments other than mosquito nets and killing mosquitos, but at this time, there is still no preventive vaccine.
B. The Mis-Folding of Prions and Alzheimer’s Disease
1. The Prion Protein
When first discovered, prion proteins seemed to behave as infectious agents that could reproduce without DNA or other nucleic acid. As you can imagine, this highly unorthodox and novel hereditary mechanism generated its share of controversy. Read about research on the cellular PrPc prion protein at en.Wikipedia.org/wiki/Prion.
Of course, prions turned out not to be reproductive agents of infection after all. Recent studies of prions have revealed several normal prion protein functions such as roles in memory formation in mice and in sporulation in yeast (Check out Prion Proteins May Play a Role in Memory Formation). A mutant version of the prion protein (PrPSc) is able to mis-fold, assuming an abnormal shape. The deformed PrPSc can then induce abnormal folding even normal PrPc! These events, illustrated below, result in the formation of so-called amyloid plaques.
In their abnormally folded state, prions have been associated Alzheimer’s Disease (which affects about 5.5 million Americans, as well as with Mad Cow disease and Creutzfeldt-Jakob-Disease (mad cow disease in humans), as well as Scrapie in sheep, among others. We are beginning to understand that the role of prion proteins in Alzheimer’s Disease is less causal and somewhat indirect.
2. The amyloid beta (Ab) peptide
The post-mortem brains of patients that suffered Alzheimer’s disease exhibit characteristic extracellular amyloid plaques composed largely of the amyloid beta (Ab) peptide. Enzymatic cleavage of the APP protein (amyloid precursor protein) generates extracellular 39-43 amino acid Ab peptides. Under normal conditions, excess Ab peptides are themselves digested.
Unregulated Ab peptide formation however, leads to the formation of beta amyloid plaques seen in Alzheimer’s disease.as illustrated below.
The scissors in the illustration represent two enzymes that digest the APP. Prion proteins are not a proximal cause of Alzheimer’s Disease, but may have a role in initiating events that lead to it. Normal prion protein (PrPc), itself a membrane receptor, is thought to bind Ab peptides, effectively preventing their aggregation into plaques. An experimental reduction of PrPc was shown to increases extracellular Ab peptides. Presumably prion protein aggregation induced by mutant PrP (PrPsc) prevents prion proteins from binding to Ab peptide, leading to its accumulation and ultimately to amyloid plaque formation and neurodegeneration.
3. The Tau protein
A protein called tau is also associated with Alzheimer’s Disease. Misshapen tau accumulating in neurofibrillary tangles in hippocampus brain neurons may be a more immediate cause of the neuronal disfunction associated with the disease. In normal neurons, a Microtubule-Associated Protein Tau (MAP-T) is phosphory- lated and then binds to, and stabilizes microtubules. But when neuronal tau becomes hyper-phosphorylated, its conformation changes. No longer stabilized, the microtubules disassemble and the deformed tau proteins form neurofibrillary tangles. Immunostaining of hippocampal neurons with antibodies to tau protein localizes the neurofibrillary tangles as seen in the micrograph below.
The formation of neurofibrillary tau protein tangles in a diseased neuron is compared to normal neurons in the illustration below.
The” tangles clumps of tau proteins” in this illustration are what stain deep purple in the micrograph of immunostained neurons in the light micrograph.
There is no cure for Alzheimer’s disease, although treatments with cholinesterase inhibitors seem to slow its advancement. For example, the drug Aricept inhibits acetylcholine breakdown by acetylcholinesterase, thereby enhancing cholinergic neurotransmission, which may in turn prolong brain neural function. Unfortunately, there is as yet no treatment to restore lost memories and the significant cognitive decline associated with Alzheimer’s disease. Perhaps more promising in this respect, the recent development of a blood test may detect people at risk for Alzheimer’s disease. As it happens, Aβ molecules escape into the blood stream as much as 8 years before Alzheimer’s symptoms appear. The prospect of early Aβ detection has raised hopes that new therapies might be on the horizon. For a brief review, see Early Detection of Alzheimer's Disease.
C. Some Relatives of Alzheimer’s Disease
Some of the same protein abnormalities that are seen in Alzheimer’s disease also characterize other neurodegenerative diseases as well as traumatic brain damage, as discussed below.
1. Chronic Traumatic Encephalopathy
An abnormal accumulation of tau protein is diagnostic of CTE (Chronic Traumatic Encephalopathy). In the early 20th century, disoriented boxers staggering about after a fight were called ‘punch drunk’, suffering from dementia pugilistica. We now know they suffered from CTE, as do other athletes exposed to repetitive mild-to- severe brain trauma, such as football players. Immunostaining of whole brains and brain tissue from autopsied CTE patients with antibodies to tau protein show accumulations of abnormal tau proteins and tau neurofibrillary tangles very much like those found in of Alzheimer’s patients. Many National Football League and other football players have been diagnosed post-mortem with CTE, and many still living show signs of degenerative cognition and behavior consistent with CTE (see a List of_NFL_players_with_chronic_traumatic_encephalopathy to see how many!
2. Parkinson’s Disease
This is yet another example of a neurodegenerative disease that results when a single protein changes shape in brain cells. Though not characterized as plaques, aggregates can form in brain cells when the protein alpha-synuclein undergoes anomalous conformational change. The change results in MSA (Multiple System Atrophy) or Parkinson’s Disease (click Synuclein Allostery and Aggregation in Parkinson's Disease to read more details about this recent research). Much of the high-resolution electron microscopy that reveals protein structure and that can capture conformational changes we now recognize, comes from the work of Jacques Dubochet, Joachim Frank and Richard Henderson who received the 2017 Chemistry Nobel Prize for Chemistry for developing and refining cryo-electron microscopy for biomolecular imaging (see 2017 Nobel Prize for Chemistry for more). | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/03%3A_Details_of_Protein_Structure/3.03%3A_Changes_in_Protein_Shape_Can_Cause_Disease.txt |
Quaternary structure describes a protein composed of two or more polypeptides. Like tertiary structure, multimeric polypeptide are formed by the same kinds of non-covalent interactions and may be stabilized disulfide bonds. Specifically, a dimer contains two, a trimer three, a tetramer four polypeptides… and so on. Multimers made up of identical subunits are referred to with a prefix of "homo-" (e.g. a homotetramer). Those made up of different subunits are heteromers. The vertebrate hemoglobin molecule, consisting of two a- and two b- globins (shown below) is a heterotetramer.
3.05: Some Proteins are Chemically Modified and Others Require Prosthetic Groups to be Biologically Active
Many polypeptides are modified after translation, for instance by phosphorylation or glycosylation (addition of one or more phosphates or sugars respectively to specific amino acids in the chain). These modifications account for and enhance the molecular and functional diversity of proteins within and across species.
Hemoglobins exemplify another feature of the structure of many proteins. To be biologically active, globin polypeptides must associate with a prosthetic group, in this case a cyclic organic molecule called heme. At the center of each heme is the iron that reversibly binds oxygen. All kinds of organisms, from bacteria to plants and animals and even in some anaerobic organisms contain some kind of hemoglobin. Other proteins must be bound to different metal ions (magnesium, manganese, cobalt…) to be biologically active.
136 Protein Quaternary Structure & Prosthetic Groups
3.06: Protein Domains Motifs and Folds in Protein Structure
The structures of two different proteins shown below share a common PH (Pleckstrin Homology) domain (maroon).
These two and many other proteins have this domain, allowing them to bind a molecule of phosphatidyl-inositol triphosphate that is generated as part of a common cell-signaling pathway. The implication of this common domain is that a cell can have signaling pathways that allowing it to respond to different signals that lead to the same response, albeit under different conditions and probably at different times. Proteins are typically described as consisting of several distinct sub-structures, discussed below.
A. Domains
A structural domain is an element of the protein's overall structure that is stable and often folds independently of the rest of the protein chain. Like the PH domain above, many domains are not unique to the protein products of one gene, but instead appear in a variety of proteins. Proteins sharing more than a few common domains are encoded by members of evolutionarily related genes comprising gene families. Genes for proteins that share only one or a few domains may belong to gene superfamilies. Superfamily members can have one function in common, but their sequences are otherwise unrelated. Domain names often derive from their prominent biological function in the protein they belong to (e.g., the calcium-binding domain of calmodulin), or from their discoverers (the PH domain!). The domain swapping that gives rise to gene families and superfamilies are natural genetic events. Because protein domains can also be "swapped" by genetic engineering to make chimeric proteins with novel functions.
137 Protein Domain Structure & Function
B. Motifs
Protein motifs are small regions of protein three-dimensional structure or amino acid sequence shared among different proteins. They are recognizable regions of protein structure that may (or may not) be defined by a unique chemical or biological function.
C. Supersecondary Structure
Supersecondary structure refers to a combination of secondary structure elements, such as beta-alpha-beta units or the helix-turn-helix motif. They may be also referred to as structural motifs. “Google” Supersecondary structure for examples.
D. Protein Folds
A protein fold refers to a general aspect of protein architecture, like helix bundle, beta- barrel, Rossman fold or other "folds" provided in the Structural Classification of Proteins database. Click Protein Folds to read more about these structures. | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/03%3A_Details_of_Protein_Structure/3.04%3A_Quaternary_Structure.txt |
If evolution did not have to select totally new proteins for each new cellular function, then how many genes does it take to make an organism? The number of genes in an organism that encode proteins may be far fewer than the number of proteins they actually make. Current estimates suggest that it takes just 25,000 genes make and operate a human and all its proteins (check out Pertea and Salzberg at Estimating the number of genes in the human genome). However, our cells (and those of eukaryotes generally) may express as many as 100,000 different proteins. How is this possible? Are there more efficient ways to evolve new and useful cellular tasks than evolving a new genes?
As we already noted, the use of the same 20 amino acids to make proteins in all living things speaks to their early (even pre-biotic) selection and to the common ancestry of all living things. Complex conserved domain structures shared among otherwise different proteins imply that evolution of protein function has occurred as much by recombinatorial exchange of DNA segments encoding these substructures, as by an accumulation of base substitutions in otherwise redundant genes. Likewise, motifs and folds might also be shared in this way. Protein number can exceed gene number in eukaryotes, in part because cells can produce different RNA variants from the same genes by “alternative splicing”, which can create mRNAs that code different combinations of substructures from same gene! Alternate splicing is discussed in detail in a later chapter). The conservation of amino acid sequences across species (e.g., histones, globins, etc.) is testimony to the common ancestry of eukaryotes. Along with the synthesis of alternate versions of an RNA, an ongoing repurposing of useful regions of protein structure may prove a strategy for producing new proteins without adding new genes to a genome.
3.08: View 3D Animated Images of Proteins in the NCBI Database
We can’t see them with our own eyes, but viewed by X-Ray diffraction, proteins exhibit exquisite diversity. You can get an X-Ray eye’s view of protein structures at National Center for Biological Information’s Cn3D database. Here’s how to access three- dimensional animated images of proteins from the database:
Click http://www.ncbi.nlm.nih.gov/Structure/CN3D/cn3dinstall.shtml to download the Cn3D-4.3.1_setup file (for Windows or Mac). The software will reside on your computer and will activate when you go to a macromolecule database search site.
Click http://www.ncbi.nlm.nih.gov/Structure/MMDB/docs/mmdb_search.html to enter the protein structure database (below):
The search example shown above for human insulin takes you to this link: http://www.ncbi.nlm.nih.gov/structure/?term=human+insulin&SITE=NcbiHome&submit
.x=12&submit.y=12 The website is shown below:
Click View in Cn3D for the desired protein. For human insulin see this:
To rotate the molecule, click View then Animation, then Spin… and enjoy!
3.09: Key Words and Terms
Ab
functional groups
primary structure
a-carbon
gene family
prion
alpha helix
gene superfamily
protein folding
allosteric regulation
glycosylation
PrP
Alzheimer's disease
helix-turn-helix motif
quaternary structure
amino acid residues
hemoglobin
random coil
amino end
hydrophobic interactions
recombinatorial exchange
amyloid beta protein
levels of protein structure
salt bridges
amyloid plaques
Mad Cow disease
salt bridges
beta barrel
multimer
secondary structure
beta sheet
NCBI Cn3D database
sequence motifs
carboxyl end
neurofibrillary tangles
sickle cell anemia
catalysts
nucleoskeleton
side chains
chaperones
orders of protein structure
structural domain
configuration
Parkinson's disease
structural motif
Creutzfeldt-Jakob disease
peptide bonds
sulfhydryl groups
cytoskeleton
peptide linkages
tau protein
disulfide bonds
phosphorylation
tertiary structure
Edman degradation
pleated sheet
enzymes
polypeptide backbone | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/03%3A_Details_of_Protein_Structure/3.07%3A_Proteins_Genes_and_Evolution-_How_Many_Proteins_are_We.txt |
• 4.1: Introduction
In living systems, we do not have to worry about the third law because equations for energy exchange in living systems already reflect the temperature dependence of entropy changes during reactions. Here we look at how we came to understand basic thermodynamic principles and how they apply to living systems. First, we will look at different kinds of energy and at how redox reactions govern the flow of energy through living things.
• 4.2: Kinds of Energy
We can easily recognize different kinds of energy around us like heat, light, electrical, chemical, nuclear, sound, etc., and you probably know that energy is measurable (calories, joules, volts, decibels, quanta, photons…). Even mass is a form of energy, as you may recall from Albert Einstein’s famous e=mc2 equation (the law of relativity).
• 4.3: Deriving Simple Energy Relationships
Consider an event, any even. I think we can agree that when stuff happens, participants in the happening go from an unstable state to a relatively more stable state. For example, you carrying a bag of marbles and you accidentally drop the bag. The marbles would fall to the floor, roll and spread out, eventually coming to a stop. At that point, the marbles are in a more stable state than they were when you were holding the bag.
• 4.4: Key Words and Terms
04: Bioenergetics
Three Laws of Thermodynamics describe the flow and transfer of energy in the universe.
1. Energy can neither be created nor destroyed.
2. Universal entropy (disorder) is always increasing.
3. Entropy declines with temperature -as temperatures approach absolute zero, so goes entropy
In living systems, we do not have to worry about the third law because equations for energy exchange in living systems already reflect the temperature dependence of entropy changes during reactions. Here we look at how we came to understand basic thermodynamic principles and how they apply to living systems. First, we will look at different kinds of energy and at how redox reactions govern the flow of energy through living things. Next, we will try to understand some simple arithmetic statements of the Laws of Thermodynamics for closed systems and then at how they apply to chemical reactions conducted under standard conditions. Finally, since there really is no such thing as a closed system, we look at the energetics of reactions occurring in open systems. For an excellent discussion of how basic thermodynamic principles apply to living things, see Lehninger A. (1971) Bioenergetics: The Molecular Basis of Biological Energy Transformation. Benjamin Cummings, San Francisco.
Learning Objectives
When you have mastered the information in this chapter, you should be able to:
1. explain the difference between energy transfer and energy transduction.
2. compare and contrast potential vs. kinetic as well as other categories of energy (e.g.,
mass, heat, light…, etc.).
3. explain the reciprocal changes in universal free energy and entropy.
4. derive the algebraic relationship between free energy, enthalpy and entropy.
5. state the difference between exothermic, endothermic, exergonic, and endergonic
reactions
6. predict changes in free energy based on changes in the concentrations of reactants and products in closed systems and open systems.
7. explain how the same reaction can be endergonic but will (under appropriate conditions) release free energy.
8. predict whether a biochemical reaction will release free energy if it is exothermic, and if so, under what conditions (you should be able to do this after working some sample problems of closed system energetics).
9. distinguish between the equilibrium and steady-state of reactions and explain how an endergonic reaction could also be spontaneous (i.e., could release free energy).
4.02: Kinds of Energy
We can easily recognize different kinds of energy around us like heat, light, electrical, chemical, nuclear, sound, etc., and you probably know that energy is measurable (calories, joules, volts, decibels, quanta, photons…). Even mass is a form of energy, as you may recall from Albert Einstein’s famous e=mc2 equation (the law of relativity).
The problem in thinking about thermodynamics is that the universe is big and there are too many kinds of energy to contemplate at once! To simplify, imagine only two kinds of energy in the universe: potential energy and kinetic energy. A helpful example is a dam. The water above the dam has potential energy. As the water flows over (or through) the dam, its potential energy is released as kinetic energy. In the old days the kinetic energy of flowing water could be used to power (i.e., turn) a millstone to grind wheat or other grains into flour. These days, water is more likely to flow through a hydroelectric dam where kinetic energy is converted (transduced) to electricity. In this simple view, heat (molecular motion), electricity (a current of electrons), sound (waves), and light (waves OR moving ‘particles’) are different forms of kinetic energy. The energy of mass or its position in the universe is potential energy. Thus chemical energy, for example the energy in a mole of ATP, is potential energy. Physicists talk a lot about potential energy and about kinetic energy flow and conversion.
An equally simple way to conceptualize energy is as useful vs. useless. This concept led directly to the arithmetic formulation of the thermodynamic laws. In this utilitarian way of thinking about energy, useless energy is entropy, while useful energy can be any of the other forms of energy (potential or kinetic).
A key to understanding bioenergetics is recognizing the difference between closed and open systems in the universe. Systems such as biochemical reactions in a test tube, reach equilibrium. Such systems are considered closed. Closed systems are artificial, possible only in the laboratory, where one can restrict and measure the amount of energy and mass getting into or escaping the system. Cells on the other hand (in fact every reaction or event in the rest of the universe) are open systems. Open systems readily exchange energy and mass with their surroundings.
With this brief introduction, we can imagine ourselves to be early scientists trying to understand energy flow in the universe, asking how the Laws of Thermodynamics apply to living systems (bioenergetics). We’ll see that the Laws can be demonstrated because all kinds of energy can be measured (as heat in calories or joules, electricity in volts, light in quanta, matter in units of mass, etc.). | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/04%3A_Bioenergetics/4.01%3A_Introduction.txt |
A. Energy in the Universe: the Universe is a Closed System
Consider an event, any even. I think we can agree that when stuff happens, participants in the happening go from an unstable state to a relatively more stable state. For example, you carrying a bag of marbles and you accidentally drop the bag. The marbles would fall to the floor, roll and spread out, eventually coming to a stop. At that point, the marbles are in a more stable state than they were when you were holding the bag.
If asked, you would say that gravity made the marbles fall from the bag. That is certainly true. Could we then say that the drive to greater stability is what made the marbles fall? In fact, regardless of the force or impetus for the event, we can say that the drive to achieve greater stability that makes things/events happen! This is the essence of the Second Law of Thermodynamics: all universal energy transfer events occur with an increase in stability…, that is, an increase in entropy. We’ll consider the second law and entropy in detail shortly.
The tendency of things go from unstable to more stable is a natural, rational state of affairs…, like those marbles on the floor, or a messy bedroom with clothes strewn about. Intuitively, messy and disordered is more stable than ordered. Of course, marbles dropping or clothing going from folded and hung to wrinkled on the floor releases energy (potential energy) as they fall (kinetic energy). If you don’t believe that this release of energy is real, just think of how much energy you will need to pick up the marbles or re-fold your clothes (after laundering them of course!).
We can model the flow of energy in the universe in a way that is consistent with thermodynamic laws. Since the First law of Thermodynamics says that energy can be neither created nor destroyed, a simple statement of the First Law could be:
The equation sums up the different kinds of energy in the universe. Look at it this way:
Energy cannot get in or out of the universe. Energy can only be transferred from one place to another, or converted from one form to another. It follows then that Euniversal is the sum of all kinds of energy in the universe, and that this sum is a constant. The equation below is consistent with this idea.
This is a statement of the First Law of Thermodynamics.
139 First Law of Thermodynamics
If we go with the simpler binary notion or useful and useless energy, our equation shortens to the sum of just two kinds of energy in the universe:
In this equation, G is useful energy (“Gibbs” free energy ), S is useless energy (entropy), and T is absolute temperature (included because of the third law). This is also a statement of the First Law. Here is our revised circle diagram:
By the way, segregating things and concepts into circles is a way of logically viewing relationships between them. John Venn first formalized this approach in the late 19th century. The Venn diagrams used here to describe the universe are very simple. For examples of more complex overlapping components of the universe that share some but not all attributes, “Google” Venn Diagrams.
In this binary energy model, it follows that as universal entropy increases, free energy in the universe must decrease:
Free or ‘potentially useful’ energy is higher in more ordered, complex and therefore relatively unstable systems. Such unstable, ordered systems will release free energy spontaneously.
140 Second Law Thermodynamics
While the arithmetic statements about changes in energy are useful concepts, the parameters are of course, not measurable! But if we isolate a bit of the universe, we can measure energies and watch energy flow.
B. Energy is Exchanged Between Systems in the Universe
If we can measure the amount of energy put into or removed from a system within the universe, we can write a more useful equation to follow the transfer of energy between a system and its surroundings:
$ΔH = ΔG + TΔS$
In this formula, $ΔH$ is the change (D) in enthalpy, i.e., as energy entering/leaving the system in units of heat energy); $ΔG$ is change in free energy and $ΔS$ is change in entropy; T = absolute temperature (oK).
Heat given off in a reaction (or other event) is often confused with entropy. It is true that much of the increase in entropy that occurs in living things is indeed in the form of random molecular motion, or heat. But remember that heat can have its uses; not all heat is entropic! Hence, it is more interesting (and accurate!) to think of energy in terms of changes in enthalpy, free energy and entropy during energy transfers.
According to the equation $ΔH = ΔG + TΔS$, interacting systems in our universe would seem to be closed systems. Accordingly, energy put into or removed from the system ($ΔH$) will be exactly balanced by increases and/or decreases in the other two terms in the equation ($ΔG + TΔS$). Recall that we refer to these systems as closed systems not because they are really closed, but because we can isolate them well enough to account for energy flow into and out of the system. The value of this (or any) algebraic equation with three variables is that if you know two of the values, you can calculate the third! Here is a simple situation to illustrate the point: If I put a liter of water on a burner and light the flame, the water gets hot. If the temperature of the liter of water rises by 1oC, we know that it has absorbed 1000 calories (one Kcal, or one food Calorie) of the heat from the burner.
Since energy interactions depend on different physical conditions, such as temperature and air pressure, we need to standardize those conditions when conducting experiments that measure energy changes in experimentally isolated systems. For more on how standardizing these physical parameters enables measuring energy change in chemical reactions (in fact, any energy exchange), click the link below.
141 Deriving Closed System Thermodynamics
Turning to bioenergetics, let’s apply the equation $ΔH = ΔG + TΔS$ to chemical reactions in cells. Because most life on earth lives at sea level where the air pressure is 1 atmosphere and the temperature is in the 20’s (Celsius), typical determinations of $ΔH$, $ΔG$, and $ΔS$ are made under standard conditions where T=298oK (25oC), an atmospheric pressure of pressures of 1 atm, and a constant pH of 7.0. In addition, measured values are adjusted to calculate unimolar quantities of reactants (see below). Our equation for reactions under these standard conditions becomes: $ΔH = ΔGo + TΔS$, where $ΔGo$ is the standard free energy change for the reaction conducted in a closed system under standard conditions, while $ΔH$ and $ΔS$ are still the enthalpy and entropy changes, but determined under standard conditions.
What are unimolar conditions in practice? It means that if you burn 180 mg of glucose in a calorimeter, multiply the calories released ($ΔH$) by 1000. This gives you the calories released by burning 180 gm (i.e., a whole mole) of the stuff. Now we are ready to consider examples of how we determine the energetics of reactions.
c. How is Enthalpy Change ($ΔH$) Determined?
$ΔH$ for a chemical reaction can easily be determined by conducting the reaction under standard conditions in a bomb calorimeter (illustrated below).
Food manufacturers determine the Calorie content of food using a bomb calorimeter. As a reaction takes place in the beaker in the illustration, it will either release or absorb heat, either heating or cooling the water in the calorimeter jacket, as measured by the thermometer. A reaction that releases heat as it reaches equilibrium is defined as exothermic, and the $ΔH$ for an exothermic reaction will be negative. For example, a package says that a chocolate bar has 90 Calories. This means that burning the bar will generate 90 kilocalories (Kcal) of heat as measured in the calorimeter. Recall that one Calorie (with a capital C) = 1000 calories, or one Kcal. One calorie (lower case) is the energy needed to raise a gram of water by 1oC).
You are probably most familiar with reactions that release heat, but some chemical reactions actually absorb heat. Take the common hospital cold pack for example. Squeeze it to get it going and toss it in the calorimeter. You can watch the temperature in the calorimeter drop as the pack absorbs heat from the surroundings! Such reactions are defined as endothermic, with a positive $ΔH$. OK, so we can determine the value of one of the energy parameters… we need to know at least one other, either $ΔGo$ or $ΔS$ before the equation $ΔH = ΔGo + TΔS$ becomes useful.
D. How is Standard Free Energy Change ($ΔGo$) Determined?
As it turns out, standard free energy change, $ΔGo$ , is directly proportional to the concentrations of reactants and products of a reaction conducted to completion (i.e., equilibrium) under standard conditions. Therefore, to determine $ΔGo$, we need to be able to measure the concentration of reactants and reaction products before and after a chemical reaction (i.e., when the reaction reaches equilibrium). Take the following generic chemical reaction:
$2A + B <===> 2C + D$
The following equation relates $ΔGo$ the equilibrium concentrations of A, B, C and D:
$ΔGo = -RTlnKeq = -RTln((C^2+D)/(A^2+B))$
R= the gas constant (1.806 cal/mole-deg), T = 298oK and Keq is the equilibrium constant. This is the Boltzman equation. As you can see, the Keq for the reaction is the ratio of the product of the concentrations of the products (raised to their stoichiometric powers) to the product of the concentrations of the reactants (raised to their stoichiometric powers).
If you can determine equilibrium concentrations of reactants and products in a chemical reaction, you can use this equation to calculate $ΔGo$ (standard free energy change) for a reaction. Consider the following generic chemical reaction:
$A + B ⇔ C + D$
If the $ΔGo$ is a negative number, the reaction is defined as exergonic. We say that exergonic reactions release free energy. If the $ΔGo$ is a positive number, the reaction absorbs free energy and is defined as endergonic.
142 Determining DH & DG in Closed Systems
E. Working an Example Using These Equations for Closed Systems
Consider the following reaction:
$X ⇔ Y$
If you are given [X] and [Y], you can also do the math. At equilibrium, the concentrations of the reactants and products for this reaction measured (assayed), with the following results:
[X] = 2.5 Kcal/Mole; [Y] = 500 cal/Mole
Use the Boltzmann equation (above) to calculate the standard free energy for this reaction. What is the Keq for this reaction? What is the $ΔGo$ for the reaction? If you did not come up with a Keq of 0.2 and an absolute value for the standard free energy for|$ΔGo$| of 866.2 Kcal/mole, re-calculate or collaborate with a classmate. Hint: make sure that you convert the units in your equation so that they are all the same!). Based on the calculated value of $ΔGo$, is this reaction endergonic or exergonic?
If you conduct the reaction in a bomb calorimeter, it proceeds to equilibrium with a $ΔH$ = -750 Kcal/Mole. What kind of reaction is this? Together with the enthalpy change, it is now possible to calculate an absolute value for the entropy change to be |$ΔS$| = 116.2 cal/mol-deg for this reaction. At equilibrium, did the reaction proceed with an increase or decrease in entropy under standard conditions? Again, if you did not get the correct answer, re-calculate or collaborate with a classmate.
143 Determining DS in Closed System
F. Summary: The Properties of Closed Systems
First, let’s reiterate that there is no such thing as a closed system, unless of course the universe is one! What we call a closed system is simply one in which we can measure the energy going into or coming out of the system, and within which we can measure energy transfers and transductions (changes from one kind of energy to another.
Features of systems can be defined by their properties:
Properties of Closed Systems
1. Closed systems are experimentally defined by an investigator.
2. Standard conditions apply.
3. Energy entering or leaving the system is measurable.
4. Reactions reach equilibrium regardless of reaction rate.
5. Product and reactant concentrations at equilibrium are constant.
6. Measured energy transfer/transduction values are constant.
G. Actual Free Energy Change in Open Systems
Later we will be discussing the flow of energy through living things, from sunlight to chemical energy in nutrient molecules into ATP, from chemical energy as ATP into the performance of all manner of cellular work. Cells are open systems that constantly exchange mass and energy with their environment and never reach equilibrium. In addition, diverse organisms live under very different atmospheric conditions and maintain different body temperatures (e.g., your cat has a higher body temperature than you do!). Clearly, the conditions under which cells conduct their biochemical reactions are decidedly non-standard. However, while open systems do not reach equilibrium, they do achieve a steady state in which the rate of input of energy and matter is equal to the rate of output of energy and matter. Think of a biochemical pathway like glycolysis. If a cell’s energy needs are constant, the pathway will reach a steady state. Of course, a cell’s need for energy (as ATP) can change as energy needs change. If it does, then the steady state of ATP production will change to meet the needs of the cell.
Since reaction rates can change (and are in fact regulated in cells), implying that the steady state of a reaction or biochemical pathway can change. We characterize open systems by their properties, as listed below.
Properties of Open Systems
1. Open systems exchange energy and mass with their surroundings.
2. Open systems never reach equilibrium
3. They achieve steady state where the energy input rate = output rate.
4. The steady state can change.
5. In open systems, endergonic reactions can be energetically favorable (spontaneous).
Fortunately, there is an equation to determine free energy changes in open systems. For our chemical reaction $2A + B <===> 2C + D$, this equation would be:
$ΔG' = ΔGo + RT\ln(((Css)^2+Dss)/((Ass)^2+Bss))$
Here, $ΔG'$ is the actual free energy change for a reaction in an open system. $ΔGo$ is the standard free energy change for the same reaction under standard conditions. In a closed system. R is again the gas constant (1.806 cal/mole-deg) and T is the absolute temperature in which the reaction is actually occurring. The subscript ‘ss’ designates reactant and product concentrations measured under steady state conditions. To determine the actual free energy of a biochemical reaction in a cell (in fact in any living tissue), all you need to know are the $ΔGo$ for the reaction, the steady state concentrations of reaction components in the cells/tissues, and the absolute T under which the reactions are occurring.
144 The Energetics of Open Systems
Elsewhere, we will use the reactions of the glycolytic pathway to exemplify the energetics of open and closed systems. At that time, pay careful attention to the application of the terminology of energetics in describing energy flow in closed vs. open systems.
4.04: Key Words and Terms
actual free energy
endothermic
Law of Conservation
ATP
energy
Laws of Thermodynamics
bioenergetics
energy transduction
light
Boltzman equation
energy transfer
mass
calories
enthalpy
open system properties
calorimeter
entropy
open systems
chemical energy
equilibrium constant
order vs. entropy
chemical equilibrium
exergonic
standard conditions
closed systems
exothermic
standard free energy
decibels
free energy
steady state
e=mc2
gas constant
useful energy
electricity
Gibbs free energy
useless energy
endergonic
Keq
volts | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/04%3A_Bioenergetics/4.03%3A_Deriving_Simple_Energy_Relationships.txt |
• 5.1: Introduction
In this chapter, we look at the properties and mechanism of action of enzymes. These include allosteric change (induced fit, enzyme regulation), energetic events (changes in activation energy), and how enzymes work in open and closed (experimental) systems. Any catalyst, by definition, accelerates a chemical reaction. But enzymes and inorganic catalysts differ in important ways.
• 5.2: Enzymes
By 1941, their studies correlating mutations with enzyme deficiencies in Neurospora crassa (bread mold) and Drosophila melanogaster led George Beadle and Edward Tatum to propose the one-gene/one-enzyme hypothesis in 1941. In 1958, they shared Nobel Prize in Physiology and Medicine for this work.
• 5.3: Key Words and Terms
Thumbnail: diagram showing the induced fit model in enzymes (Public Domain; LadyofHats).
05: Enzyme Catalysis and Kinetics
In this chapter, we look at the properties and mechanism of action of enzymes. These include allosteric change (induced fit, enzyme regulation), energetic events (changes in activation energy), and how enzymes work in open and closed (experimental) systems. Any catalyst, by definition, accelerates a chemical reaction. But enzymes and inorganic catalysts differ in important ways (blue and red in the table below).
Enzymes are long polymers that can fold into intricate shapes. As a result, they can be more specific than inorganic catalysts in which substrates they recognize and bind to. Finally, enzymes are flexible and can be regulated in ways that rigid, inflexible, metallic inorganic catalysis cannot. The specificity of an enzyme lies in the structure and flexibility of its active site. We will see that the active site of enzymes undergo conformational change during catalysis. The flexibility of enzymes also explains the effects of enzymes to cellular metabolites that indicate the biochemical status of the cell. When such metabolites bind to an enzyme, they force a conformational change in the enzyme that change the catalytic rate of the reaction, a phenomenon called allosteric regulation. As you might imagine, changing the rate of a biochemical reaction can change the rate of an entire biochemical pathway…, and ultimately the steady state concentrations of products and reactants in the pathway.
To understand the importance of allosteric regulation, we’ll look at how we measure the speed of enzyme catalysis. As we consider the classic early 20th century enzyme kinetic studies of Leonor Michaelis and Maud Menten, we’ll focus on the significance of the Km and Vmax values that they derived from their data. But, before we begin our discussion here, remember that chemical reactions are by definition, reversible. The action of catalysts, either inorganic or organic, depends on this concept of reversibility.
Finally, let’s give a nod to recent human ingenuity that enabled enzyme action to turn an extracellular profit! You can now find enzymes in household cleaning products like detergents, where they digest and remove stains caused by fats and pigmented proteins. Enzymes added to meat tenderizers also digest (hydrolyze) animal proteins down to smaller peptides. Enzymes can even clean a clogged drain!
Learning objectives
When you have mastered the information in this chapter, you should be able to:
1. describe how the molecular flexibility of protein and RNA molecules make them ideal biological catalysts.
2. compare and contrast the properties of inorganic and organic catalysts.
3. explain why catalysts do not change equilibrium concentrations of a reaction conducted in a closed system.
4. compare the activation energies of catalyzed and un-catalyzed reactions and explain the roles of allosteric effectors in enzymatic reactions.
5. discuss how allosteric sites interact with an enzyme's active site and explain the concept of the rate limiting reaction in a biochemical pathway.
6. write simple rate equations for chemical reactions.
7. write the possible rate equations for equations for catalyzed reactions.
8. distinguish between Vmax and Km in the Michaelis-Menten kinetics equation.
9. state what Vmax and Km say about the progress of an enzyme catalyzed reaction.
10. interpret enzyme kinetic data and the progress of an enzyme-catalyzed reaction from this data.
11. more accurately identify Leonor Michaelis and Maud Menten! | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/05%3A_Enzyme_Catalysis_and_Kinetics/5.01%3A_Introduction.txt |
By 1941, their studies correlating mutations with enzyme deficiencies in Neurospora crassa (bread mold) and Drosophila melanogaster led George Beadle and Edward Tatum to propose the one-gene/one-enzyme hypothesis in 1941. In 1958, they shared Nobel Prize in Physiology and Medicine for this work. By the time of the award, their hypothesis had morphed twice: first into the one-gene/one-protein, and then the one-gene/one- polypeptide hypothesis. This rightfully revered history helped launch the age of molecular biology, making the discovery of RNA catalysts quite a surprise! The discovery of RNA catalysts, dubbed ribozymes, earned Sidney Altman and Thomas Cech the Nobel Prize in Chemistry in 1989. Ribozymes are now known that catalyze RNA splicing (the removal of unwanted regions of a precursor RNA. Ribozymes are also associated with a region of ribosomal RNA, where they participate in the catalysis of protein synthesis. Here, the focus here is based on the long history of protein enzyme catalysis, but you should recognize the mechanisms of enzyme catalytic mechanisms to be discussed involve essential features in all biocatalysts.
Enzymes are generally soluble in or outside cells while a few are part of membranes or other cellular structures. In all cases, they bind to soluble substrates (the reactants in enzyme-catalyzed reactions). The large size and exquisite diversity of protein structures make enzymes highly specific catalysts. The specificity of an enzyme results from the shape of the active site of the enzyme, which is dependent on the three-dimensional arrangement of amino acids in and around the region. The substrates of a catalyzed biochemical reaction are bound to, and held in place on the enzyme while rapid bond rearrangements take place. Because of their flexibility, enzymes undergo change in shape at the active site during catalysis itself. In addition, this flexibility enables small metabolites in cells to interact with and change the shapes of many enzymes. The latter phenomenon enables allosteric regulation, allowing cells to control the rates and even the direction of biochemical reactions and pathways. As we will see, enzymes may also be bound to prosthetic groups or ions that contribute to the shape and activity of the enzyme.
Almost no chemical reaction occurs that is not directly the result of enzyme catalysis, from the digestion of nutrients in your mouth, stomach and small intestines to pretty much every chemical reaction inside your cells [check out Kornberg A (1989) Never a Dull Enzyme. Ann. Rev. Biochem. 58:1-30].
A. The Mechanisms of Enzyme Catalysis
We describe the action of biological catalysis in two ways. One way takes into account structural features of the enzyme (active site shape, overall conformation, the affinities of the enzyme for its substrates). The other way involves the energetic of enzyme action. We’ll see that enzymes lower the activation energy of a chemical reaction. Activation energy is an inherent energy barrier to the reaction. Of course, structural and energy considerations of enzyme catalysis are related.
1. Structural Considerations of Catalysis
From a chemistry course, you may recall that the rate of an uncatalyzed reaction is dependent on the concentration of the reactants in solution. This is the Law of Mass Action, recognized in the 19th century. Look at this simple reaction:
$\ce{A + B <=> C + D}$
The Law of Mass Action makes two key assumptions:
1. At any given time following the start of the reaction, the rate of product formation is proportional to the concentrations of the reactants and products ([A], [B], [C] and [D] in this case).
2. Chemical reactions in the laboratory eventually reach equilibrium, at which point the net rate of formation of reaction products is zero (i.e., the forward and reverse reactions occur at the same rate).
At the start of the reaction written above, since there are no products yet, the reaction rate should be directly proportional only to the concentration of the reactants. Therefore, the Law of Mass Action predicts that a chemical reaction will occur faster at higher concentrations of A & B. This is because there are more reactant molecules in solution and a greater likelihood that they will collide in an orientation that allows the bond rearrangements for the reaction to occur.
Of course, reactant concentrations decline as products accumulate over time. Then the rate of formation of C & D should slows down, now affected by product as well as reactant concentrations; remember, all chemical reactions are inherently reversible! You may recognize the chemical rate equations from a chemistry course; these enable quantitation of reaction rates for our sample reaction. Here is the rate of formation of the products, C and D:
$\text{Rate of formation of products (C & D)} = \mathrm{k_1[A][B] – k_{-1}[C][D]}$
This equation recognizes that the reaction is reversible. Thus, the net reaction rate is equal to the rate of the forward reaction $\ce{k_1[A][B]}$ minus the rate of the back reaction $\ce{k_{-1}[C][D]}$. The equation is valid (applicable) at any time during the reaction. $\ce{k_1}$ and $\ce{k_{-1}}$ are rate constants for the forward and reverse reactions, respectively.
So how do catalysts work? Catalysts increase chemical reaction rates by bringing reactants together more rapidly than they would encounter each other based just on random molecular motion in solution. This is possible because catalysts have an affinity for their substrates.
In the case of inorganic catalysts, relatively weak, generic forces account for the affinity of reactants and inorganic catalysts. Thus, a metallic catalyst (e.g., silver, platinum) attracts molecules with the appropriate (e.g., charge) configuration. If the attraction (affinity) is sufficient, the metal will hold reactants in place long enough to catalyze the bond rearrangements of a chemical reaction.
Unlike inorganic catalysts, enzymes have evolved highly specific shapes with physical-chemical properties. As a result, enzymes typically attract only the substrates necessary for a particular biochemical reaction. The active site of an enzyme has the exquisitely selective affinity for its substrate(s). This affinity is many times greater than those of inorganic catalysts for generic reactants. The result is that enzymes are more efficient, faster catalysts.
Early ideas of how substrate-enzyme interaction could be so specific suggested a Lock and Key mechanism, illustrated below.
According to this model, the affinity of enzyme for substrate brings them together, after which the substrate uniquely fits into the active site like a key into a lock. Once in the active site, the substrate(s) would undergo the bond rearrangements specific for the catalyzed reaction to generate products and regenerate an unchanged enzyme. But X-ray crystallography of enzyme-substrate interaction revealed that the active site of the enzyme changes shape during catalysis. This allosteric change suggested the revised, Induced Fit mechanism of enzyme action modeled below.
In this model, enzyme-substrate affinity causes the substrate to bind to the enzyme surface. Once bound, the enzyme undergoes an allosteric change, drawing the substrate(s) more tightly into the active site and catalyzing the reaction. Of course, after the reaction products come off, the enzyme returns to its original shape.
2. Energetic Considerations of Catalysis
Catalysts work by lowering the activation energy (Ea) for a reaction, thereby dramatically increasing the rate of the reaction. Activation energy is essentially a barrier to getting interacting substrates together to actually undergo a biochemical reaction. Compare the random motion of substrates in solution that occasionally encounter one another. They even more rarely bump into one another in just the right way to cause a reaction. This explains why adding more reactants or increasing the temperature of a reaction can speed it up…, by increasing the number of random as well as productive molecular collisions. Unlike molecules and reactions in a test tube, living organisms do not have these options for conducting fast biochemical reactions, or controlling reaction rates.
Inorganic catalytic surfaces attract reactants where catalysis can occur. The attractions are weak compared to those of enzymes and their substrates. An enzyme’s active site attracts otherwise randomly distributed substrates very strongly, making enzyme catalysis faster than inorganic catalysis. Again, cells cannot use inorganic catalysts, most of which are insoluble and would attract reactants indiscriminately... not a good way for cells to control metabolism! The advent of enzymes with their specificity and high rate of catalysis was a key event in chemical evolution required for the origins of life. As we saw, allosteric change during the ‘induction of fit’ enables specific catalysis. In fact, a catalyzed reaction will be faster than the same reaction catalyzed by a piece of metal, and of course much faster (millions of times faster!) than the uncatalyzed reaction. The energetic of catalysis helps to explain why. Take a look at the energetic of a simple reaction in which A & B are converted to C & D, shown below.
Conducted in a closed system, enzyme-catalyzed reactions reach their equilibrium more rapidly. As with all catalysts, enzymes are not consumed by the reactions they catalyze, nor do they alter the equilibrium concentrations of reactants and products of these reactions. The roughly 4000 biochemical reactions known to be catalyzed in cells are undoubtedly an underestimate! But remember too, that we estimate that the human genome has only 20,000 to 25,000 different genes!
B. Enzyme Regulation
We noted that some enzymes are regulated, which just means that factors in the cell can slow down or speed up their rate of catalysis. In this way, the cell can respond quickly to metabolic needs reflected by the intracellular levels of these factors. Factors that slow down catalysis are called inhibitors. Those that speed up catalysis are called activators. In addition to responding to intracellular molecular indicators of the metabolic status of the cell, enzymes may be inhibited by drugs, poisons or changes in the chemical milieu (e.g. pH). Since cellular reactions occur as part of biochemical pathways, regulating a single enzyme can affect an entire pathway. For example, look at the generic pathway illustrated below.
This pathway exists to produce substance E. Under normal conditions, another series of metabolic reactions would consume E. However, if the cell is meeting its metabolic needs and no longer needs so much E, it will accumulate in the cell. If there is an excess of E in the cell, it might bind to one of the enzymes. In the pathway shown, E binds to enzyme 1. This binding causes an allosteric change inhibiting catalysis and slowing down the entire pathway. In this example, of allosteric regulation, we can assume that inhibitory regulation of enzyme 1 evolved to control the rate of production of substance E. This is a common mode of enzyme allosteric regulation, called feedback inhibition.
Enzymes can be regulated precisely because they can be bent out of shape (or into shape for that matter!). Some small metabolites become chemical information when they accumulate in cells, becoming the indicators of cellular metabolic status. The result is a decrease or increase enzyme activities to achieve an appropriate cellular response.
Whether an activator or an inhibitor of enzyme catalysis, regulatory molecules typically bind to enzymes at allosteric regulatory sites, causing local allosteric changes that is transmitted to the active site. Enzyme inhibition will occur if a change in shape reduces the affinity of enzyme for substrate or the rate of the bond rearrangements after the substrate has entered the active site. Enzyme activation would occur if the allosteric effect were to increase this affinity and/or catalytic rate. The mechanism of allosteric regulation of enzyme activity is illustrated below.
We can understand the effects changing rates of enzyme catalysis by determining enzyme kinetics. By comparing kinetic data for each enzyme in a biochemical pathway, one can determine a standard rate-limiting reaction under a given set of conditions. For example, if clinical tests reveal that a patient is producing too much of a biochemical metabolite, then the catalytic rate of the normally rate-limiting enzyme in its pathway of synthesis may have increased. What then, if the patient is producing too little of the metabolite? Either the catalytic rate of the rate-limiting enzyme has decreased or the catalytic rate of another enzyme in the biochemical pathway has become rate limiting. Reasons why a cellular biochemical would deviate from ‘normal’ levels include:
1. Viral & bacterial infection or environmental poisons: these can interfere with a specific reaction in a metabolic pathway; remedies depend on this information!
2. Chronic illness resulting from mutational enzyme deficiencies: treatments might include medications designed to enhance or inhibit (as appropriate) enzyme activity.
3. Genetic illness tied to metabolic deficiency: if a specific enzyme is the culprit, investigation of a pre- and/or post-natal course of treatment might be possible.
4. Life-style changes and choices: these might include eating habits, usually remediated by a change in diet.
5. Life-Style changes brought on by circumstance rather than choice: these are changes due to aging, such as the possibility of onset of Type 2 Diabetes; this can be delayed by switching to a low carb diet favoring hormonal changes that improve proper sugar metabolism.
Knowing the rate-limiting reaction(s) in biochemical pathways can identify regulated enzymes and lead to a remedy to correct a metabolic imbalance. As noted, ribozymes are RNA molecules that catalyze biochemical reactions; their kinetics can also be analyzed and classified. Next, we look at an overview of enzyme kinetics (for clear, detailed explanations of enzyme catalytic mechanisms, check out Jencks WP [1987, Catalysis in Chemistry and Enzymology. Mineola, NY, Courier Dover Publications]). We will consider how enzymes are regulated later, when we discuss glycolysis, a biochemical pathway that most living things use to extract energy from nutrients.
C. Enzyme Kinetics
All catalyzed chemical reactions display saturation kinetics, as shown below.
Note how at high substrate concentration, the active sites on all the enzyme molecules are bound to substrate molecules.
The experiment described below will determine the kinetics of the conversion of S to P by enzyme E.
A series of reaction tubes are set up, each containing the same concentration of enzyme ([E]) but different concentrations of substrate ([S]). The concentration of P ([P]) produced at different times just after the start of the reaction in each tube is plotted to determine the initial rate of P formation for each concentration of substrate tested (see below).
In this hypothetical example, the rates of the reactions (amount of P made over time) do not increase at substrate concentrations higher than 4 X10-5 M. The upper curves therefore represent the maximal rate of the reaction at the experimental concentration of enzyme. We say that the maximal reaction rate occurs at saturation.
Next, we can estimate the initial reaction rate (vo) at each substrate concentration by plotting the slope of the first few time points through the origin of each curve in the graph. Consider the graph below, of the initial reaction rates estimated in this way.
Each straight line is the vo for the reaction at a different [S] near the very beginning of the reaction, when [S] is high and [P] is vanishingly low. Next, we plot these rates (slopes, or vo values) against the different concentrations of S in the experiment to get the curve of the reaction kinetics below.
This is an example of Michaelis-Menten kinetics common to many enzymes, named after the two biochemists who realized that the curve described rectangular hyperbola.
Put another way, the equation mathematically describes the mechanism of catalysis of the enzyme. The equation below mathematically describes a rectangular hyperbola:
$\mathrm{y = \dfrac{xa}{x + b}}$
You might be asked to understand the derivation of (or even derive!) the Michaelis- Menten equation in a Biochemistry course. Suffice it to say here that Michaelis and Menten started with some simple assumptions about how an enzyme-catalyzed reaction would proceed and wrote reasonable chemical and rate equations for those reactions. Here is one way to write the chemical equation for a simple reaction in which an enzyme (E) catalyzes the conversion of substrate (S) to product (P):
$\ce{S<=>[][E] P}$
Michaelis and Menten rationalized that this reaction might actually proceed in three steps. In each step, E, the enzyme is treated as a reactant in the conversion of S to P. The resulting chemical equations are shown below.
Reasoning that the middle reaction (the conversion of E-S to E-P) would be the fastest one, and therefore would not be the rate-limiting reaction of catalysis, they only considered the first and third reactions to be relevant in determining the overall kinetics of product formation. Then they wrote the following rate equations for just these two chemical reactions (as one would in an introductory chemistry course):
$V_\text{E-S formation}=\mathrm{k_{1}[E][S]-k_{-1}[\text{E-S}]}$
$V_\text{P formation}=\mathrm{k_2[\text{E-S}]-k_{-2}[E][P]}$
Both of these equations describe a straight line, which does not describe the observed hyperbolic reaction kinetics. Solving one for e.g., E-S and substituting the solution for E-S in the other equation left a single equation that also described a straight line. Again, not the expected rectangular hyperbola. To arrive at a chemical rate equation consistent with a rectangular hyperbola, Michaelis and Menten made several assumptions, including those made by G. E. Briggs and J. B. S. Haldane about how E, S and P would behave in a catalyzed reaction.
It was those assumptions allowed them to re-write each equation, combine and rewrite them into a single mathematical equation that did indeed describe a rectangular hyperbola. Here are Briggs and Haldane’s assumptions:
We have already seen the equation that Michaelis and Menten derived and now known as the Michaelis-Menten equation:
$\mathrm{v_0 = \dfrac{Vmax[S]}{Km + [S]}}$
The take-home message here is that the assumptions about an enzyme-catalyzed reaction are a good approximation of how the reaction proceeds over time.
Michaelis and Menten defined Vmax and Km as key kinetic factors in enzymatic reactions. In the generic example of substrate conversion to product, we saw that increasing [S] results in a higher rate of product formation because a higher rate of encounters of enzyme and substrate molecules. At some point however, increasing [S] does not increase the initial reaction rate any further. Instead, vo asymptotically approaches a theoretical maximum for the reaction, defined as Vmax, the maximum initial rate. As we have already seen, Vmax occurs when all available enzyme active sites are saturated (occupied by substrate). At this point, the intrinsic catalytic rate determines the turnover rate of the enzyme. The substrate concentration at which the reaction rate has reached ½Vmax is defined as KM (the Michaelis-Menten constant). The Km is a ratio of rate constants remaining after rewriting the rate equations for the catalyzed reaction.
To recapitulate, the two most important kinetic properties of an enzyme are:
1. how quickly the enzyme becomes saturated with a particular substrate, which is related to the Km for the reaction, and
2. the maximum rate of the catalyzed reaction, described by the Vmax for the reaction.
Knowing these properties suggests how an enzyme might behave under cellular conditions, and can show how the enzyme should respond to allosteric regulation by natural inhibitory or activating factors…, and to poisons or other anomalous chemicals. You can find more details of how kinetic equations are derived (a necessary step in understanding how the enzyme works) in any good biochemistry textbook, or check out the Michaelis-Menten Kinetics entry in in the Enzymes Wikipedia link.
5.03: Key Words and Terms
activation energy
enzyme
Michaelis-Menten constant
active site
enzyme activation
Michaelis-Menten kinetics
allosteric change
enzyme inhibition
rate-limiting reaction
allosteric regulation
enzyme kinetics
ribozyme
allosteric site
enzyme regulation
saturation kinetics
biochemical pathway
induced fit
substrate specificity
catalytic RNAs
inorganic catalyst
substrates
conformation
Km
Vmax | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/05%3A_Enzyme_Catalysis_and_Kinetics/5.02%3A_Enzymes.txt |
• 6.1: Introduction
We used to get metabolic pathways charts like the one you see here free from vendors of biochemical reagents. This one is a high-resolution image; if you zoom in, you can actually read the content…, but don’t feel you must! The big picture is correct in macro- detail, but the chart is likely out of date in small new details. In this chapter, we ‘zoom in’ on the small region in the middle of the chart, encompassing glycolysis and the Krebs cycle.
• 6.2: Glycolysis (from the Greek glyco (sugar) lysis (Separation), or Sugar Breakdown
To begin with, the most common intracellular energy currency with which livings things “pay” for cellular work is ATP. The energy to make ATP on planet earth ultimately comes from the sun via photosynthesis. Recall that light energy fuels the formation of glucose and O2 from CO2 and water in green plants, algae, cyanobacteria and a few other bacteria. Photosynthesis even produces some ATP directly, but not enough to fuel all cellular and organismic growth and metabolism.
• 6.3: Some Details of Glycolysis
Recall that ATP hydrolysis is an exergonic reaction, releasing ~7 Kcal/mole (rounding down!) in a closed system under standard conditions. The condensation reaction of glucose phosphorylation occurs with a DGo of +3 Kcal/mole. This is an endergonic reaction under standard conditions. Summing up the free energy changes of the two reactions, we can calculate the overall DGo of -4 Kcal/mole for the coupled reaction under standard conditions in a closed system.
• 6.4: Gluconeogenesis
In a well-fed animal, most cells can store a small amount of glucose as glycogen. All cells break glycogen down as needed to retrieve nutrient energy as G-6-P. Glycogen hydrolysis, or glycogenolysis, produces G-1-P that is converted to G-6-P, as we saw at the top of Stage 1 of glycolysis. But, glycogen in most cells is quickly used up between meals. Therefore, most cells depend on a different, external source of glucose other than diet.
• 6.5: The Atkins Diet and Gluconeogenesis
You may know that the Atkins Diet is an ultra-low carb diet. It is one of several low-carb ketogenic diets. The glucocorticoid hormones released on a low carb diet trick the body into a constant gluconeogenic state.
• 6.6: The Krebs/TCA/Citric acid cycle
Glycolysis through fermentative reactions produces ATP anaerobically. The evolution of respiration (the aerobic use of oxygen to efficiently burn nutrient fuels) had to wait until photosynthesis created the oxygenic atmosphere we live in now. Read more about the source of our oxygenic atmosphere in Dismukes GC et al.
• 6.7: Key Words and Terms
06: Glycolysis the Krebs Cycle and the Atkins Diet
We used to get metabolic pathways charts like the one you see here free from vendors of biochemical reagents. This one is a high-resolution image; if you zoom in, you can actually read the content…, but don’t feel you must! The big picture is correct in macro- detail, but the chart is likely out of date in small new details. In this chapter, we ‘zoom in’ on the small region in the middle of the chart, encompassing glycolysis and the Krebs cycle.
We have looked at the principles governing thermodynamics (the flow of energy in the universe) and bioenergetics (energy flow in living systems). We saw evidence that energy can be exchanged between components in the universe, but that it can be neither created nor destroyed. That makes the universe a closed system, a conclusion codified as the first law of thermodynamics. Personally, I find it troubling that there is no escape from the universe…, that is, until I remind myself that the universe is a pretty big place, and I am but a small part of a small system. You can define systems for yourself: the solar system, planet earth, the country you pledge allegiance to, your city or village, your school, a farm or homestead…! Then you may derive comfort from the realization that you can move from one system to another and even exchange goods and services between them. This is a metaphor for energy flow between systems in the universe. We also said that the first law applies to closed systems within the universe…, and that there are no closed systems in the universe! Any system in the universe is open, always exchanging energy and mass with neighboring systems. What we mean by the term ‘closed system’ is that we can define and isolate some small part of the universe, and then measure any energy that this isolated system gives up to its environment, or takes in from it. The simplest demonstration of the first law in action was the bomb calorimeter that measures heat released or absorbed during a chemical reaction.
The second concept said that energy flows from one place to another only when it can. In the vernacular, we say that energy flows downhill. Anything that happens in the universe (a galaxy moving through space, a planet rotating, you getting out of bed, coffee perking, sugar burning in your cells, your DNA replicating) does so because of a downhill flow of energy. We saw that by definition, any happening or event in the universe, however large or small, is spontaneous, occurring with a release of free energy. Remember, spontaneous means “by itself” and not necessarily instantaneous or fast! Finally, we noted that that when enzymes catalyze biochemical reactions in a closed system, the reactions still reach equilibrium, despite the higher rate of the catalyzed reaction. What does this tell you about the energetics of catalyzed reactions in closed systems?
With this brief reminder about energy flow and what enzymes do, we’ll turn to the question of how our cells capture nutrient free energy. This will include examples of the energetics of closed systems that reach equilibrium, and open systems that don’t! First we’ll tackle glycolysis, an anaerobic pathway for generating chemical energy from glucose, as well as the first of several pathways of respiration. Then we’ll look at Gluconeogenesis, a regulated reversal of glycolysis. We ask when, where and why we would want to make, rather than burn glucose. Finally, we begin a discussion of respiration with a look at the Krebs Cycle.
The complete respiratory pathway can be summarized by the following equation:
\[C6H12O6 + 6O2 ⇔ 6CO2 + 6H2O\]
The standard free energy change for this reaction (ΔGo) is about -687Kcal/mole. That is the maximum amount of nutrient free energy that is (at least in theory) available from the complete respiration of a mole of glucose. Given the cost of about 7.3 Kcal to make each mole of ATP (adenosine triphosphate), how many moles of ATP might a cell produce after burning a mole of glucose? We’ll figure this out here.
learning Objectives
When you have mastered the information in this chapter, you should be able to:
1. explain the difference between fermentation and respiratory glycolysis and the role of redox reactions in both processes.
2. calculate and then compare and contrast DGo and DG’ for the same reaction, and explain any differences in free energy in open and closed systems.
3. describe and explain the major events of the first stage of glycolysis and trace the free energy changes through the formation of G-3-P.
4. describe and explain the major events of the second stage of glycolysis and trace the free energy changes through the formation of pyruvate and lactic acid.
5. state the role of redox reactions in glycolysis and fermentation.
6. compare and contrast glucose (i.e., carbohydrates in general), ATP, NADH and FADH2 as high-energy molecules. [Just for fun, click Power in the Primordial Soup to read some far out speculations on prebiotic high-energy molecules that might have been around when ATP was being hired for the job!].
7. explain why only a few cell types in the human body conduct gluconeogenesis.
8. explain why gluconeogenesis, an energetically unfavorable pathway, occurs at all.
9. explain why the Atkins Diet works and speculate on its downside (and that of the related South Beach Diet).
10. explain the concept of a super-catalyst.
11. explain why a super-catalyst like the Krebs Cycle would have evolved.
12. explain the role of high energy linkages and electron carriers in the Krebs cycle.
13. compare phosphate ester linkages in ATP and GTP, and thioester linkage in acetyl-S- CoA and succinyl-S-CoA in terms of energetics and their biochemical reactions.
speculate on why the Krebs Cycle in E. coli generates GTP molecules and why it generates ATP molecules eukaryotes. | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/06%3A_Glycolysis_the_Krebs_Cycle_and_the_Atkins_Diet/6.01%3A_Introduction.txt |
One of the properties of life is that living things require energy. The pathways of energy flow through life are shown below.
To begin with, the most common intracellular energy currency with which livings things “pay” for cellular work is ATP. The energy to make ATP on planet earth ultimately comes from the sun via photosynthesis. Recall that light energy fuels the formation of glucose and O2 from CO2 and water in green plants, algae, cyanobacteria and a few other bacteria. Photosynthesis even produces some ATP directly, but not enough to fuel all cellular and organismic growth and metabolism. So all cells, even plant cells, use fermentation or respiration (anaerobic or aerobic processes respectively) to capture nutrient free energy (mostly) as ATP.
ATP is called a high-energy intermediate because its hydrolysis releases a large amount to free energy. In the condensation reactions that make ATP, it takes about 7.3 Kcal of free energy to link a phosphate to ADP in a phosphate ester linkage. Having captured nutrient free energy in a form that cells can use, ATP hydrolysis releases that free energy to fuel cellular work, including bending cilia, whipping flagella, contracting muscles, transmitting neural information, building polymers from monomers, and more. The energetics of ATP hydrolysis and synthesis are summarized below.
The free energy needed to make ATP in animal cells comes exclusively from nutrients (sugars, fats, proteins). As noted, plants get free energy directly from sunlight, but they mobilize nutrient free energy they make in much the same way as the rest of us get it from what we eat! Glucose oxidation releases a considerable amount of free energy, enough to synthesize many molecules of ATP, as shown below.
Cellular respiration, the oxidation of glucose, starts with glycolysis. Otto Myerhoff and Archibald V. Hill shared a Nobel Prize in Physiology or Medicine with in 1923 for isolating enzymes of glucose metabolism from muscle cells. Thanks to the efforts of others (e.g., Gustav Embden, Otto Meyerhof, Otto Warburg, Gerty Cori, Carl Cori), all the enzymes and reactions of the glycolyitic pathway were known by 1940, and the pathway became known as the Embden-Myerhoff Pathway. As we will see, glycolysis is an evolutionarily conserved biochemical pathway used by all organisms to capture a small amount of nutrient free energy. For more detail, check out Fothergill-Gilmore LA [(1986) The evolution of the glycolytic pathway. Trends Biochem. Sci. 11:47-51]. The glycolytic pathway occurs in the cytosol of cells where it breaks down each molecule of glucose (C6H12O6) into two molecules of pyruvic acid (pyruvate; CH3COCOOH). This occurs in two stages, capturing nutrient free energy in two ATP molecules per glucose molecule that enters the pathway.
Glycolytic reactions are summarized below, highlighting the two stages of the pathway.
Stage 1 of glycolysis actually consumes ATP. Phosphates are transferred from ATP first to glucose and then to fructose-6-phosphate, reactions catalyzed by hexokinase and phosphofructokinase respectively. So, these Stage 1 phosphorylations consume free energy. Later, in Stage 2 of glycolysis, nutrient free energy is captured in ATP and NADH (reduced nicotinamide adenine dinucleotide). NADH forms in redox reactions in which NAD+ is reduced as some metabolite is oxidized. In Stage 2, it is glyceraldehyde- 3-phosphate that is oxidized…, but more later!
In fact, by the end of glycolysis, four molecules of ATP and two of NADH have been formed and a single starting glucose molecule has been split into two molecules of pyruvate. Pyruvate will be metabolized either anaerobically or aerobically.
The alternate fates of pyruvate are summarized below.
151 Overview of Glycolysis
Anaerobic (complete) glycolysis is a fermentation pathway. In anaerobic glycolysis the electrons in NADH produced in Stage 2 of glycolysis are used to reduce pyruvate, so that in the end, there is no consumption of O2 and no net oxidation of nutrient (i.e., glucose). A familiar anaerobic glycolytic pathway is the production of alcohol by yeast in the absence of oxygen. Another one is the muscle fatigue you might have experienced after especially vigorous and prolonged exercise. This results from a fermentation that produces an anaerobic build-up of lactic acid in skeletal muscle cells. In anaerobic glycolysis, the reduction of pyruvate can lead to one of several other fermentation end products, along with a net yield of two ATPs per glucose fermented.
Aerobic (incomplete) glycolysis also produced two ATPs, and is the first step in the complete oxidation of glucose, the respiration pathway oxidizing glucose to CO2 and H2O, leaving no carbohydrates behind. Pyruvate is completely oxidized in mitochondria. As we look at the reactions of glycolysis and the Krebs cycle, watch for redox reactions in both pathways.
Along the way, we’ll also consider Gluconeogenesis, a pathway that essentially reverses the glycolysis and results in glucose synthesis. Gluconeogenesis occurs both under normal conditions, during in high-protein/low carb diets, and during fasting or starvation. In another chapter, we’ll look at electron transport and oxidative phosphorylation, the pathways that complete the oxidation of glucose. Here, we begin with a closer look at glycolysis, focusing on the enzyme-catalyzed reactions and free energy transfers between pathway components. We will consider the energetics and enzymatic features of each reaction. | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/06%3A_Glycolysis_the_Krebs_Cycle_and_the_Atkins_Diet/6.02%3A_Glycolysis_%28from_the_Greek_glyco_%28sugar%29_lysis_%28Separation%29_or_Sugar_Brea.txt |
A. Glycolysis, Stage 1
Reaction 1: In the first reaction of glycolysis, the enzyme hexokinase rapidly phosphorylates glucose entering the cell, forming glucose-6-phosphate (G-6-P). As shown below, the overall reaction is exergonic; the free energy change for the reaction is -4 Kcal per mole of G-6-P synthesized.
This is a coupled reaction, in which phosphorylation of glucose is coupled to ATP hydrolysis. The free energy of ATP hydrolysis (an energetically favorable reaction) fuels the glucose phosphorylation (an energetically unfavorable reaction). The reaction is also biologically irreversible, as shown by the single vertical arrow. Excess dietary glucose can be stored in most cells (especially liver and kidney cells) as a highly branched polymer of glucose monomers called glycogen. In green algae and plants, glucose made by photosynthesis is stored as polymers of starch. When glucose is necessary for energy, glycogen and starch hydrolysis forms glucose-1- phosphate (G-1-P) which is then converted to G-6-P.
Let’s look at the energetics (free energy flow) of the hexokinase-catalyzed reaction. This reaction can be seen as the sum of two reactions shown below.
Recall that ATP hydrolysis is an exergonic reaction, releasing ~7 Kcal/mole (rounding down!) in a closed system under standard conditions. The condensation reaction of glucose phosphorylation occurs with a DGo of +3 Kcal/mole. This is an endergonic reaction under standard conditions. Summing up the free energy changes of the two reactions, we can calculate the overall DGo of -4 Kcal/mole for the coupled reaction under standard conditions in a closed system.
The reactions above are written as if they are reversible. However, we said that the overall coupled reaction is biologically irreversible. Where’s the contradiction? To explain, we say that an enzyme-catalyzed reaction is biologically irreversible when the products have a relatively low affinity for the enzyme active site, making catalysis (acceleration) of the reverse reaction very inefficient. Enzymes catalyzing biologically irreversible reactions don’t allow going back to reactants, but they are often allosterically regulated. This is the case for hexokinase. Imagine a cell that slows its consumption of G-6-P because its energy needs are being met. What happens when G-6-P levels rise in cells? You might expect the hexokinase reaction to slow down so that the cell doesn’t unnecessarily consume a precious nutrient energy resource. The allosteric regulation of hexokinase is illustrated below.
As G-6-P concentrations rise in the cell, excess G-6-P binds to an allosteric site on hexokinase. The conformational change in the enzyme is then transferred to the active site, inhibiting the reaction.
152 Glycolysis Stage 1, Reaction 1
Reaction 2: In this slightly endergonic and reversible reaction, isomerase catalyzes the isomerization of G-6-P to fructose-6-P (F-6-P), as shown below.
Reaction 3: In this biologically irreversible reaction, 6-phosphofructokinase (6-P- fructokinase) catalyzes the phosphorylation of F-6-P to make fructose 1,6 di- phosphate (F1,6 diP). This is also a coupled reaction, in which ATP provides the second phosphate. The overall reaction is written as the sum of two reactions, as shown below.
Like the hexokinase reaction, the 6-P-fructokinase reaction is a coupled, exergonic and allosterically regulated reaction. Multiple allosteric effectors, including ATP, ADP and AMP and long-chain fatty acids regulate this enzyme.
Reactions 4 and 5: These are the last reactions of the first stage of glycolysis. In reaction 4, F1,6 diP (a 6-C sugar) is reversibly split into dihydroxyacetone phosphate (DHAP) and glyceraldehyde-3-phosphate (G-3-P). In reaction 5 (also reversible), DHAP is converted into another G-3-P. Here are the reactions:
The net result is the formation of two molecules of G-3-P in the last reactions of Stage 1 of glycolysis. The enzymes F-diP aldolase and triose-P-isomerase both catalyze freely reversible reactions. Also, both reactions proceed with a positive free energy change and are therefore endergonic. The sum of the free energy changes for the splitting of F1,6 diP into two G-3-Ps is a whopping +7.5 Kcal per mole, a very energetically unfavorable process.
Summing up, by the end of Stage 1 of glycolysis, we have consumed two ATP molecules, and split one 6C carbohydrate into two 3-C carbohydrates. We have also seen two biologically irreversible and allosterically regulated enzymes.
153 Glycolysis Stage 1; Reactions 2-5
B. Glycolysis, Stage 2
We will follow just one of the two molecules of G-3-P generated by the end of Stage 1 of glycolysis, but remember that both are proceeding through Stage 2 of glycolysis.
Reaction 6: This is a redox reaction. G-3-P is oxidized to 1,3, diphosphoglyceric acid (1,3, diPG) and NAD+ is reduced to NADH. The reaction catalyzed by glyceraldehyde-3-phopsphate dehydrogenase is shown below.
In this freely reversible endergonic reaction, a hydrogen molecule (H2) is removed from G-3-P, leaving behind phosphoglyceric acid. This short-lived oxidation intermediate is phosphorylated to make 1,3 diphosphoglyceric acid (1,3diPG). At the same time, the hydrogen molecule is split into a hydride ion (H-) and a proton (H+). The H- ions reduce NAD+ to NADH, leaving the protons behind in solution. Remember that all of this is happening in the active site of the same enzyme!
Even though it catalyzes a reversible reaction, G-3-P dehydrogenase is allosterically regulated. However, in contrast to the regulation of hexokinase, that of G-3-P dehydrogenase is more complicated! The regulator is NAD+ and the mechanism of allosteric regulation of G-3-P dehydrogenase by NAD+ is called negative cooperativity. It turns out that the higher the [NAD+] in the cell, the lower the affinity of the enzyme for more NAD+ and the faster the reaction in the cell! The mechanism is discussed at the link below.
154 Glycolysis Stage 2; Reaction 6
Reaction 7: The reaction shown below is catalyzed by phosphoglycerate kinase. It is freely reversible and exergonic, yielding ATP and 3-phosphoglyceric acid (3PG).
Catalysis of phosphate group transfer between molecules by kinases is called substrate-level phosphorylation, often the phosphorylation of ADP to make ATP. In this coupled reaction the free energy released by hydrolyzing a phosphate from 1,3 diPG is used to make ATP. Remember that this reaction occurs twice per starting glucose. Two ATPs have been synthesized to this point in glycolysis. We call 1,3 diPG a very high-energy phosphate compound.
Reaction 8: This freely reversible endergonic reaction moves the phosphate from the number 3 carbon of 3PG to the number 2 carbon as shown below.
Mutases like phoshoglycerate mutase catalyze transfer of functional groups within a molecule.
Reaction 9: In this reaction (shown below), enolase catalyzes the conversion of 2PG to phosphoenol pyruvate (PEP).
Reaction 10: This reaction results in the formation of pyruvic acid (pyruvate), as shown below. Remember again, two pyruvates are produced per starting glucose molecule.
The enzyme pyruvate kinase couples the biologically irreversible, exergonic hydrolysis of a phosphate from PEP and transfer of the phosphate to ADP in a coupled reaction. The reaction product, PEP, is another very high-energy phosphate compound.
155 Glycolysis Stage 2; Reactions 7-10
Pyruvate kinase is allosterically regulated by ATP, citric acid, long-chain fatty acids, F1,6 diP, and one of its own substrates, PEP.
In incomplete (aerobic) glycolysis, pyruvate is oxidized in mitochondria during respiration (see the Alternate Fates of Pyruvate above). Fermentations are called complete glycolysis because pyruvate is reduced to one or another end product. Recall that muscle fatigue results when skeletal muscle uses anaerobic fermentation to get energy during vigorous exercise. When pyruvate is reduced to lactic acid (lactate), lactic acid accumulation causes muscle fatigue. The enzyme Lactate Dehydrogenase (LDH) that catalyzes this reaction is regulated, but not allosterically. Instead different muscle tissues regulate LDH by making different versions of the enzyme! Click the Link below for an explanation.
156 Fermentation: Regulation of Pyruvate Reduction is NOT Allosteric!
C. A Chemical and Energy Balance Sheet for Glycolysis
Compare the balance sheets for complete glycolysis (fermentation) to lactic acid and incomplete (aerobic) glycolysis, showing chemical products and energy transfers.
There are two reactions in Stage 2 of glycolysis that each yield a molecule of ATP. Since each of these reactions occurs twice per starting glucose molecule, Stage 2 of glycolysis produces four ATP molecules. Since Stage 1 consumed two ATPs, the net yield of chemical energy as ATP by the end of glycolysis is two ATPs, whether complete to lactate or incomplete to pyruvate! Because they can’t make use of oxygen, anaerobes have to settle for the paltry 15 Kcal worth of ATP that they get from a fermentation. Since there are 687 Kcal potentially available from the complete combustion of a mole of glucose, there is a lot more free energy left to be captured during the rest of respiration.
157 Balance Sheet of Glycolysis
Remember also that the only redox reaction in aerobic glycolysis is in Stage 2. This is the oxidation of G-3-P, a 3C glycolytic intermediate. Now check out the redox reaction a fermentation pathway. Since pyruvate, also a 3C intermediate, was reduced, there has been no net oxidation of glucose (i.e., glycolytic intermediates) in complete glycolysis.
By this time, you will have realized that glycolysis is a net energetically favorable (downhill, spontaneous) reaction pathway in a closed system, with an overall negative ΔGo. Glycolysis is also normally spontaneous in most of our cells, driven by a constant need for energy to do cellular work. Thus the actual free energy of glycolysis, or ΔG’, is also negative. In fact, glycolysis in actively respiring cells proceeds with release of more free energy than it would in a closed system. In other words, the ΔG’ for glycolysis in active cells is more negative than the ΔGo of glycolysis!
Now, for a moment, let’s look at gluconeogenesis, the Atkins Diet and some not-so- normal circumstances when glycolysis essentially goes in reverse, at least in a few cell types. Under these conditions, glycolysis is energetically unfavorable, and those reverse reactions are the ones proceeding with a negative ΔG’! | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/06%3A_Glycolysis_the_Krebs_Cycle_and_the_Atkins_Diet/6.03%3A_Some_Details_of_Glycolysis.txt |
In a well-fed animal, most cells can store a small amount of glucose as glycogen. All cells break glycogen down as needed to retrieve nutrient energy as G-6-P. Glycogen hydrolysis, or glycogenolysis, produces G-1-P that is converted to G-6-P, as we saw at the top of Stage 1 of glycolysis. But, glycogen in most cells is quickly used up between meals. Therefore, most cells depend on a different, external source of glucose other than diet. Those sources are liver and to a lesser extent, kidney cells, that can store large amounts of glycogen after meals. In continual feeders (for examples cows and other ruminants), glycogenolysis is ongoing. In intermittent feeders (like us), liver glycogenolysis can supply glucose to the blood for 6-8 hours between meals, to be distributed as needed to all cells of the body. Thus, you can expect to use up liver and kidney glycogen reserves after a good night’s sleep, a period of intense exercise, or any prolonged period of low carbohydrate intake (fasting or starvation). Under these circumstances, animals use gluconeogenesis (literally, new glucose synthesis) in liver and kidney cells to provide systemic glucose to nourish other cells. As always in otherwise healthy individuals, the hormones insulin and glucagon regulate blood glucose homeostasis, protecting against hypoglycemia (low blood sugar) and hyperglycemia (high blood sugar) respectively. The gluconeogenic pathway produces glucose from carbohydrate and non-carbohydrate precursor substrates. These precursors include pyruvate, lactate, glycerol and gluconeogenic amino acids. The latter are amino acids that can be converted to alanine. Look at the side-by-side reactions of glycolysis and gluconeogenesis on the next page. Look for the two bypass reactions, catalyzed by two carboxylases and two phosphatases (brown in the illustration) and the glycolytic reactions that function in reverse during gluconeogenesis.
If glycolysis is an exergonic pathway, then gluconeogenesis must be an endergonic one. In fact, while glycolysis through two pyruvates generates a net of two ATPs, gluconeogenesis from two pyruvate to glucose costs 4 ATPs and two GTPs! Likewise, gluconeogenesis is only possible if the bypass enzymes are present. These are necessary to get around the three biologically irreversible reactions of glycolysis. Except for the bypass reactions, gluconeogenesis is essentially a reversal of glycolysis.
As drawn in the pathways above, glycolysis and gluconeogenesis would seem to be cyclic. In fact this apparent cycle was recognized by Carl and Gerti Cori, who shared the 1947 Nobel Prize for Medicine or Physiology with Bernardo Houssay for discovering how glycogen is broken down to pyruvate in muscle (in fact most) cells, which can then be used to resynthesize glucose in liver cells. Named after the Coris, The Cori Cycle, shown below, recognizes the interdependence of liver and muscle in glucose breakdown and resynthesis.
In spite of this free energy requirement, gluconeogenesis is energetically favorable in liver and kidney cells! This is because the cells are open systems. The accumulation of pyruvate in liver cells and a rapid release of new glucose into the blood drives the energetically favorable reactions of gluconeogenesis forward. Thus, under gluconeogenic conditions, glucose synthesis occurs with a negative DG’, a decline in actual free energy. Of course, glycolysis and gluconeogenesis are not simultaneous! Which pathways operate in which cells is tightly controlled.
Glycolysis is the norm in all cell types, even in liver and kidney. However, the cessation of glycolysis in favor of gluconeogenesis in the latter cells is under hormonal control, as illustrated below.
Key in turning on liver gluconeogenesis is the role of glucocorticoid hormones. What causes the secretion of glucocorticoids? A long night’s sleep, fasting and more extremely, starvation are forms of stress. Stress responses starts in the hypothalamic- pituitary axis. Different stressors cause the hypothalamus to secrete a neurohormone that in turn, stimulates the release of ACTH (adrenocorticotropic hormone) from the pituitary gland. ACTH then stimulates the release of cortisone and other glucocorticoids from the cortex (outer layer) of the adrenal glands. As the name glucocorticoid suggests, these hormones participate in the regulation of glucose metabolism. Here is what happens at times of low blood sugar (e.g., when carbohydrate intake is low):
1. Glucocorticoids stimulate the synthesis of gluconeogenic bypass enzymes in liver cells.
2. Glucocorticoids stimulate protease synthesis in skeletal muscle, causing hydrolysis of the peptide bonds between amino acids. Gluconeogenic amino acids circulate to the liver where they are converted to pyruvate, a major precursor of gluconeogenesis. Some amino acids are ketogenic; they are converted to Acetyl-S-CoA, a precursor to ketone bodies.
(1). Glucocorticoids stimulate increased levels of enzymes including lipases that catalyze hydrolysis of the ester linkages in triglycerides (fat) in adipose and other cells. This generates fatty acids and glycerol.
(2). Glycerol circulates to liver cells that take it up convert it to G-3-P, augmenting gluconeogenesis. Fatty acids circulate to liver cells where they are oxidized to Acetyl-S-CoA that is then converted to ketone bodies. and released to the cisculation.
(3). Most cells use fatty acids as an alternate energy nutrient when glucose is limiting. , and while heart and brain cells depend on glucose for energy, brain cells can use ket9one bodies as an alternate energy course.
essential roles of glucocorticoids
1. It’s a pity that we humans cannot use fatty acids as gluconeogenic substrates! Plants and some lower animals have a glyoxalate cycle pathway that can convert the products of fatty acid oxidation (acetate) directly into carbohydrates that can enter the gluconeogenic pathway. Lacking this pathway, we (and higher animals in general) cannot convert fats to carbohydrates, in spite of the fact that we can all too easily convert the latter to the former!
The dark side of bad eating habits is prolonged starvation that can overwhelm the gluconeogenic response. You see this in reports from third world regions suffering starvation due to drought or other natural disaster, or war. The spindly arms and legs of starving children result from muscle wasting as the body tries to provide the glucose necessary for survival. When the gluconeogenic response is inadequate to the task, the body can resort to ketogenic fat metabolism. Think of this as a last resort, leading to the production of ketone bodies and the “acetone breath” in starving people.
6.05: The Atkins Diet and Gluconeogenesis
You may know that the Atkins Diet is an ultra-low carb diet. It is one of several low-carb ketogenic diets. The glucocorticoid hormones released on a low carb diet trick the body into a constant gluconeogenic state. While the liver can produce enough glucose for brain and heart cells, the rest of the cells in our bodies switch to burning fats, hence the weight loss. Discredited some years ago, the Atkins Diet (and similar ones e.g., South Beach) is now back in favor. Some folks on these diets restrict their intake of carbohydrates so much that they can develop “acetone breath”! Nevertheless, low carb diets are important in the control of diabetes. In older folks, type 2 (adult-onset) diabetics can control their disease with a low carb diet and a drug called metformin, which blocks gluconeogenesis and therefore prevents glucose synthesis from gluconeogenic substrates, at the same time stimulating cellular receptors to take up available glucose. For more details on the mechanism of metformin action, check out Hundal RS et al. [(2000) Mechanism by Which Metformin Reduces Glucose Production in Type 2 Diabetes. Diabetes 49 (12): 2063–9]. Given the prevalence of obesity and type 2 diabetes in the U.S., it’s likely that someone you know is taking metformin or other similar medication!
158 Gluconeogenesis & the Atkins Diet | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/06%3A_Glycolysis_the_Krebs_Cycle_and_the_Atkins_Diet/6.04%3A_Gluconeogenesis.txt |
Glycolysis through fermentative reactions produces ATP anaerobically. The evolution of respiration (the aerobic use of oxygen to efficiently burn nutrient fuels) had to wait until photosynthesis created the oxygenic atmosphere we live in now. Read more about the source of our oxygenic atmosphere in Dismukes GC et al. [(2001) The origin of atmospheric oxygen on earth: the innovation of oxygenic photosynthesis. Proc. Nat. Acad. Sci. USA 98:2170-2175].
The Krebs cycle is the first pathway of oxygenic respiration. Evolution of this respiration and the chemical bridge from glycolysis to the Krebs cycle, no doubt occurred a few reactions at a time, perhaps at first as a means of protecting anaerobic cells from the ‘poisonous’ effects of oxygen. Later, natural selection fleshed out the aerobic Krebs cycle, electron transport and oxidative phosphorylation pathways we see today.
Whatever its initial utility, these reactions were an adaptive response to the increase in oxygen in the earth’s atmosphere. As a pathway for getting energy out of nutrients, respiration is much more efficient than glycolysis. Animals rely on it, but even plants and photosynthetic algae use the respiratory pathway when sunlight is not available! Here we focus on oxidative reactions in mitochondria, beginning with pyruvate oxidation and continuing to the redox reactions of the Krebs cycle.
After entering the mitochondria, pyruvate dehydrogenase catalyzes pyruvate oxidation to Acetyl-S-Coenzyme A (Ac-S-CoA). Then the Krebs cycle completely oxidizes the Ac-S- CoA. These mitochondrial redox reactions generate CO2 and lot of reduced electron carriers (NADH, FADH2). The free energy released in these redox reactions is coupled to the synthesis of only one ATP per pyruvate oxidized (i.e., two per the glucose we started with!). It is the NADH and FADH2 molecules have captured most of the free energy in the original glucose molecules. These entry of pyruvate into the mitochondrion and its oxidation are summarized below.
Pyruvate oxidation converts a 3C carbohydrate into acetate, a 2C molecule, releasing a molecule of CO2. In this highly exergonic reaction, CoA-SH forms a high-energy thioester linkage with the acetate in Ac-S-CoA. The oxidation of pyruvic acid results in the reduction of NAD+, production of Ac-S-CoA and a molecule of CO2, as shown below.
The Krebs cycle functions during respiration to oxidize Ac-S-CoA and to reduce NAD+ and FAD to NADH and FADH2 (respectively). Intermediates of the Krebs cycle also function in amino acid metabolism and interconversions. All aerobic organisms alive today share the Krebs cycle we see in humans. This is consistent with its spread early in the evolution of our oxygen environment. Because of the central role of Krebs cycle intermediates in other biochemical pathways, parts of the pathway may even have pre- dated the complete respiratory pathway. The Krebs cycle takes place in mitochondria of eukaryotic cells.
After the oxidation of pyruvate, the Ac-S-CoA enters the Krebs cycle, condensing with oxaloacetate in the cycle to form citrate. There are four redox reactions in the Krebs cycle. As we discuss the Krebs cycle, look for the accumulation of reduced electron carriers (FADH2, NADH) and a small amount of ATP synthesis by substrate-level phosphorylation. Also, follow the carbons in pyruvate into CO2. The Krebs Cycle as it occurs in animals is summarized below.
To help you understand the events of the cycle,
1. find the two molecules of CO2 produced in the Krebs cycle itself.
2. find GTP (which quickly transfers its phosphate to ADP to make ATP). Note that in bacteria, ATP is made directly at this step.
3. count all of the reduced electron carriers (NADH, FADH2). Both of these electron carriers carry a pair of electrons. If you include the electrons on each of the NADH molecules made in glycolysis, how many electrons have been removed from glucose during its complete oxidation?
Remember that glycolysis produces two pyruvates per glucose, and thus two molecules of Ac-S-CoA. Thus, the Krebs cycle turns twice for each glucose entering the glycolytic pathway. The high-energy thioester bonds formed in the Krebs cycle fuel ATP synthesis as well as the condensation of oxaloacetate and acetate to form citrate in the first reaction. Each NADH carries about 50 Kcal of the 687 Kcal of free energy originally available in a mole of glucose; each FADH2 carries about 45 Kcal of this free energy. This energy will fuel ATP production during electron transport and oxidative phosphorylation.
159 Highlights of the Krebs Cycle
Finally, the story of the discovery of the Krebs cycle is as interesting as the cycle itself! Albert Szent-Györgyi won a Nobel Prize in 1937 for discovering some organic acid oxidation reactions initially thought to be part of a linear pathway. Hans Krebs did the elegant experiments showing that the reactions were part of a cyclic pathway. He proposed (correctly!) that the cycle would be a supercatalyst that would catalyze the oxidation of yet another organic acid. Some of the experiments are described by Krebs and his coworkers in their classic paper: Krebs HA, et al. [(1938) The formation of citric and α-ketoglutaric acids in the mammalian body. Biochem. J. 32: 113–117]. Hans Krebs and Fritz Lipmann shared the 1953 Nobel Prize in Physiology or Medicine. Krebs was recognized for his elucidation of the TCA cycle, which now more commonly carries his name. Lipmann was recognized for proposing ATP as the mediator between food (nutrient) energy and intracellular work energy, and for discovering the reactions that oxidize pyruvate and synthesize Ac-S-CoA, bridging the Krebs Cycle and oxidative phosphorylation (to be considered iin the next chapter).
160 Discovery of the Krebs Cycle
You can read Krebs’ review of his own research in Krebs HA [(1970) The history of the tricarboxylic acid cycle. Perspect. Biol. Med. 14:154-170]. For a classic read on how Krebs described his supercatalyst suggestion, click Hans Krebs Autobiographical Comments. For more about the life of Lipmann, check out the brief Nobel note on the Fritz Lipmann Biography.
6.07: Key Words and Terms
Acetyl-S-coenzyme A (Ac-S-CoA)
free energy capture
phosphatase enzymes
ADP, ATP, GDP, GTP
fructose
phosphate-ester linkage
aerobic
G, G6P, F6P, F1,6-diP
redox reactions
anaerobic
gluconeogenesis
reducing agent
Atkins Diet
gluconeogenic amino acids
respiration
biochemical pathways
glycolysis
SDH (succinate dehydrogenase)
bioenergetics
glyoxalate cycle
spontaneous reaction
bypass reactions, enzymes
high energy bond (linkage)
stage 1
C6H12O6 (glucose)
high energy molecules
stage 2
cells as open systems
isomerase enzymes
standard conditions
Cori Cycle
kinase enzymes
steady state
dehydrogenase enzymes
Krebs (TCA, citric acid) cycle
stoichiometry of glycolysis
DHAP, G3P,1,3-diPG, 3PG, 2PG, PEP, Pyr
metabolic effects of low carb diet
substrate level phosphorylation
diabetes
metformin
Succinyl-S-CoA
energetics of glycolysis
mitochondria
super-catalyst
energy flow in cells
mutase enzymes
synthase enzymes
equilibrium
NAD+ (oxidized nicotinamide adenine di- Phosphate)
thioester linkage
FAD (oxidized nicotinamide adenine di- Phosphate)
NADH (reduced nicotinamide adenine di- Phosphate)
DG’ (actual free energy change)
FADH2 (reduced flavin adenine di-Phosphate)
nutrients
DGo (standard free energy change)
fermentation
oxidation, reduction
free energy
oxidizing agent | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/06%3A_Glycolysis_the_Krebs_Cycle_and_the_Atkins_Diet/6.06%3A_The_Krebs_TCA_Citric_acid_cycle.txt |
• 7.1: Introduction
We have seen that glycolysis generates two pyruvate molecules per glucose molecule, and that the subsequent oxidation of each pyruvate generates two Ac-S-CoA molecules. After the further oxidation of each Ac-S-CoA by the Krebs cycle, aerobic cells have captured about 30 Kcal out of the 687 Kcal potentially available from a mole of glucose in two molecules of ATP
• 7.2: The Electron Transport Chain (ETC)
All cells use an electron transport chain (ETC) to oxidize substrates in exergonic reactions. The electron flow from reduced substrates through an ETC is like the movement of electrons between the poles of a battery. In the case of the battery, the electron flow releases free energy to power a motor, light, cell phone, etc. In the mitochondrial ETC, electrons flow when the reduced electron (NADH, FADH2) are oxidized.
• 7.3: Oxidative Phosphorylation
Oxidative phosphorylation is the mechanism that by which ATP captures the free energy in the mitochondrial proton gradient. Most of the ATP made in aerobic organisms is made by oxidative phosphorylation, rather than by substrate phosphorylation (the mechanism of ATP synthesis in glycolysis or the Krebs cycle).
• 7.4: Photosynthesis
If respiration (reaction 1) is the complete oxidation of glucose to H2O and CO2, then photosynthesis (reaction 2) is the reduction of CO2 using electrons from H2O. Photosynthesis is thus an endergonic reaction. During photosynthesis, sunlight (specifically visible light), fuels the reduction of CO2 (summarized below)
• 7.5: More Thoughts on the Mechanisms and Evolution of Respiration and Photosynthesis
We can assume that the abundance of chemical energy on our cooling planet favored the formation of cells that could capture free energy from these nutrients in the absence of any oxygen. For a time, we thought that the first cells would have extracted nutrient free energy by non-oxidative, fermentation pathways. And they would have been voracious feeders, quickly depleting their environmental nutrient resources. In this scenario, the evolution of autotrophic life forms saved life from an early e
• 7.6: Key Words and Terms
Thumbnail: The electron transport chain in the cell is the site of oxidative phosphorylation in prokaryotes. The NADH and succinate generated in the citric acid cycle are oxidized, releasing energy to power the ATP synthase. (Public Domain; Fvasconcellos).
07: Electron Transport Oxidative Phosphorylation and Photosynthesis
We have seen that glycolysis generates two pyruvate molecules per glucose molecule, and that the subsequent oxidation of each pyruvate generates two Ac-S-CoA molecules. After the further oxidation of each Ac-S-CoA by the Krebs cycle, aerobic cells have captured about 30 Kcal out of the 687 Kcal potentially available from a mole of glucose in two molecules of ATP. Not much for all that biochemical effort! However, a total of 24 H+ (protons) pulled from glucose in redox reactions have also been captured, in the form or the reduced electron carriers NADH and FADH2. We begin here with a look at electron transport and oxidative phosphorylation, the linked (“coupled”) mechanism that transfers much of nutrient free energy into ATP. We will see that the free energy released by the transport of electrons from the reduced electron carriers is captured in a proton (H+) gradient. Then we’ll see how dissipation of this gradient releases free energy to fuel ATP synthesis by oxidative phosphorylation. Next, we will contrast mitochondrial oxidative phosphorylation with the substrate-level phosphorylation we saw in glycolysis and the Krebs cycle. After presenting an energy balance sheet for respiration, we look at how cells capture of free energy from alternate nutrients. Then we discuss photosynthesis (overall, the opposite of respiration) and conclude by comparing photosynthesis and respiration.
learning objectives
When you have mastered the information in this chapter, you should be able to:
1. explain the centrality of the Krebs Cycle to aerobic metabolism.
2. identify sources of electrons in redox reactions leading to and within the Krebs cycle.
3. illustrate the path of electrons from the Krebs cycle to and through the electron transport chain.
4. trace the evolution of the electron transport chain from its location on an aerobic bacterial membrane to its location in eukaryotic cells.
5. list the expected properties of a proton gate and a proton pump.
6. interpret experiments involving redox reactions, ATP synthesis and ATP hydrolysis conducted with intact mitochondria and separated mitochondrial membranes.
7. distinguish between the pH, H+ and electrical gradients established by electron transport.
8. explain the chemiosmotic mechanism of ATP synthesis and contrast it with substrate- level phosphorylation.
9. compare and contrast the role of electron transport in respiration and photosynthesis and discuss the evolution of each.
10. trace and explain the different paths that electrons can take in photosynthesis.
11. explain the presence of similar (or even identical) biochemical intermediates in respiration and photosynthesis. | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/07%3A_Electron_Transport_Oxidative_Phosphorylation_and_Photosynthesis/7.01%3A_Introduction.txt |
All cells use an electron transport chain (ETC) to oxidize substrates in exergonic reactions. The electron flow from reduced substrates through an ETC is like the movement of electrons between the poles of a battery. In the case of the battery, the electron flow releases free energy to power a motor, light, cell phone, etc. In the mitochondrial ETC, electrons flow when the reduced electron (NADH, FADH2) are oxidized. In plants and other photosynthetic organisms, an ETC serves to oxidize NADPH (a phosphorylated version of the electron carrier NADH). In both cases, free energy released when the redox reactions of an ETC are coupled to the active transport of protons (H+ ions) across a membrane. The result is a chemical gradient of H+ ions as well as a pH gradient. Since protons are charged, the proton gradient is also an electrical gradient. In a kind of shorthand, we say that the free energy once in reduced substrates is now in an electrochemical gradient. That gradient free energy is captured in ATP synthesis reactions coupled to the flow (diffusion) of protons back across the membrane in the process called oxidative phosphorylation. In aerobic respiration, electrons are ultimately transferred from components at the end of the ETC to a final electron acceptor molecular oxygen, O2, making water. In photosynthesis, electron transfer reduces CO2 to sugars.
The Chemiosmotic Mechanism explained how the creation of an electrochemical gradient and how gradient free energy ends up in ATP. For this insight, Peter Mitchell won the Nobel Prize in Chemistry in 1978. You can read Mitchell’s original proposal of the chemiosmosis model of mitochondrial ATP synthesis in Mitchell P (1961) Coupling of phosphorylation to electron and hydrogen transfer by a chemiosmotic type of mechanism. Nature 191:144-148. Here we focus on the details of respiration as it occurs in the mitochondria of eukaryotic cells. The end products of electron transport are NAD+, FAD, water and protons. The protons end up outside the mitochondrial matrix because they are pumped across the cristal membrane using the free energy of electron transport.
Electron transport and oxidative phosphorylation are summarized in the illustration below.
162 Finding the Free Energy of Electron Transport
163 Separating Electron Transport from Oxidative Phosphorylation
Roman numbered protein complexes along with Coenzyme Q (just “Q” in the drawing) and cytochrome C (Cyt c) constitute the ETC), the sequence of reactions that oxidize NADH or FADH2 to NAD+ and FAD (respectively). The electrons from these reduced electron carriers are transferred from one ETC complex to the next. At the end of chain, electrons, protons and oxygen unite in complex IV to make water. As you might expect, under standard conditions in a closed system, electron transport is downhill, with an overall release of free energy (negative DGo) at equilibrium.
In the illustration above, we can see three sites in the respiratory ETC that function as H+ pumps. At these sites, the negative change in free energy of electron transfer is large and coupled to the action of a pump. The result is that protons accumulate outside the matrix of the mitochondrion. Because the outer mitochondrial membrane is freely permeable to protons, the electrochemical gradient is in effect between the cytoplasm and the mitochondrial matrix. Proton flow back into the mitochondrial matrix through lollipop- shaped ATP synthase complexes releases the gradient free energy that is harnessed as chemical energy.
164 Proton Pumps Store Free Energy of the ETC in Proton Gradients | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/07%3A_Electron_Transport_Oxidative_Phosphorylation_and_Photosynthesis/7.02%3A_The_Electron_Transport_Chain_%28ETC%29.txt |
Oxidative phosphorylation is the mechanism that by which ATP captures the free energy in the mitochondrial proton gradient. Most of the ATP made in aerobic organisms is made by oxidative phosphorylation, rather than by substrate phosphorylation (the mechanism of ATP synthesis in glycolysis or the Krebs cycle). Some aerobic chemistry may have evolved in response to the toxic effects of rising environmental oxygen levels. Later elaboration of respiratory metabolism were undoubtedly selected because it turns out to be more efficient at making ATP than anaerobic fermentations such as ‘complete’ glycolysis. In other words, oxidative phosphorylation fueled by electron transport is more efficient that substrate-level phosphorylation. Oxidative phosphorylation couples controlled diffusion of protons through the cristal membrane ATP synthase to ATP production.
To summarize here, the movement of electrons down the electron transport chain fuels three proton pumps that establish a proton gradient across the cristal membrane that stores free energy. We say that the proton gradient has a proton-motive force, resulting from the difference in proton concentration (an H+ or pH gradient) and a difference in electric potential. The use of this force to make ATP is regulated.
Conditions in the cell control when the energy stored in this gradient will be released to make ATP. The switch that allows protons to flow across the cristal membrane to relieve the proton gradient is an ATP synthase, a tiny, complex enzymatic protein motor. For a clear discussion of this complex enzyme, see P. D. Boyer (1997) The ATP synthase – a splendid molecular machine. Ann. Rev. Biochem. 66:717-749.
The capture of free energy of protons flowing through the complex is summarized below.
In mitochondria, the protons pumped out of the mitochondrial matrix (using the free energy released by electron transport) can then flow back into the matrix through the ATP synthase. If the three ETC sites in the cristal membrane that actively transport protons are proton pumps, then the cristal membrane ATP synthase complexes function as regulated proton gates that catalyzes ATP synthesis when protons are allowed to flow through them. For their discovery of the details of ATP synthase function, P. D. Boyer and J. E. Walker shared the Nobel Prize in Chemistry in 1997.
165 Proton Gates Capture Proton Gradient Free Energy as ATP
The ratio of ATP to ADP concentrations regulates proton flow through the ATP synthase gates is regulated. A high ATP/ADP ratio in the mitochondrial matrix indicates that the cell does not need more ATP, closing the proton gate remains closed so that the proton gradient cannot be relieved. On the other hand, a low ATP/ADP ratio in the matrix means that the cell is hydrolyzing a lot of ATP…, and that the cell needs more. Then the proton gate opens, and protons flow through cristal membrane ATP synthases back into the matrix along a concentration gradient. As they flow, they release the free energy that powers a protein motor in the enzyme that in turn, activates ATP synthesis. Recall that according to the endosymbiotic theory, aerobic bacteria are the evolutionary ancestor to mitochondria; in fact, the cell membrane of aerobic bacteria house an ETC and chemiosmotic mechanism of ATP generation much like that in mitochondria.
Proton gradients do not only power ATP synthesis, but can also power cellular work quite directly. The well-known example is the bacterial flagellum driven directly by proton flow through cell membrane proton gate/molecular motor complex (below).
Electron transport in the cell membrane creates the gradient, and relief of the gradient directly powers the flagellum.
Just as we did for glycolysis, we can count the ATPs and see how much free energy we get from aerobic respiration, i.e., the complete oxidation of glucose. You can see this in the link below.
166 A Balance Sheet for Respiration | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/07%3A_Electron_Transport_Oxidative_Phosphorylation_and_Photosynthesis/7.03%3A_Oxidative_Phosphorylation.txt |
Chemically, photosynthesis is the reverse reaction of respiration. Compare the two reactions:
\[C6H12O6 + 6O2 ⇔ 6CO2 + 6H2O\] (DGo = -687Kcal/mole)
\[6CO2 + 6H2O ⇔ C6H12O6 + 6O2\] (DGo = +687Kcal/mole)
If respiration (reaction 1) is the complete oxidation of glucose to H2O and CO2, then photosynthesis (reaction 2) is the reduction of CO2 using electrons from H2O. Photosynthesis is thus an endergonic reaction. During photosynthesis, sunlight (specifically visible light), fuels the reduction of CO2 (summarized below).
Photosynthesis began in the absence of oxygen; it came before oxygenic respiration on earth. Increasing oxygen in the atmosphere led to selection of oxygenic respiratory pathways (the Krebs cycle, electron transport and oxidative phosphorylation). When we look at photosynthesis in some detail, we will see that photosynthesis and respiration have electron transport-ATP synthesizing systems with similar features. This suggests that they share a common evolutionary ancestry. Elsewhere, we will consider what a common ancestral system might have looked like. Two biochemical pathways make up photosynthesis:
· Light-dependent reactions that use visible light energy to remove electrons from water, reduce electron carriers, pump protons and make ATP;
· Light-independent reactions that use ATP to transfer electrons from the reduced electron carriers to CO2 to synthesize glucose.
The two pathways are summarized below.
A. The Light Dependent Reactions
Colored substances contain pigments that reflect the colors that we see and at the same time, absorb all the other colors of visible light. Early studies asked which plant pigments absorbed the light that allowed (we say supported) photosynthesis. Chlorophyll, the abundant pigment we see in plant tissues is actually two separate green pigments, chlorophyll a and chlorophyll b. One might therefore predict that light absorbed by chlorophyll will support photosynthesis, but light absorbed by other pigments in plant cells would not.
The experiment to test this hypothesis is illustrated below.
The action spectrum of photosynthesis below plots the results of this experiment.
The spectrum shows that all wavelengths of visible light energy support photosynthesis. In addition, other experiments revealed that radiation other than visible light (e.g., ultraviolet and infrared light) do not support photosynthesis. One can conclude that chlorophylls alone are likely not the only pigments to support photosynthesis.
Chlorophylls are easily purified from leaves. The graph below shows an average absorbance spectrum for of chlorophylls. The absorbance of chlorophyll a and chlorophyll b are slightly different, but center at wavelengths at 450 nm and 675 nm.
We can conclude from the absorbance spectra that chlorophylls do support photosynthesis, but that, indeed, they are not alone in doing so. Chlorophylls alone do not account for the action spectrum of photosynthesis! Clearly, other pigments absorbing elsewhere in the visible spectrum also support photosynthesis. Of course, we knew that leaves and other photosynthetic plant tissues contained a variety of different pigments, many of which we see as fall colors. All of these pigments (including chlorophylls) are found in the chloroplasts, the organelles that conduct photosynthesis in plants. Examine the structure of chloroplasts in the electron micrographs below.
The visible light absorbance spectra of three different kinds of plant pigments shown below do coincide with the action spectrum of photosynthesis. This implies that absorption of light by those pigments is responsible for photosynthesis.
Carotenoids, chlorophyll b and other accessory pigments participate in capturing light energy for photosynthesis. Two clusters of pigments capture light energy. These reaction centers are part of photosystems 1 and photosystem 2 on thylakoid membranes of chloroplasts. Johann Deisenhofer, Robert Huber and Hartmut Michel first determined the 3D structure of a bacterial reaction center. Then they and unraveled the relationship between the structure of the proteins in the center and the membrane in which they were embedded. For this, they shared the 1988 Nobel Prize in Chemistry.
The activities of Photosystem I are animated at Photosystem 1 Action. You should see light (a photon) excite electron (e-) pairs excited from Photosystem I pigments that then transfer their energy from pigment to pigment, ultimately to chlorophyll a P700. The impact of the electron pair then excites a pair of electrons from chlorophyll a P700. This e- pair is captured by a photosystem I (PSI) e- acceptor. Next, the reduced PSI acceptor is oxidized as electrons move down a short ETC, eventually reducing NADP+ to NADPH. Electrons on NADPH will eventually be used to reduce
CO2 to a carbohydrate. So far, so good! But that leaves an electron deficit in Photosystem I. The Z-Scheme illustrated below follows electrons taken from water (absorbed through roots) into photosystem II (PSII), which will replace those missing from PSI.
Let’s summarize the flow of electrons from water through the Z-scheme. Light excites an e- pair from the P680 form of chlorophyll a in PSII. A PSII electron acceptor in the thylakoid membrane, identified as pheophytin, captures these electrons. An electron transport chain oxidizes the pheophytin, transferring e- pairs down to PSI. Some of the free energy released pumps protons from the stroma into the space surrounded by the thylakoid membranes. The gradient free energy fuels ATP synthesis as protons flow back into the stroma through a chloroplast ATP synthase. The link at Action in the Z-Scheme animates the entire Z-Scheme, showing first how PSI electrons reduce NADP+ and then how PSII electrons replace missing PSI electrons, making ATP along the way. The oxygen released by splitting water ends up in the atmosphere.
B. Cyclic Photophosphorylation
The Z-Scheme does not in fact make enough ATP to power the Calvin Cycle. But when the need for ATP exceeds the capacity of the tissues to make sugar, the photosynthetic apparatus can take a time-out, resorting to Cyclic Photo- phosphorylation for a while. Cyclic Photophosphorylation simply takes electrons excited to the PSI electron acceptor, and instead of sending them to NADP+, deposits them on PC (plastocyanin) in the electron transport chain between PSII and PSI. These electrons then flow down this ‘long line’ of the Z, right back to PSI, releasing their free energy to make ATP. In light, the electrons just go up and around, hence the name Cyclic Photophosphorylation. The path of electrons is shown below and animated at Action in Cyclic Photophosphorylation.
C. The Light-Independent (“Dark”) Reactions
1. The Dark Reactions of C3 Photosynthesis
As we have seen, the light-dependent reactions of photosynthesis require light energy and water and generate O2, ATP and NADPH. In the light-independent (or dark’) reactions, the ATP and NADPH will provide free energy and electrons (respectively) for carbon fixation (the reduction of CO2 to make carbohydrates). CO2 enters photosynthetic tissues through stomata. Stomata are pores in leaves that can be open or closed, depending on light, temperature conditions and water availability. In addition to allowing CO2 into photosynthetic tissues, stomata also function in transpiration, which allows excess water in cells to leave the plants by transpiration (sometimes called evapotranspiration). C3 photosynthesis is the mechanism of carbon fixation in most plants, so called because its first carbohydrate product is a 3-C molecule, 3-phosphoglyceric acid (3-PG). You should recognize 3-PG; it is also a glycolytic intermediate. The Calvin Cycle is the most common dark reaction pathway. For its discoverer, M. Calvin received the Nobel Prize in Chemistry in 1961. The Calvin Cycle is shown below.
Check the animation at Action in the Calvin Cycle.
Each carbon dioxide entering the Calvin cycle is "fixed" to a 5-carbon ribulose bisphosphate molecule (RuBP), catalyzed by the enzyme RuBP carboxylase- oxygenase, or Rubisco for short. The expected 6-C molecule must be quickly split into two 3-C molecules since it has not been detected as an intermediate to date! The first detectable products are two molecules of 3-PG. Each 3-PG is in turn reduced to glyceraldehyde-3-phosphate (G-3-P, another familiar molecule).
The cycle regenerates the RuBP and produces glucose. Perhaps the easiest way to see this is to imagine the cycle going around 12 times, fixing 12 molecules of carbon dioxide, as shown in the link above. Two of the G-3-P molecules are linked together to make a single 6-C molecule of glucose (which is polymerized into starch for storage in daylight). That leaves 10 molecules of G-3-P, for a total of 30 carbons. The latter part of the cycle will regenerate 5 molecules of new RuBP, accounting for our 30 carbons!
2. Photorespiration
There are times that even plants in temperate environments suffer prolonged hot, dry spells. Perhaps you have seen a lawn grow more slowly and turn brown after a dry heat wave in summer, only to grow and re-green after the rains resume. C3 plants resort to photorespiration during drought and dry weather, closing their stomata to conserve water. Under these conditions, CO2 can’t get into the leaves… and O2 can’t get out! As CO2 levels drop and O2 rise in photosynthetic cells, the Calvin Cycle slows down. Instead of fixing CO2, the enzyme Rubisco now catalyzes “O2 fixation” using its oxygenase activity. The combination of RuBP with O2 splits RuBP into a 3-carbon and a 2-carbon molecule: 3-phosphoglyceric acid (3-PG) and phosphoglycolate respectively. The reaction is shown below.
Not only does photorespiration result in only one 3-carbon carbohydrate (compared to two in the Calvin Cycle), but the phosphoglycolate produced is cytotoxic (not healthy for cells!). Removing the phosphate and metabolizing the remaining glycolic acid costs energy. Therefore, photorespiration can only be sustained for a short time. On the other hand, plants that have adapted to live in hot arid environments all the time have evolved one of two alternate pathways. One is the CAM (Crassulacean Acid Metabolism); the other is the C4 pathway. Each is an alternative to C3 carbon fixation.
3. The CAM Photosynthetic Pathway
Crassulacean acid metabolism (CAM) was discovered in the Crassulaceae. These are succulents like sedum (a common ground cover), cactuses and jade plants, and some orchids. The CAM pathway was selected in evolution to allow plants to conserve water, especially during the high daytime temperatures. Stomata in chlorenchymal (mesophyll) leaf cells close during the day to minimize water loss by transpiration. The stomata open at night, allowing plant tissues to take up CO2. CAM plants fix CO2 by combining it with PEP (phosphoenol pyruvate). This eventually produces malic acid that is stored in plant cell vacuoles. By day, stored malic acid retrieved from the vacuoles splits into pyruvate and CO2. The CO2 then enters chloroplasts and joins the Calvin Cycle to make glucose and the starches. The CAM pathway is shown below.
In sum, CAM plant mesophyll cells
1. open stomata to collect, fix and store CO2 as an organic acid at night.
2. close stomata to conserve water in the daytime.
3. re-fix the stored CO2 as carbohydrate using the NADPH and ATP from the light reaction the next the day.
4. The C4 Photosynthetic Pathway
C4 refers to malic acid, the 4-carbon end product of CO2 fixation. In this regard, the C4 pathway is the same as in CAM metabolism! In both pathways, PEP carboxylase is the catalyst of carbon fixation, converting phosphoenol pyruvate (PEP) to oxaloacetate (OAA). The OAA is then reduced to malic acid, as shown below.
C4 metabolism diverges from CAM pathway after malic acid formation. PEP carboxylase catalysis is rapid in C4 plants, in part because malic acid does not accumulate in the mesophyll cells. Instead, it is rapidly transferred from mesophyll to adjacent bundle sheath cells, where it enters chloroplasts. The result is that C4 plants can keep stomata open for CO2 capture (unlike CAM plants), but closed at least part of the day to conserve water. The 4-carbon malic acid is oxidized to pyruvate (three carbons) in the bundle sheath cell chloroplasts. The CO2 released enters the Calvin cycle to be rapidly fixed by Rubisco. Of course, this system allows more efficient water use and faster carbon fixation under high heat, dry conditions than does C3 photosynthesis. Corn is perhaps the best-known C4 plant!
By the way, can you recognize several more intermediates common to respiration and the light-independent photosynthetic reactions? | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/07%3A_Electron_Transport_Oxidative_Phosphorylation_and_Photosynthesis/7.04%3A_Photosynthesis.txt |
We can assume that the abundance of chemical energy on our cooling planet favored the formation of cells that could capture free energy from these nutrients in the absence of any oxygen. For a time, we thought that the first cells would have extracted nutrient free energy by non-oxidative, fermentation pathways. And they would have been voracious feeders, quickly depleting their environmental nutrient resources. In this scenario, the evolution of autotrophic life forms saved life from an early extinction! That is because autotrophs could create organic molecules extracting free energy from inorganic molecules or from light.
An alternative scenario that is gaining traction, suggests that the first cells may have started with oxidative reactions that used something other than oxygen as a final electron acceptor. In this scenario (to be considered in more detail elsewhere), non-oxygenic ‘oxidative’ chemistries came first, followed by the evolution of anoxic fermentative chemistries, then followed by photosynthesis, and finally respiratory pathways. In either scenario, we can safely assume that photosynthesis existed before oxygenic respiration.
We also assume that oxygenic photoautotrophs that capture free energy from light would become the most abundant autotrophs, if for no other reason than sunlight is always available (at least during the day), and oxygen is abundant in the air! The early photoautotrophs were likely the ancestors of today’s cyanobacteria. In fact, a phylogenetic study of many genes including “plastid-encoded proteins, nucleus-encoded proteins of plastid origin…, as well as wide-ranging genome data from cyanobacteriasuggests a common ancestry of freshwater cyanobacteria and eukaryotic chloroplasts (Ponce-Toledo, R.I. et al., 2017, An Early-Branching Freshwater Cyanobacterium at the Origin of Plastids. Current Biology 27:386-391).
But what about the origins of respiratory metabolism and the endosymbiotic origins of mitochondria? Let’s start by asking how respiration co-opted photosynthetic electron transport reactions that captured the electrons from H2O needed to reduce CO2, turning those reactions to the task of burning sugars back to H2O and CO2. As photosynthetic organisms emerged and atmospheric oxygen increased, elevated oxygen levels would have been toxic to most living things. Still, some autotrophic cells must have had a pre- existing genetic potential to conduct detoxifying respiratory chemistry. These would have been facultative aerobes with the ability to switch from photosynthesis to respiration when oxygen levels rose. Today’s purple non-sulfur bacteria such as Rhodobacter sphaeroides are just such facultative aerobes! Perhaps we aerobes descend from the ancestors of such cells that survived and spread from localized environments where small amounts of oxygen threatened their otherwise strictly anaerobic neighbors. Is it possible that the endosymbiotic critter that became the first mitochondrion in a eukaryotic cell was not just any aerobic bacterium, but a purple photosynthetic bacterium?
7.06: Key Words and Terms
active transport of protons
energy efficiency of glucose metabolism
PEP carboxylase
ATP synthase
energy flow in glycolysis
pH gradient
bacterial flagellum
energy flow in the Krebs Cycle
pheophytin
C4 photosynthesis
F1 ATPase
photosynthesis
Calvin Cycle
FAD
Photosystems
CAM photosynthesis
FADH2
proton gate
carotene
Light-dependent reactions
proton gradient
chemiosmotic mechanism
Light-independent reactions
proton pump
Chlorophyll a
Malic acid
PSI electron acceptor
Chlorophyll b
mitochondria
PSII electron acceptor
molecular motor
redox reactions
complex I, II, III, IV
NAD+
reduced electron carriers
Crassulaceae
NADH
RUBISCO
cristal membrane
NADP+
RuBP
Cyclic photophosphorylation
NADPH
Splitting water
cytochromes
outer membrane
stoichiometry of glycolysis
Dark Reactions
oxidative phosphorylation
stoichiometry of the Krebs Cycle
electrochemical gradient
oxidative phosphorylation
substrate-level phosphorylation
electron transport
system (chain)
P680
Z-scheme
endosymbiotic theory
P700 | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/07%3A_Electron_Transport_Oxidative_Phosphorylation_and_Photosynthesis/7.05%3A_More_Thoughts_on_the_Mechanisms_and_Evolution_of_Respiration_and_P.txt |
• 8.1: Introduction
Here we look at classic experiments that led to our understanding that genes are composed of DNA. We already knew that genes were on chromosomes (chromo – colored; soma-body). Early 20th century gene mapping even showed the relative location (locus) of genes on chromosomes. Compared to eukaryotes, bacteria contain a very small amount of DNA per cell. Subsequent bacterial gene mapping and electron microscopy revealed that the E. coli “chromosome is little more than a small closed, circular DNA do
• 8.2: The Stuff of Genes
That all eukaryotic cells contain a nucleus was understood by the late 19th century. By then, histological studies had shown that nuclei contained largely proteins and DNA. At around the same time, the notion that the nucleus contains genetic information was gaining traction. In 1910, Albrecht Kossel received the 1910 Nobel Prize in Physiology or Medicine for his discovery of the adenine, thymine, cytosine and guanine (the four DNA bases), as well as of uracil in RNA.
• 8.3: DNA Structure
By 1878, a substance in the pus of wounded soldiers derived from cell nuclei (called nuclein) was shown to be composed of 5 bases (the familiar ones of DNA and RNA). The four bases known to make up DNA (as part of nucleotides) were thought to be connected through the phosphate groups in short repeating chains of four nucleotides. By the 1940s, we knew that DNA was a long polymer. Nevertheless, it was still considered too simple to account for genes.
• 8.4: Genes and Chromatin in Eukaryotes
Chromosomes and chromatin are a uniquely eukaryotic association of DNA with more or less protein. Bacterial DNA (and prokaryotic DNA generally) is relatively ‘naked’ – not visibly associated with protein. The electron micrograph of an interphase cell (below) reveals that the chromatin can itself exist in various states of condensation.
• 8.5: Structure and Organization of DNA in Bacteria
Sexual reproduction allows compatible genders (think male and female) to share genes, a strategy that increases species diversity. It turns out that bacteria and other single celled organisms can also share genes… and spread diversity. We will close this chapter with a look at sex (E. coli style!), and gene-mapping experiments showing linearly arranged genes on a circular bacterial DNA molecule (the bacterial ‘chromosome’).
• 8.6: Key Words and Terms
Thumbnail: DNA double helix. (public domain; NIH - Genome Research Institute).
08: DNA Chromosomes and Chromatin
Here we look at classic experiments that led to our understanding that genes are composed of DNA. We already knew that genes were on chromosomes (chromo – colored; soma-body). Early 20th century gene mapping even showed the relative location (locus) of genes on chromosomes. Compared to eukaryotes, bacteria contain a very small amount of DNA per cell. Subsequent bacterial gene mapping and electron microscopy revealed that the E. coli “chromosome is little more than a small closed, circular DNA double helix. In contrast, linear eukaryotic chromosomes are highly condensed structures composed of DNA and protein, visible only during mitosis or meiosis. During the much longer interphase portion of the eukaryotic cell cycle, chromosomes de-condense to chromatin, a less organized form of protein-associated DNA in the nucleus. Chromatin is the gatekeeper of gene activity in eukaryotic cells, a situation quite different from bacterial cells. Since we know that all cells of an organism contain the same DNA, and all cells must alter patterns of gene expression over time, understanding the structure and organization of DNA in cells is essential to an understanding of how and when cells turn genes on and off.
Learning Objectives
When you have mastered the information in this chapter, you should be able to:
1. summarize the evidence that led to acceptance that genes are made of DNA.
2. discuss how Chargaff’’s DNA base ratios support DNA as the “stuff of genes”.
3. interpret the results of Griffith, Avery et al. and Hershey & Chase, in historical context.
4. outline and explain how Watson and Crick built their model of a DNA double helix.
5. distinguish between conservative, semiconservative and dispersive replication.
6. describe and/or draw the progress of a viral infection.
7. trace the fate of 35SO4 (sulfate) into proteins synthesized in cultured bacteria.
8. distinguish between the organization of DNA in chromatin and chromosomes and speculate on how this organization impacts replication.
9. list some different uses of karyotypes.
10. compare and contrast euchromatin and heterochromatin structure and function.
11. outline an experiment to purify histone H1 from chromatin.
12. formulate an hypothesis to explain why chromatin is found only in eukaryotes.
13. describe the roles of different histones in nucleosome structure.
14. explain the role of Hfr strains in mapping genes in E. coli.
15. explain the chemical rationale of using different salt concentrations to extract 10 nm nucleosome fibers vs. 30nm solenoid structures from chromatin. | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/08%3A_DNA_Chromosomes_and_Chromatin/8.01%3A_Introduction.txt |
That all eukaryotic cells contain a nucleus was understood by the late 19th century. By then, histological studies had shown that nuclei contained largely proteins and DNA. At around the same time, the notion that the nucleus contains genetic information was gaining traction. In 1910, Albrecht Kossel received the 1910 Nobel Prize in Physiology or Medicine for his discovery of the adenine, thymine, cytosine and guanine (the four DNA bases), as well as of uracil in RNA. Mendel’s Laws of Inheritance, presented in 1865, were not widely understood, probably because they relied on a strong dose of arithmetic and statistics, when the utility of quantitative biology was not much appreciated. But, following the re-discovery three decades later, the number of known inherited traits in any given organism increased rapidly. At that time, DNA was known as a small, simple molecule, made up of only the four nucleotides (see DNA Structure below for additional historical perspective). So, the question was how could such a small, simple account for the inheritance of so many different physical traits? The recognition that enzyme activities were inherited in the same way as morphological characteristics led to the one- gene-one enzyme hypothesis that earned G. W. Beadle, E. L. Tatum and J. Lederberg the 1958 Nobel Prize for Physiology and Medicine. When enzymes were later shown to be proteins, the hypothesis became one-gene-one protein. When proteins were shown to be composed of one or more polypeptides, the final hypothesis became one-gene-one- polypeptide. However, this relationship between genes and proteins failed to shed any light on how DNA might be the genetic material. In fact, quite the contrary! As chains of up to 20 different amino acids, polypeptides and proteins had the potential for enough structural diversity to account for the growing number of heritable traits in a given organism. Thus, proteins seemed more likely candidates for the molecules of inheritance.
The experiments you will read about here began around the start of World War I and lasted until just after World War 2. During this time, we learned that DNA was no mere tetramer, but was in fact a long polymer. This led to some very clever experiments that eventually forced the scientific community to the conclusion that DNA, not protein, was the genetic molecule, despite being composed of just four monomeric units. Finally, we look at the classic work of Watson, Crick, Franklin and Wilkins that revealed the structure of the genetic molecule.
A. Griffith’s Experiment
Fred Neufeld, a German bacteriologist studying pneumococcal bacteria in the early 1900s discovered three immunologically different strains of Streptococcus pneumonia (Types I, II and III). The virulent strain (Type III) was responsible for much of the mortality during the Spanish Flu (influenza) pandemic of 1918-1920. This pandemic killed between 20 and 100 million people, many because the influenza viral infection weakened the immune system of infected individuals, making them susceptible to bacterial infection by Streptococcus pneumonia.
In the 1920s, Frederick Griffith was working with virulent wild type (Type III) and benign (Type II) strains of S. pneumonia. The two strains were easy to tell apart petri dishes because the virulent strain grew in morphologically smooth colonies, while the benign strain formed rough colonies. For this reason, the two bacterial strains were called S and R, respectively. We now know that S cells are coated with a polysaccharide (mucus) capsule, making colonies appear smooth. In contrast, R cell colonies look rough (don’t glisten) because they lack the polysaccharide coating.
Griffith knew that injecting mice with S cells killed them within about a day! Injecting the non-lethal R cells on the other hand, caused no harm. Then, he surmised that, perhaps, the exposure of mice to the R strain of S. pneumonia first would immunize them against lethal infection by S cells. His experimental protocol and results, published in 1928, are summarized below.
To test his hypothesis, Griffith injected mice with R cells. Sometime later, he injected them with S cells. However, the attempt to immunize the mice against S. pneumonia was unsuccessful! The control mice injected with S strain cells and the experimental mice that received the R strain cells first and then S cells, all died in short order! As expected, mice injected with R cells only survived.
Griffith also checked the blood of his mice for the presence of bacterial cells:
· Mice injected with benign R (rough) strain cells survived and after plating blood from the mice on nutrient medium, no bacterial cells grew.
· Many colonies of S cells grew from the blood of dead mice injected with S cells.
Griffith performed two other experiments, shown in the illustration:
1. He injected mice with heat-killed S cells; as expected, these mice survived. Blood from these mice contained no bacterial cells. This was “expected” since heating the S cells should have the same effect as pasteurization has on bacteria in milk!
2. Griffith also injected mice with a mixture of live R cells and heat-killed S cells, in the hope that the combination might induce immunity in the mouse where injecting the R cells alone had failed. You can imagine his surprise when, far from becoming immunized, the injected mice died and abundant S cells had accumulated in their blood.
Griffith realized that something important had happened in his experiments. In the mixture of live R cells and heat-killed S cells, something released from the dead S cells had transformed some R cells. Griffith named this “something” the transforming principle, a molecule present in the debris of dead S cells and sometimes acquired by a few live R cells, turning them into virulent S cells. We now know that R cells lack polysaccharide coat, and that the host cell’s immune system can attack and clear R cells before a serious infection can take hold.
B. The Avery-MacLeod-McCarty Experiment
Griffith didn’t know the chemical identity of the transforming principle. However, his experiments led to studies that proved DNA was the “stuff of genes”. With improved molecular purification techniques developed in the 1930s, O. Avery, C. MacLeod, and M. McCarty transformed R cells in vitro (that is, without the help of a mouse!). They purified heat-killed S-cell components (DNA, proteins, carbohydrates, lipids…) and separately tested the transforming ability of each molecular component on R cells in a test tube.
The experiments of Avery et al. are summarized below.
Since only the DNA fraction of the dead S cells could cause transformation, Avery et al. concluded that DNA must be the Transforming Principle. In spite of these results, DNA was not readily accepted as the stuff of genes. The sticking point was that DNA was composed of only four nucleotides. Even though scientists knew that DNA was a large polymer, they still thought of DNA as that simple molecule, for example a polymer made up of repeating sequences of the four nucleotides:
…AGCTAGCTAGCTAGCTAGCT…
Only the seemingly endless combinations of 20 amino acids in proteins promised the biological specificity necessary to account for an organism’s many genetic traits. Lacking structural diversity, DNA was explained as a mere scaffold for protein genes. To adapt Marshal McLuhan’s famous statement that the medium is the message (i.e., airwaves do not merely convey, but are the message), many still believed that proteins are the medium of genetic information as well as the functional message itself.
The reluctance of influential scientists of the day to accept a DNA transforming principle deprived its discoverers of the Nobel Prize stature it deserved. After new evidence made further resistance to that acceptance untenable, even the Nobel Committee admitted that failure to award a Nobel Prize for the discoveries of Avery et al. was an error. The key experiments of Alfred Hershey and Martha Chase finally put to rest any notion that proteins were genes.
167 Transformation In & Out of Mice; Griffith, McCarthy et al.
C.The Hershey-Chase Experiment
Biochemically, bacterial viruses were known consist of DNA enclosed in a protein capsule. The life cycle of bacterial viruses (bacteriophage, or phage for short) begins with infection of a bacterium, as illustrated below.
Phages are inert particles until they bind to and infect bacterial cells. Phage particles added to a bacterial culture could be seen attach to bacterial surfaces in an electron microscope. Investigators found that they could detach phage particles from bacteria by agitation in a blender (similar to one you might have in your kitchen). Centrifugation then separated the bacterial cells in a pellet at the bottom of the centrifuge tube, leaving the detached phage particles in the supernatant. By adding phage to bacteria and then detaching the phage from the bacteria at different times, it was possible to determine how long it the phage had to remain attached before the bacteria become infected. It turned out that pelleted cells that had been attached to phage for short times would survive and reproduce when re-suspended in growth medium. But pelleted cells left attached to phage for longer times had become infected; centrifugally separated from the detached phage and resuspended in fresh medium, these cells would go on and lyse, producing new phage. Therefore, the transfer of genetic information for virulence from virus to phage took some time. The viral genetic material responsible for infection and virulence was apparently no longer associated with the phage capsule, which could be recovered from the centrifugal supernatant.
Alfred Hershey and Martha Chase designed an experiment to determine whether the DNA enclosed by the viral protein capsule or the capsule protein itself caused phage to infect the bacterium. In the experiment, they separately grew E. coli cells infected with T2 bacteriophage in the presence of either 32P or 35S (radioactive isotopes of phosphorous and sulfur, respectively). The result was to produce phage that contained either radioactive DNA or radioactive proteins, but not both (recall that only DNA contains phosphorous and only proteins contain sulfur). They then separately infected fresh E. coli cells with either 32P- or 35S-labeled, radioactive phage. Their experiment is described below.
Phage and cells were incubated with either 32P or 35S just long enough to allow infection. Some of each culture was allowed to go on and lyse to prove that the cells were infected. The remainder of each mixture was sent to the blender. After centrifugation of each blend, the pellets and supernatants were examined to see where the radioactive proteins or DNA had gone. From the results, the 32P always ended up in the pellet of bacterial cells while the 35S was found in the phage remnant in the supernatant. Hershey and Chase concluded that the genetic material of bacterial viruses was DNA and not protein, just as Avery et al. had suggested that DNA was the bacterial transforming principle.
Given the earlier resistance to “simple” DNA being the genetic material, Hershey and Chase used cautious language in framing their conclusions. They need not have; all subsequent experiments confirmed that DNA was the genetic material. Concurrent with these confirmations were experiments demonstrating that DNA might not be (indeed, was not) such a simple, uncomplicated molecule! For their final contributions to pinning down DNA as the “stuff of genes”, Alfred D. Hershey shared the 1969 Nobel Prize in Physiology or Medicine with Max Delbruck and Salvador E. Luria.
168 Hershey and Chase: Viral Genes are in Viral DNA | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/08%3A_DNA_Chromosomes_and_Chromatin/8.02%3A_The_Stuff_of_Genes.txt |
A. Early Clues and Ongoing Misconceptions
By 1878, a substance in the pus of wounded soldiers derived from cell nuclei (called nuclein) was shown to be composed of 5 bases (the familiar ones of DNA and RNA). The four bases known to make up DNA (as part of nucleotides) were thought to be connected through the phosphate groups in short repeating chains of four nucleotides. By the 1940s, we knew that DNA was a long polymer. Nevertheless, it was still considered too simple to account for genes (see above). After the Hershey and Chase experiments, only a few holdouts would not accept DNA as the genetic material. So, the question remaining was how such a “simple” molecule could account for all the genes, even in so simple an organism as a bacterium. The answer to this question was to lie at least in part in an understanding of the physical structure of DNA, made possible by the advent of X-Ray Crystallography.
If a substance can be crystallized, the crystal will diffract X-rays at angles revealing regular (repeating) structures of the crystal. William Astbury demonstrated that high molecular weight DNA had just such a regular structure. His crystallographs suggested DNA to be a linear polymer of stacked bases (nucleotides), each nucleotide separated from the next by 0.34 nm. Astbury is also remembered for coining the term “molecular biology” to describe his studies. The term now covers as all aspects of biomolecular structure, as well as molecular functions (e.g. replication, transcription, translation, gene regulation…).
In an irony of history, the Russian biologist Nikolai Koltsov had already intuited in 1927 that the basis of genetic transfer of traits would be a "giant hereditary molecule" made up of "two mirror strands that would replicate in a semi-conservative fashion using each strand as a template". A pretty fantastic inference if you think about it since it was proposed long before Watson and Crick and their colleagues worked out the structure of the DNA double-helix!
B. Wilkins, Franklin, Watson & Crick
Maurice Wilkins, an English biochemist, was the first to isolate highly pure, high molecular weight DNA. Working in Wilkins laboratory, Rosalind Franklin was able to crystalize this DNA and produce very high-resolution X-Ray diffraction images of the DNA crystals. Franklin’s most famous (and definitive) crystallography was “Photo 51”, shown below.
This image confirmed Astbury’s 0.34 nm repeat dimension and revealed two more numbers, 3.4 nm and 2 nm, reflecting additional repeat structures in the DNA crystal. When James Watson and Francis Crick got hold of these numbers, they used them along with other data to build DNA models out of nuts, bolts and plumbing. Their models eventually revealed DNA to be a pair of antiparallel complementary of nucleic acid polymers…, shades of Koltsov’s mirror-image macromolecules! Each strand is a string of nucleotides linked by phosphodiester bonds, the two strands held together in a double helix by complementary H-bond interactions.
Let’s look at the evidence for these conclusions and as we do, refer to the two illustrations of the double helix below.
Recalling that Astbury’s 0.34 nm dimension was the distance between successive nucleotides in a DNA strand, Watson and Crick surmised that the 3.4 nm repeat was a structurally meaningful 10-fold multiple of Astbury’s number. When they began building their DNA models, they realized from the bond angles connecting the nucleotides that the strand was forming a helix, from which they concluded that the 3.4 nm repeat was the pitch of the helix, i.e., the distance of one complete turn of the helix. This meant that there were 10 bases per turn of the helix. They further reasoned that the 2.0 nm number might reflect the diameter of helix. When their scale model of a single stranded DNA helix predicted a helical diameter much less than 2.0 nm, they were able to model a double helix that more nearly met the 2.0 nm diameter requirement. In building their double helix, Watson and Crick realized that bases in opposing strands would come together to form H-bonds, holding the helix together. However, for their double helix to have a constant diameter of 2.0 nm, they also realized that the smaller pyrimidine bases, Thymine (T) and Cytosine (C), would have to H-bond to the larger purine bases, Adenine (A) and Guanosine (G).
Now to the question of how a “simple” DNA molecule could have the structural diversity needed to encode thousands of different polypeptides and proteins. In early studies, purified E. coli DNA was chemically hydrolyzed down to nucleotide monomers. The hydrolysis products contained nearly equal amounts of each base, reinforcing the notion that DNA was that simple molecule that could not encode genes. But Watson and Crick had private access to revealing data from Erwin Chargaff. Chargaff had determined the base composition of DNA isolated from different species, including E. coli. He found that the base composition of DNA from different species was not always equimolar, meaning that for some species, the DNA was not composed of equal amounts of each of the four bases (see some of this data below).
The mere fact that DNA from some species could have base compositions that deviated from equimolarity put to rest the argument that DNA had to be a very simple sequence. Finally, it was safe to accept that to accept the obvious, namely that DNA was indeed the “stuff of genes”.
Chargaff’s data also showed a unique pattern of base ratios. Although base compositions could vary between species, the A/T and G/C ratio was always one, for every species. Likewise the ratio of (A+C)/(G+T) and (A+G)/(C+T). From this information, Watson and Crick inferred that A (a purine) would H-bond with T (a pyrimidine), and G (a purine) would H-bond with C (a pyrimidine) in the double helix. When building their model with this new information, they also found H-bonding between the complementary bases would be maximal only if the two DNA strands were antiparallel, leading to the most stable structure of the double helix.
Watson and Crick published their conclusions about the structure of DNA in 1953 (Click here to read their seminal article: Molecular Structure of Nucleic Acids: A Structure for Deoxyribose Nucleic Acid. Their article is also famous for predicting a semi-conservative mechanism of replication, something that had been predicted by Koltsov 26 years earlier, albeit based on intuition… and much less evidence!
Watson, Crick and Wilkins shared a Nobel Prize in 1962 for their work on DNA structure. Unfortunately, Franklin died in 1958 and Nobel prizes were not awarded posthumously. There is still controversy about why Franklin did not get appropriate credit for her role in the work. But she has been getting well-deserved, long-delayed recognition, including a university in Chicago named in her honor!
169 Unraveling the Structure of DNA
Confirmation of Watson & Crick’s suggestion of semiconservative replication came from Meselson and Stahl’s very elegant experiment, which tested the three possible models of replication shown below.
In their experiment, E. coli cells were grown for in medium containing 15N, a ‘heavy’ nitrogen isotope. After many generations, all of the DNA in the cells had become labeled with the heavy isotope. At that point, the 15N-tagged cells were placed back in medium containing the more common, ‘light’ 14N isotope and allowed to grow for exactly one generation.
Meselson and Stahl’s predictions and their experimental design are shown below.
Meselson and Stahl knew that 14N-labeled and 15N-labeled DNA would form separate bands after centrifugation on CsCl chloride density gradients. They tested their predictions by purifying and centrifuging the DNA from the 15N-labeled cells grown in 14N medium for one generation. They found that this DNA formed a single band with a density between that of 15N-labeled DNA and 14N-labeled DNA. This result eliminated a conservative model of DNA replication (as Watson and Crick also predicted. That left two possibilities: replication was either semiconservative or dispersive. The dispersive model was eliminated when DNA isolated from cells grown for a 2nd generation on 14N were shown to contain two bands of DNA on the CsCl density gradients.
170 Replication is Semiconservative
Chromosomes
We understood from the start of the 20th century that chromosomes contained genes. Therefore, it becomes necessary to understand the relationship between chromosomes, chromatin, DNA and genes. As noted earlier, chromosomes are a specialized, condensed version of chromatin, with key structural features shown below.
We now know that the compact structure of a chromosome prevents damage to the DNA during cell division. This damage can occur when forces on centromeres generated by mitotic or meiotic spindle fibers pull chromatids apart. As the nucleus breaks down during mitosis or meiosis, late 19th century microscopists saw chromosomes condense from the dispersed cytoplasmic background. These chromosomes remained visible as they separated, moving to opposite poles of the cell during cell division. Such observations of chromosome behavior during cell division pointed to their role in heredity. A computer- colorized cell in mitosis is shown below.
It is possible to distinguish one chromosome from another by karyotyping. When cells in metaphase of mitosis are placed under pressure, they burst and the chromosomes spread apart. Such a chromosome spread is shown below.
By the early 1900s, the number, sizes and shapes of chromosomes were shown to be species-specific. What’s more, a close look at chromosome spreads revealed that chromosomes came in morphologically matched pairs. This was so reminiscent of Gregor Mendel’s paired hereditary factors that chromosomes were then widely accepted as the structural seat of genetic inheritance. Cutting apart micrographs like the one above and pairing the chromosomes by their morphology generates a karyotype. Paired human homologs are easily identified in the colorized micrograph below.
Captured in mitosis, all dividing human cells contain 23 pairs of homologous chromosomes. The karyotype is from a female; note the pair of homologous sex (“X”) chromosomes (lower right of the inset). X and Y chromosomes in males are not truly homologous. Chromosomes in the original spread and in the aligned karyotype stained with fluorescent antibodies to chromosome-specific DNA sequences, ‘light up’ the different chromosomes.
171 DNA, Chromosomes, Karyotypes & Gene Maps | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/08%3A_DNA_Chromosomes_and_Chromatin/8.03%3A_DNA_Structure.txt |
Chromosomes and chromatin are a uniquely eukaryotic association of DNA with more or less protein. Bacterial DNA (and prokaryotic DNA generally) is relatively ‘naked’ – not visibly associated with protein.
The electron micrograph of an interphase cell (below) reveals that the chromatin can itself exist in various states of condensation.
Chromatin is maximally condensed during mitosis, forming chromosomes. During interphase, chromatin exists in more or less condensed forms, called Heterochromatin and euchromatin respectively. Transition between these chromatin forms involve changes in the amounts and types of proteins bound to the chromatin, and can that can occur during gene regulation, i.e., when genes are turned on or off. Active genes tend to be in the more dispersed euchromatin so that enzymes of replication and transcription have easier access to the DNA. Genes that are inactive in transcription are heterochromatic, obscured by additional chromatin proteins present in heterochromatin. We’ll be looking at some experiments that demonstrate this in a later chapter.
We can define three levels of chromatin organization in general terms:
1. DNA wrapped around histone proteins form nucleosomes in a "beads on a string" structure.
2. Multiple nucleosomes coil (condense), forming 30 nm fiber (solenoid) structures.
3. Higher-order packing of the 30 nm fiber leads to formation of metaphase chromosomes seen in mitosis & meiosis.
The levels of chromatin structure were determined in part by selective isolation and extraction of interphase cell chromatin, followed by selective chemical extraction of chromatin components. The steps are:
· Nuclei are first isolated from the cells.
· The nuclear envelope gently ruptured so as not to physically disrupt chromatin structure.
· the chromatin can be gently extracted by one of several different chemical treatments (high salt, low salt, acid...).
The levels of chromatin structure are illustrated below.
Salt extraction dissociates most of the proteins from the chromatin. When a low salt extract is centrifuged and the pellet resuspended, the remaining chromatin looks like beads on a string. DNA-wrapped nucleosomes are the beads, which are in turn linked by uniform lengths of metaphorical DNA “string’ ( # 1 in the illustration above). A high salt chromatin extract appears as a coil of nucleosomes, or 30 nm solenoid fiber (# 2 above). Other extraction protocols revealed other aspects of chromatin structure shown in #s 3 and 4 above. Chromosomes seen in metaphase of mitosis are the ‘highest order’, most condensed form of chromatin.
The 10 nm filament of nucleosome ‘beads-on-a-string’ remaining after a low salt extraction can be seen in an electron microscope as shown below.
When these nucleosome necklaces were digested with the enzyme deoxyribonuclease (DNAse), the DNA between the ‘beads’ was degraded, leaving behind shortened 10nm filaments after a short digest period, or just single beads the beads after a longer digestion (below).
Roger Kornberg (son of Nobel Laureate Arthur Kornberg who discovered the first DNA polymerase enzyme of replication) participated in the discovery and characterization of nucleosomes while he was still a post-doc! Electrophoresis of DNA extracted from these digests revealed nucleosomes separated by a “linker” DNA stretch of about 80 base pairs. DNA extracted from the nucleosomes was about 147 base pairs long. This is the DNA that had been wrapped around the proteins of the nucleosome.
172 Nucleosomes-DNA & Protein
After separating all of the proteins from nucleosomal DNA, five proteins were identified (illustrated below).
Histones are basic proteins containing many lysine and arginine amino acids. Their positively charged side chains enable these amino acids bind the acidic, negatively charged phosphodiester backbone of double helical DNA. The DNA wraps around an octamer of histones (2 each of 4 of the histone proteins) to form the nucleosome. About a gram of histones is associated with each gram of DNA. After a high salt chromatin extraction, the structure visible in the electron microscope is the 30nm solenoid, the coil of nucleosomes modeled in the figure below.
As shown above, simply increasing the salt concentration of an already extracted nucleosome preparation will cause the ‘necklace’ to fold into the 30nm solenoid structure.
173 Chromatin Structure: Dissecting Chromatin
As you might guess, an acidic extraction of chromatin should selectively remove the basic histone proteins, leaving behind an association of DNA with non-histone proteins. This proved to be the case. An electron micrograph of the chromatin remnant after an acid extraction of metaphase chromosomes is shown on the next page.
DNA freed of the regularly spaced histone-based nucleosomes, loops out, away from the long axis of the chromatin. Dark material along this axis is a protein scaffolding that makes up what’s left after histone extraction. Much of this protein is topoisomerase, an enzyme that prevents DNA from breaking apart under the strain of replication.
174 Histones and Non-Histone Proteins | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/08%3A_DNA_Chromosomes_and_Chromatin/8.04%3A_Genes_and_Chromatin_in_Eukaryotes.txt |
Sexual reproduction allows compatible genders (think male and female) to share genes, a strategy that increases species diversity. It turns out that bacteria and other single celled organisms can also share genes… and spread diversity. We will close this chapter with a look at sex (E. coli style!), and gene-mapping experiments showing linearly arranged genes on a circular bacterial DNA molecule (the bacterial ‘chromosome’).
E. coli sex begins when F+ and F- cells meet. These cells are “opposite” mating types that can share DNA during conjugation. F+ cells contain the F plasmid, a small circular DNA molecule that is separate from the E. coli chromosome. The F (fertility) plasmid has genes that encode sex pili on F+, as well as factors needed to form a mating bridge, or conjugation tube. The behavior of the F plasmid during conjugation is shown below.
When an F+ (donor) cell encounters an F- (recipient) cell, sex pili on the donor cell initiate recognition. Next, a conjugation tube forms, linking the cytoplasms of the two cells. After nicking one strand of the F plasmid DNA, the nicked begins to roll into the conjugation tube and into the recipient (F-) cell. The DNA strand entering the recipient cell replicates, as does the intact circle remaining in the donor cell (replicating DNA is shown in red in the illustration).
E. coli conjugation can have different outcomes:
1. One outcome is that one of two semi-conservatively replicated F plasmids remains in the donor cell and another is now in the recipient cell. In this case, the recipient cell becomes a new F+ donor cell!
2. The other outcome is integration of the F plasmid into recipient cell chromosomal DNA. Insertion is typically at specific sites in the DNA where there is sufficient sequence similarity between the plasmid and chromosomal DNA to allow insertion by recombination. The result is that the recipient cell becomes an Hfr (High-frequency recombination) cell. This cell will produce Hfr strain progeny cells.
These two possible results of conjugation in E. coli are illustrated below.
Hfr cells readily express their integrated F plasmid genes, and like F+ cells, develop sex pili and form a conjugation tube with an F- cell. One strand of the bacterial chromosomal DNA will be nicked at the original insertion site of the F plasmid.
The next events parallel the replicative transfer of an F plasmid during F+/F- conjugation, except that only part of the Hfr donor chromosomal DNA is transferred, as shown below.
In this illustration, the F plasmid has inserted ‘in front of’ an A gene so that when it enters the conjugation tube, it brings along several E. coli chromosomal genes Because of the size of the bacterial chromosome, only a few bacterial genes enter the recipient gene before transfer is aborted. But in the brief time of DNA transfer, at least some genes did get in to the recipient F- strain where they can be expressed. Here is an outline of an experiment that allowed mapping bacterial genes on a circular DNA chromosome:
1. Hfr cells containing functional A, B, C, D genes were mated with recipient cells containing mutants of either the A, the B, the C or the D gene.
2. Conjugation was mechanically disrupted at different times after the formation of a conjugation tube.
3. Recipient cells from each of the disrupted conjugations were then grown in culture and analyzed for specific gene function.
In this hypothetical example, the results were that a recipient cell with a mutant A gene acquired a wild type A gene (and therefore A-gene function) after a short time before conjugation disruption. Progressively longer times of conjugation (measured in separate experiments) were required to transfer gens B, C and D (respectively) to the recipient cell. Thus the order of these genes on the bacterial chromosome was
-A-B-C-D-
The timing of conjugation that led to F- mutants acquiring a functional gene from the Hfr strain was so refined that not only could the gene locus be determined, but even the size ) length) of the genes! Thus, the time to transfer a complete gene to an F- cell reflects the size (length) of the gene. The other important conclusion is that genes are arranged linearly on bacterial DNA.
Recall that genes already mapped along the length of eukaryotic chromosomes implied a linear order of the genes. However, little was known about eukaryotic chromosome structure at the time, and the role of DNA as the ‘stuff of genes’ was not appreciated. These bacterial mating experiments demonstrated for the first time that genes are linearly arranged not just along a chromosome, but also along the DNA molecule.
Over time, many bacterial genes were mapped all along the E. coli chromosome by isolating many different Hfr strains in which an F plasmid had inserted into different sites around the DNA circle. These Hfr strains were mated to F- bacteria, each with mutations in one or another known bacterial gene. As in the original ‘ABCD’ experiment, the order of many genes was determined, and even shown to be linked at a greater or lesser distance to those ABCD genes and each other.
The map that results from such a study is diagrammed below.
Using the different Hfr strains (numbered in the diagram) in conjugation experiments, it was shown that in fact, the different Hfr cells transferred different genes into the recipient cells in the order implied by the diagram. What’s more, when the experiment was done with Hfr4 (in this generic diagram); the order of genes transferred after longer times of conjugation was found to be:
V-W-X-Y-Z-A-B….
The obvious conclusion from experiments like these was that the E. coli DNA molecule (its ‘chromosome’) was a closed circle! We will see visual evidence of circular E. coli chromosomes in the next chapter, with some discussion of how this evidence informed our understanding of DNA replication.
8.06: Key Words and Terms
10 nm fiber
double helix
mutations
30 nm fiber
euchromatin
non-histone proteins
5' -to-3' replication
F and Hfr plasmids
nuclear proteins
antiparallel DNA strands
F- strain
nucleosomes
bacterial conjugation
F+ strain
recipient cell
base ratios
fertility plasmid
replication
beads-on-a-string
heterochromatin
S. pneumonia type III-S
chromatin
Hfr strain
S. pneumonia type II-R
chromosomes
histone octamer
semi-conservative replication
conjugation tube
histone proteins
sex pili
conservative replication
influenza
solenoid fiber
deoxyribonuclease
karyotype
spindle fibers
discontinuous replication
levels of chromatin packing
transforming principle
dispersive replication
mating bridge
X & Y chromosomes
DNA
metaphase chromatin
X-ray crystallography
donor cell
mitosis & meiosis
X-ray diffraction | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/08%3A_DNA_Chromosomes_and_Chromatin/8.05%3A_Structure_and_Organization_of_DNA_in_Bacteria.txt |
• 9.1: Introduction
Replication begins at one or more origins of replication along DNA, where helicase enzymes catalyze unwinding of the double helix. DNA unwinding creates replicating bubbles, or replicons, with replication forks at either end. Making a new DNA strand starts with making an RNA primer with RNA nucleotides and primase enzymes.
• 9.2: DNA Replication
As we’ve seen, DNA strands have directionality, with a 5’ nucleotide-phosphate and a 3’ deoxyribose hydroxyl end. This is even true for circular bacterial chromosomes…, if the circle is broken! Because the strands of the double helix are antiparallel, the 5’ end of one strand aligns with the 3’end of the other at both ends of the double helix. The complementary pairing of bases in DNA means that the base sequence of one strand can be used as a template to make a new complementary strand. As we’l
• 9.3: DNA Repair
We generally accept the notion that replication faithfully duplicates the genetic material. At the same time, evolution would not be possible without mutation, and mutation is not possible without at least some adverse consequences. Germline mutations are heritable. When present in one, but especially in both alleles of a gene, such mutations can result in genetic disease (e.g., Tay-Sach’s disease, cystic fibrosis, hemophilia, sickle-cell anemia, etc.).
• 9.4: Key Words and Terms
09: Details of DNA Replication and Repair
Replication begins at one or more origins of replication along DNA, where helicase enzymes catalyze unwinding of the double helix. DNA unwinding creates replicating bubbles, or replicons, with replication forks at either end. Making a new DNA strand starts with making an RNA primer with RNA nucleotides and primase enzymes. DNA nucleotides are then added to the 3’-ends of primers by one a DNA polymerase. Later, other DNA polymerases catalyze removal of the RNA primers and replacement of the hydrolyzed ribonucleotides with new deoxyribonucleotides. Finally, DNA ligases stitch together the fragments of new DNA synthesized at the replication forks. This complex mechanism is common to the replication of ‘naked’ prokaryotic DNA and of chromatinencased eukaryotic DNA, and must therefore have arisen early in the evolution of replication biochemistry. In this chapter, we look at the details of replication and the differences in detail between prokaryotic and eukaryotic replication that arise because of differences in DNA packing. As with any complex process with many moving parts, replication is error-prone. Therefore, we will also look at how the overall fidelity of replication relies mechanisms of DNA repair that target specific kinds of replication mistakes, or mutations. At the same time, lest we think that uncorrected errors in replication are always a bad thing, they usually do not have bad outcomes. Instead, they leave behind the very mutations that allow natural selection and the evolution of diversity.
Learning Objectives
1. Explain how Cairns interpreted his theta (\(\Theta \)) images.
2. Compare and contrast the activities of enzymes required for replication.
3. Describe the order of events at an origin of replication and at each replication fork.
4. Compare unidirectional and bidirectional DNA synthesis from an origin of replication.
5. Outline the basic synthesis and proofreading functions of DNA polymerase.
6. Identify the major players and their roles in the initiation of replication.
7. Explain how Okazaki’s experimental results were not entirely consistent with how both strands of DNA replicate
8. List the major molecular players (enzymes, etc.) that elongate a growing DNA strand.
9. List the non-enzymatic players in replication and describe their functions.
10. Describe how the structure of telomerase enables proper replication.
11. Compare the activities of topoisomerases 1 and 2.
12. Explain the reasoning behind the hypothesis of processive replication.
13. Compare and contrast the impacts of germline and somatic mutations.
14. Describe common forms of DNA damage.
15. List enzymes of replication that were adapted to tasks of DNA repair.
16. Explain why a DNA glycosylase is useful in DNA repair.
17. Explain why the connection between 'breast cancer genes' and DNA repair. | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/09%3A_Details_of_DNA_Replication_and_Repair/9.01%3A_Introduction.txt |
As we’ve seen, DNA strands have directionality, with a 5’ nucleotide-phosphate and a 3’ deoxyribose hydroxyl end. This is even true for circular bacterial chromosomes…, if the circle is broken! Because the strands of the double helix are antiparallel, the 5’ end of one strand aligns with the 3’end of the other at both ends of the double helix. The complementary pairing of bases in DNA means that the base sequence of one strand can be used as a template to make a new complementary strand. As we’ll see, this structure of DNA created some interesting dilemmas for understanding the biochemistry of replication. The puzzlement surrounding how replication proceeds begins with experiments that visualize replicating DNA.
A. Visualizing Replication and Replication Forks
Recall the phenomenon of bacterial conjugation allowed a demonstration bacterial chromosomes were circular. In 1963, John Cairns confirmed this fact by direct visualization of bacterial DNA. He cultured E. coli cells for long periods on 3Hthymidine (3H-T) to make all of their cellular DNA radioactive. He then disrupted the cells gently to minimize damage to the DNA. The DNA released was allowed to settle and adhere to membranes. A sensitive film was placed over the membrane and time was allowed for the radiation to expose the film. After Cairns developed the autoradiographs, he examined the results in the electron microscope. He saw tracks of silver grains in the autoradiographs (the same kind of silver grains that create an image on film in old-fashioned photography). Look at the two drawings of his autoradiographs on the next page.
Cairns measured the length of the “silver” tracks, which usually consisted of three possible closed loops, or circles. The circumferences of two of these circles were always equal, their length closely predicted by the DNA content of a single, nondividing cell. Cairns therefore interpreted these images to be bacterial DNA in the process of replication. Cairns’ autoradiographs and the measurements that led him to conclude that he was looking at images of bacterial circular chromosomes are illustrated below.
He arranged his autoradiograph images in a sequence (below) to make his point.
Because the replicating chromosomes looked (vaguely!) like the Greek letter $\theta$, Cairns called them theta images. He inferred that replication starts at a single origin of replication on the bacterial chromosome, proceeding around the circle to completion.
175 Seeing E.Coli Chromosomes
Subsequent experiments by David Prescott demonstrated bidirectional replication…, that replication did indeed begin at an origin of replication, after which the double helix was unwound and replicated in both directions, away from the origins, forming two replication forks (illustrated below).
176 Semiconservative Bidrectional Replication From Two RFs
Bacterial cells can divide every hour (or even less); the rate of bacterial DNA synthesis is about 2 X 106 base pairs per hour. A typical eukaryotic cell nucleus contains thousands of times as much DNA as a bacterium, and typical eukaryotic cells double every 15-20 hours. Even a small chromosome can contain hundreds or thousands of times as much DNA as a bacterium. It appeared that eukaryotic cells could not afford to double their DNA at a bacterial rate of replication! Eukaryotes solved this problem not by evolving a faster biochemistry of replication, but by using multiple origins of replication from which DNA synthesis proceeds in both directions. This results in the creation of multiple replicons.
Each replicon enlarges, eventually meeting other growing replicons on either side to replicate most of each linear chromosome, suggested in the illustration below.
Before we consider the biochemical events at replication forks in detail, let's look at the role of DNA polymerase enzymes in the process.
177 Multiple Replicons in Eukaryotes
B. DNA Polymerases Catalyze Replication
The first of these enzymes was discovered in E. coli by Arthur Kornberg, for which he received the 1959 Nobel Prize in Chemistry. Thomas Kornberg, one of Arthur’s sons later found two more of DNA polymerases! All DNA polymerases require a template strand against which to synthesize a new complementary strand. They all grow new DNA by adding to the 3’ end of the growing DNA chain in successive condensation reactions. And finally, all DNA polymerases also have the odd property that they can only add to a pre-existing strand of nucleic acid, raising the question of where the ‘preexisting’ strand comes from! DNA polymerases catalyze the formation of a phosphodiester linkage between the end of a growing strand and the incoming nucleotide complementary to the template strand. The energy for the formation of the phosphodiester linkage comes in part from the hydrolysis of two phosphates (pyrophosphate) from the incoming nucleotide during the reaction. While replication requires the participation of many nuclear proteins in both prokaryotes and eukaryotes, DNA polymerases perform the basic steps of replication, as shown in the illustration below.
178 DNA Polymerases & Their Activities
Although DNA polymerases replicate DNA with high fidelity with as few as one error per 107 nucleotides, mistakes do occur. The proofreading ability of some DNA polymerases corrects many of these mistakes. The polymerase can sense a mismatched base pair, slow down and then catalyze repeated hydrolyses of nucleotides until it reaches the mismatched base pair. This basic proofreading by DNA polymerase is shown below.
After mismatch repair, DNA polymerase resumes forward movement. Of course, not all mistakes are caught by this or other repair mechanisms (see DNA Repair, below). Mutations in the eukaryotic germ line cells that elude correction can cause genetic diseases. However, most are the mutations that fuel evolution. Without mutations in germ line cells (egg and sperm), there would be no mutations and no evolution, and without evolution, life itself would have reached a quick dead end! Other replication mistakes can generate mutations somatic cells. If these somatic mutations escape correction, they can have serious consequences, including the generation of tumors and cancers.
C. The Process of Replication
DNA replication is a sequence of repeated condensation (dehydration synthesis) reactions linking nucleotide monomers into a DNA polymer. Like all biological polymerizations, replication proceeds in three enzymatically catalyzed and coordinated steps: initiation, elongation and termination.
1. Initiation
As we have seen, DNA synthesis starts at one or more origins or replication. These are DNA sequences targeted by initiator proteins in E. coli (below).
After breaking hydrogen bonds at the origin of replication, the DNA double helix is progressively unzipped in both directions (i.e., by bidirectional replication). The separated DNA strands serve as templates for new DNA synthesis. Sequences at replication origins that bind to initiation proteins tend to be rich in adenine and thymine bases. This is because A-T base pairs have two hydrogen (H-) bonds that require less energy to break than the three H-bonds holding G-C pairs together. Once initiation proteins loosen H-bonds at a replication origin, DNA helicase uses the energy of ATP hydrolysis to unwind the double helix. DNA polymerase III is the main enzyme that then elongates new DNA. Once initiated, a replication bubble (replicon) forms as repeated cycles of elongation proceed at opposite replication forks.
179 Replication Initiation in E. coli
Recalling that new nucleotides can only be added to the free 3' hydroxyl group of a pre-existing nucleic acid strand. Since no known DNA polymerase can start synthesizing new DNA strands from scratch, this is a problem! The action of DNA polymerases therefore requires a primer, a nucleic acid strand to which to add nucleotides. The questions were…, what is the primer and where does it come from? Since RNA polymerases (enzymes that catalyze RNA synthesis) are the only nucleotide polymerase that can grow a new nucleic acid strand against a DNA template from scratch (i.e., from the first base), it was suggested that RNA might be the primer, After synthesis of a short RNA primer, new deoxynucleotides would be added to its 3’ end by DNA polymerase. The discovery of short stretches of RNA nucleotides at the 5’ end of Okazaki fragments confirmed the notion of RNA primers. We now know that cells use primase, a special RNA polymerase active during replication, to make those RNA primers against DNA templates before a DNA polymerase can grow the DNA strands at replication forks. As we will see now, the requirement for RNA primers is nowhere more in evidence in events at a replication fork.
2. Elongation
Looking at elongation at one replication fork (below), we see another problem:
One of the two new DNA strands can grow continuously towards the replication fork as the double helix unwinds. But what about the other strand? Either this other strand must grow in pieces in the opposite direction, or it must wait to begin synthesis until the double helix is fully unwound. If one strand of DNA must be replicated in fragments, then those fragments would have to be stitched (i.e., ligated) together. The problem is illustrated below.
According to this hypothesis, a new leading strand of DNA is lengthened continuously by sequential addition of nucleotides to its 3’ end against its leading strand template. The other strand however, would be made in pieces that would be joined in phosphodiester linkages in a subsequent reaction. Because of the extra step and presumably extra time it takes to make and join these new DNA fragments, this new DNA is called the lagging strand, making its template the lagging strand template.
Reiji Okazaki and his colleagues were studying mutants of T4 phage that grew slowly in their E. coli host cells. They graphed the growth rates of wild-type and mutant T4 phage and demonstrated that slow growth was due to a deficient DNA ligase enzyme, already known to catalyze the circularization of linear phage DNA molecules being replicated in infected host cells. The graph below summarizes their results.
Okazaki’s hypothesis was that the deficient DNA ligase in the mutant phage not only slowed down circularization of replicating T4 phage DNA, but would also be slow at joining phage DNA fragments replicated against at least one of the two template DNA strands. When the hypothesis was tested, the Okazakis found that short DNA fragments did indeed accumulate in E. coli cells infected with ligasedeficient mutants, but not in cells infected with wild type phage. The lagging strand fragments are now called Okazaki fragments.
180 Okazaki Experiments & Fragments - Solving a Problem at an RF
181 Okazaki Fragments are Made Beginning with RNA Primers
You can check out Okazaki’s original research at this link.
Each Okazaki fragment would have to begin with a 5’ RNA primer, creating yet another dilemma! The RNA primer must be replaced with deoxynucleotides before stitching the fragments together. This in fact happens, and the process illustrated below
Removal of RNA primer nucleotides from Okazali fragments requires the action of DNA polymerase I, an enzyme that can also catalyze hydrolysis of the phosphodiester bonds between the RNA (or DNA) nucleotides from the 5’-end of a nucleic acid strand. Flap Endonuclease 1 (FEN 1) also plays a role in removing ‘flaps’ of nucleic acid from the 5’ ends of the fragments often displaced by polymerase as it replaces the replication primer. At the same time as the RNA nucleotides are removed, DNA polymerase I catalyzes their replacement by the appropriate deoxynucleotides. Finally, when a fragment is entirely DNA, DNA ligase links it to the rest of the already assembled lagging strand DNA. Because of its 5’ exonuclease activity (not found in other DNA polymerases), DNA polymerase 1 also plays unique roles in DNA repair (discussed further below). As Cairn’s suggested and others demonstrated, replication proceeds in two directions from the origin to form a replicon with its two replication forks (RFs). Each RF has a primase associated with replication of Okazaki fragments along lagging strand templates.
As Cairn’s suggested and others demonstrated, replication proceeds in two directions from the origin to form a replicon with its two replication forks (RFs). Each RF has a primase associated with replication of Okazaki fragments along lagging strand templates.
The requirement for primases at replication forks is shown below.
Now we can ask what happens when replicons reach the ends of linear chromosomes in eukaryotes.
182 Replication Elongation in E.coli
3. Termination
In prokaryotes, replication is complete when two replication forks meet after replicating their portion of the circular DNA molecule. In eukaryotes, many replicons fuse to become larger replicons, eventually reaching the ends of the chromosomes…, where there is yet another problem (below)!
When a replicon nears the end of a chromosome (i.e. a double-stranded DNA molecule), the strand synthesized continuously stops when it reaches the 5’ end of its template DNA. In theory, synthesis of a last Okazaki fragment can be primed from the 3’ end of the lagging template strand. The illustration above implies removal of a primer from the penultimate Okazaki fragment and DNA polymerase catalyzed replacement with DNA nucleotides. But what about the last Okazaki fragment? Would its primer be hydrolyzed? Moreover, without a free 3’ end to add to, how are those RNA nucleotides replaced with DNA nucleotides? The problem here is that every time a cell replicates, one strand of new DNA (likely both) would get shorter and shorter. Of course, this would not do…, and does not happen! Eukaryotic replication undergoes a termination process involving extending the length of one of the two strands by the enzyme telomerase. The action of telomerase is summarized in the illustration below
Telomerase consists of several proteins and an RNA. From the drawing,, the RNA component serves as a template for 5’-> 3’ extension of the problematic DNA strand. The protein with the requisite reverse transcriptase activity is called Telomerase Reverse Transcriptase, or TERT. The Telomerase RNA Component is called TERC. Carol Greider, Jack Szostak and Elizabeth Blackburn shared the 2009 Nobel Prize in Physiology or Medicine for discovering telomerase.
183 Telomerase Replication Prevents Chromosome Shorteninghttps://youtu.be/M4dmfrxGKKU
One of the more interesting recent observations was that differentiated, nondividing cells no longer produce the telomerase enzyme. On the other hand, the telomerase genes are active in normal dividing cells (e.g., stem cells) and cancer cells, which contain abundant telomerase.
4. Is Replication Processive?
Drawings of replicons and replication forks suggest separate events on each DNA strand. Yet events at replication forks seem to be coordinated. Replication may be processive, meaning both new DNA strands are replicated in the same direction at the same time, smoothing out the process. How might this be possible? The drawing below shows lagging strand template DNA bending, so that it faces in the same direction as the leading strand at the replication fork.
184 Processive Replication
The replisome structure cartooned at the replication fork consists of clamp proteins, primase, helicase, DNA polymerase and single-stranded binding proteins among others.
Newer techniques of visualizing replication by real-time fluorescence videography call the processive model into question, suggesting that the replication process is anything but smooth! Are lagging and leading strand replication not in fact coordinated? Alternatively, is the jerky movement of DNA elongation in the video an artifact, so that the model of smooth, coordinated replication integrated at a replisome still valid? Or is coordination defined and achieved in some other way? Check out the video yourself in the article here.
5. One More Problem with Replication
Cairns recorded many images of E.coli of the sort shown below.
The coiled, twisted appearance of the replicating circles were interpreted to be a natural consequence of trying to pull apart helically intertwined strands of DNA… or intertwined strands of any material! As the strands continued to unwind, the DNA should twist into a supercoil of DNA. Increased DNA unwinding would cause the phosphodiester bonds in the DNA to rupture, fragmenting the DNA. Obviously, this does not happen. Experiments were devised to demonstrate supercoiling, and to test hypotheses explaining how cells relax the supercoils during replication. Testing these hypotheses revealed the topoisomerase enzymes. These enzymes bind and hold on to DNA, catalyze hydrolysis of phosphodiester bonds, control unwinding of the double helix, and finally catalyze the re-formation of the phosphodiester linkages. It is important to note that the topoisomerases are not part of a replisome, but can act far from a replication fork, probably responding to the tensions in overwound DNA. Recall that topoisomerases comprise much of the protein lying along eukaryotic chromatin.
185 Topoisomerases Relieve Supercoiling During Replication
We have considered most of the molecular players in replication. Below is a list of the key replication proteins and their functions (from here).
Enzyme Function in DNA Replication
DNA Helicase Also known as helix destabilizing enzyme. Unwinds the DNA double helix at the Replication Fork.
DNA Polymerase
Builds a new duplex DNA strand by adding nucleotides in the 5' to 3' direction. Also performs proof-reading and error correction.
DNA clamp A protein which prevents DNA polymerase III from dissociating from the DNA parent strand.
Single-Strand Binding (SSB) Proteins Bind to ssDNA and preven the DNA double helix from re-annealing after DNA helicase unwinds it thus maintaining the strand separation.
Topoisomerase Relaxes the DNA from its super-coiled nature.
DNA Gyrase Relieves strain of unwinding by DNA helicase; this is a specific type of topoisomerase
DNA Ligase Re-anneals the semi-conservative strands and joins Okazaki Fragments of the lagging strand
Primase Provides a starting point of RNA (or DNA) for DNA polymerase to begin synthesis of the new DNA strand.
Telomerase Lengthens telomeric DNA by adding repetitive nucleotide sequences to the ends of eukaryotic chromosomes. | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/09%3A_Details_of_DNA_Replication_and_Repair/9.02%3A_DNA_Replication.txt |
A. DNA Damage (Mutation) is a Fact of Life
We generally accept the notion that replication faithfully duplicates the genetic material. At the same time, evolution would not be possible without mutation, and mutation is not possible without at least some adverse consequences.
Germline mutations are heritable. When present in one, but especially in both alleles of a gene, such mutations can result in genetic disease (e.g., Tay-Sach’s disease, cystic fibrosis, hemophilia, sickle-cell anemia, etc.). Rather than causing disease, some germline mutations may increase the likelihood of becoming ill (e.g., mutations of the BRCA2 gene greatly increase a woman’s odds of getting breast cancer). Somatic mutations in actively dividing cells might result in benign “cysts” or malignant tumors (i.e., cancer). Other somatic mutations may play a role in dementia (Alzheimer’s disease) or in some of the neuropathologies along the autism spectrum.
Since the complex chemistry of replication is subject to an inherent high rate of error, cells have evolved systems of DNA repair to survive high mutation rates. As we saw, DNA polymerases themselves have proofreading ability so that incorrectly inserted bases can be quickly removed and replaced. Beyond this, multiple mechanisms have evolved to repair mismatched base pairs and other kinds of damaged DNA that escape early detection. How often and where DNA damage occurs is random, as is which damage will be repaired and which will escape to become a mutation. For those suffering the awful consequences of unrepaired mutation, the balance between retained and repaired DNA, damage is to say the least, imperfect. However, evolution and the continuance of life itself rely on this balance.
B. What Causes DNA Damage
DNA is most exposed and therefore most vulnerable to damage, especially in eukaryotes. The simplest damage to DNA during replication is the point mutation, the accidental insertion of a ‘wrong’ nucleotide into a growing DNA strand. Other mutations, equally accidental, include DNA deletions, duplications, inversions, etc., any of which might escape repair. The causes of DNA damage can be chemical or physical, and include spontaneous intracellular events (e.g., oxidative reactions) and environmental factors (radiation, exogenous chemicals, etc.). Based on studies of different kinds of DNA damage, Thomas Lindahl estimated that DNA damaging events might be occurring at the rate of 10,000 per day! Lindahl realized that there must be some “fundamental DNA repair mechanisms” at work to protect cells against such a high rate of DNA damage. The discovery of the base excision repair mechanism earned Thomas Lindahl a share in the 2015 Nobel Prize in Chemistry. Environmental factors that can damage DNA include UV light, X-rays and other radiation, as well as chemicals (e.g., toxins, carcinogens, and even drugs, etc.). Both germline and somatic cells can be affected. While mutations can and do cause often debilitating diseases, it is instructive to keep the impact of mutations in perspective. Most mutations are actually silent; they do not cause disease. In addition, much DNA damage is repaired. Cells correct more than 99.9% of mistaken base changes before they have a chance to become mutations. That is why we think of replication as a “faithful” process. Let’s look at some common types of DNA damage that are usually repaired:
• Pyrimidine dimers, typical of adjacent thymines (less often cytosines) in a single DNA strand, caused by UV exposure
• Depurination; the hydrolytic removal of guanine or adenine from the #1 C (carbon) of deoxyribose in a DNA strand
• Deamination: hydrolytic removal of amino (-NH2) groups from guanine (most common), cytosine or adenine
• Oxidative damage of deoxyribose with any base, but most commonly purines
• Inappropriate methylation of any bases, but most commonly purines
• DNA strand breakage during replication or from radiation or chemical exposure
C. Some Molecular Consequences of Uncorrected DNA Damage
While bacteria suffer DNA damage, we will focus here on eukaryotes since they have evolved the most sophisticated mechanisms. Remember that unrepaired DNA damage will be passed on to daughter cells in mitosis, or might be passed on to the next generation if the mutation occurs in a germline cell.
Next, let us consider some molecular consequences of uncorrected DNA damage.
1. Depurination
This is the spontaneous hydrolytic removal of guanine or adenine from deoxyribose C#1 in a DNA strand. Its frequency of 5000 depurinations per cell per day emphases the high rate of DNA damage that demands a fix! If not repaired, depurination results in a single base-pair deletion in one chromosome after replication, leaving the DNA in the same region of the other chromosome unchanged. The effects of depurination are illustrated below.
The replisome ignores the missing base during replication of the depurinated DNA region (an A in this example), jumping to the C in the depurinated template DNA. Unrepaired, one new double-stranded DNA will have a deletion, leaving the other new one with no mutation.
2. Pyrimidine Dimerization
UV light exposure of DNA can cause adjacent pyrimidines (commonly thymines; less often, cytosines) on a DNA strand to dimerize. Pyrimidine dimers form at a rate of a bit less than 100 per cell per day!
Uncorrected dimerization results in 2-base deletion in one chromosome while the other is unchanged (below).
You can predict that correction of this radiation-induced damage will either involve disrupting the dimers (in this case thymine dimers), or removal and replacement of the dimerized bases by monomeric bases.
3. Deamination
Deamination is the hydrolytic removal of amino (-NH2) groups from guanine (most common), cytosine or adenine, at a rate of 100 per cell per day. Deamination does not affect thymine (because it has no –amino groups!). Uncorrected deamination results in a base substitution on one chromosome (actually, a T-A pair substitution for the original C-G in this example) and no change on the other. Deamination of adenine or guanine results in unnatural bases (hypoxanthine and xanthine, respectively). These are easily recognized and corrected by DNA repair systems. The U-A base pair remains occasionally un-repaired. The consequences of deamination to base sequence are shown below.
D. DNA Repair Mechanisms
Many enzymes and proteins are involved in DNA repair. Some of these function in normal replication, mitosis and meiosis, but were co-opted for DNA repair activities. These molecular co-optations are so vital to normal cell function that some repair activities and molecular players are highly conserved in evolution. Among different DNA repair pathways that have been identified, we will look at Base Excision Repair, Nucleotide Excision Repair, Transcription Coupled Repair, Non-homologous End-Joining, and Homologous Recombination (of these, the last is perhaps the most complex).
1. Base Excision Repair
Upon detection and recognition of an incorrect base (e.g., oxidized bases, openring bases, deaminated Cs or As, bases containing C=C bonds saturated to C-C bonds…), specific DNA glycosylases catalyze hydrolysis of the damaged base from affected deoxyribose in the DNA. To learn more about the specific versions of this enzyme, click here. Events of base excision repair are summarized below.
After a DNA glycosylase removes an offending base, an AP endonuclease recognizes the deoxyribose with the missing base and nicks the DNA at that nucleotide. Phosphodiesterase next hydrolyzes the remaining phosphate-ester bond of ‘base-less’ sugar phosphate, removing it from the DNA strand. DNA polymerase then adds correct nucleotide to the 3’ end of the nick. Finally, DNA ligase III (an ATP-dependent mammalian version of the original prokaryotic enzyme) seals the remaining nick in the strand. Thomas Lindahl (see above) discovered most of these enzymes.
2. Nucleotide Excision Repair
The discovery of nucleotide excision repair earned Aziz Sancar a share in the 2015 Nobel Prize in Chemistry. The results of this mechanism include the removal of thymidine dimers. The events of nucleotide excision repair are shown below for a pyrimidine dimer.
In this example, an Excision Nuclease recognizes a pyrimidine dimer and hydrolyzes phosphodiester bonds between nucleotides several bases away from either side of the dimer. A DNA helicase then unwinds and separates the DNA fragment containing the dimerized bases from the damaged DNA strand. Finally, DNA polymerase acts 5’-3’ to fill in the gap and DNA ligase seals the remaining nick to complete the repair.
3. Mismatch Repair
DNA Mismatch Repair occurs when DNA polymerase proofreading misses an incorrect base insertion into a new DNA strand. This repair mechanism relies on the fact that double-stranded DNA shows a specific pattern of methylation. The discovery of the mismatch repair mechanism earned Paul Modrich a share in the 2015 Nobel Prize in Chemistry. These methylation patterns are related to epigenetic patterns of gene activity and chromosome structure that are expected to be inherited by daughter cells. When DNA replicates, the methyl groups on the template DNA strands remain, but the newly synthesized DNA is unmethylated. In fact, it will take some time for methylation enzymes to locate and methylate the appropriate nucleotides in the new DNA. In the intervening time, several proteins and enzymes can detect inappropriate base pairing (the mismatches) and initiate mismatch repair. The basic process is illustrated below.
4. Transcription Coupled Repair (in Eukaryotes)
If an RNA polymerase reading a template DNA encounters a nicked template or one with an unusual base substitution, it might stall transcription and “not know what to do next”. Thus at a loss, a normal transcript would not be made and the cell might not survive. No big deal in a tissue comprised of thousands if not millions of cells, right? Nevertheless, Transcription Coupled Repair exists! In this repair pathway, if RNA polymerase encounters a DNA lesion (i.e., damaged DNA) while transcribing a template strand, it will indeed stall. This allows time for coupling proteins to reach the stalled polymerase and enable repair machinery (e.g., by base, or nucleotide excision) to effect the repair. Once the repair is complete, the RNA polymerase ‘backs up’ along the template strand with the help of other factors, and resumes transcription of the corrected template.
5. Non-homologous End-Joining
DNA replication errors can cause double stranded breaks, as can environmental factors (ionizing radiation, oxidation, etc.). Repair by non-homologous end-joining deletes damaged and adjacent DNA and rejoins the ‘cut’ ends (shown below).
Once the site of a double-stranded break is recognized, nucleotides hydrolyzed from the ends of both strands at the break-site leave ‘blunt ends’. Next, several proteins (Ku among others) bring DNA strands together and further hydrolyze single DNA strands to create staggered (overlapping, or complementary) ends. The overlapping ends of these DNA strands form H-bonds. Finally, DNA ligase seals the H-bonded overlapping ends of DNA strands, leaving a repair with deleted bases.
In older people, there is evidence of more than 2000 ‘footprints’ of this kind of repair per cell. How is this possible? This quick-fix repair often works with no ill effects because most of the eukaryotic genome does not encode genes or even regulatory DNA (whose damage would otherwise be more serious).
6. Homologous Recombination
Homologous recombination is a complex but normal and frequent part of meiosis in eukaryotes. You may recall that homologous recombination occurs in synapsis in the first cell division of meiosis (Meiosis I). During synapsis,homologous chromosomes align. This may lead to DNA breakage, an exchange of alleles, and ligation to reseal the now recombinant DNA molecules. Novel recombinations of variant alleles in the chromosomes of sperm and eggs ensure genetic diversity in species. The key point is that DNA breakage of DNA is required to exchange alleles between homologous chromosomes. Consult the genetics chapter in an introductory biology textbook, or the recombination chapter in a genetics text to be reminded of these events.
Cells use the same machinery to reseal DNA breaks during normal recombination and to repair DNA damaged by single or double stranded breakage. A single DNA strand nicked during replication can be repaired by recombination with strands of homologous DNA that are being replicated on the other strand. A double stranded break can be repaired using the same recombination machinery that operates on sister chromatids in meiosis. In both cases, the process accurately repairs damaged DNA without any deletions. These mechanisms are conserved in the cells of all species. This indicates an evolutionary imperative of accurate repair to the survival of species, no less than the imperative to maintain genetic diversity of species.
a) Repair of a Single-Stranded Break
A specific example of homologous recombination repair is the re-establishment of a replication fork damaged when a replisome reaches a break in one of the two strands of replicating DNA (illustrated below).
Such a break may have occurred prior to replication itself, and repair begins when the replication fork (RF) reaches the lesion. In the first step, a 5’-3’ exonuclease trims template DNA back along its newly synthesized complement. Next, RecA protein monomers (each with multiple DNA binding sites) bind to the single-stranded DNA to form a nucleoprotein filament. With the help of additional proteins, the 3’ end of the ‘filament’ scans the ‘other’ replicating strand for homologous sequences. When such sequences are found, the RecA-DNA filament binds to the homologous sequences and the filament of new DNA ‘invades’ the homologous (i.e., opposite) double stranded DNA, separating its template and newly replicated DNA. After strand invasion, replication of a leading strand continues from the 3’ end of the invading strand. A new RF is established as the leading strand template is broken and re-ligated to the original break; New lagging strand replication then resumes at the new (re-built) RF. The result is an accurate repair of the original damage, with no deletions or insertions of DNA.
RecA, a bacterial protein, is another of those evolutionarily conserved proteins. Its homolog in Archaea is called RadA. In Eukaryotes, the homolog is called Rad51, where it initiates synapsis during meiosis. Thus, it seems that a role for RecA and its conserved homologs in DNA repair predated its use in synapsis and crossing over in eukaryotes! For more about the functions of RecA protein and its homologs, click here.
b) Repair of a Double-Stranded Break
Homologous recombination can also repair a double-stranded DNA break with the aid of a number of enzymes and other proteins. Alternate repair pathways are summarized in the illustration on the next page. Here is a list of proteins involved in these homologous recombination pathways:
MRX, MRN: bind at double-stranded break; recruit other factors.
Sae2: an endonuclease (active when phosphorylated).
Sgs1: a helicase.
Exo1, Dna2: single strand exonucleases.
RPA, Rad51, DMC1: proteins that bind to overhanging DNA to form a nucleoprotein filament and initiate strand invasion at similar sequences.
The activities of other enzymes in the drawing are identified. Not shown in this illustration are two gene products that interact with some of the proteins that mediate the repair pathway. These are products of the BRCA1 and BRCA2 genes (the same ones that when mutated, increase the likelihood of a woman getting breast cancer). Expressed mainly in breast tissue, their wild-type (normal) gene products participate in homologous recombination repair of double-stranded DNA breaks. They do this by binding to Rad51 (the human RecA homolog!).
When mutated, the BRCA proteins function poorly and DNA in the affected cells is not efficiently repaired. This is the likely basis of the increased chance of getting breast cancer. It doesn’t help matters that the normal BRCA1 protein also plays a role in mismatch repair… and that the mutated protein can’t! To end this chapter, here is a bit of weird science! Read all about the genome of a critter, nearly 17% of which is comprised of foreign DNA, possibly the result of here.
9.04: Key Words and Terms
base excision repair initiation replicons
bidirectional replication initiator proteins replisome
Central Dogma lagging strand S phase of the cell cycle
clamp proteins leading strand satellite DNA
condensation reactions methylation single-strand binding proteins
deamination mutations siRNA
density gradient centrifugation nucleotide excision repair supercoiling
depurination Okazaki fragments T2 phage
direct repeats origin of replication tardigrade
discontinuous replication phosphate backbone telomerase
DNA ligase phosphodiester linkage telomeres
DNA mismatch repair primase theta images
DNA polymerase I, II, III primer topoisomerases
DNA repair processive replication transcription-coupled repair
DNA sequence phylogeny proofreading transposase
elongation RadA protein VNTRs
env RecA protein
helicase replication
high-speed binder replication fork | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/09%3A_Details_of_DNA_Replication_and_Repair/9.03%3A_DNA_Repair.txt |
• 10.1: Introduction
Transcription, the synthesis of RNA based on a DNA template, is the central step of the Central Dogma proposed by Crick in 1958. The basic steps of transcription are the same as for replication: initiation, elongation and termination. Differences between transcription in prokaryotes and eukaryotes are in the details.
• 10.2: Overview of Transcription
All cells make three main kinds of RNA: ribosomal RNA (rRNA), transfer RNA (tRNA) and messenger RNA (mRNA). rRNA is a structural as well as enzymatic component of ribosomes, the protein-synthesizing machine in the cell. Quantitatively, rRNAs are by far the most abundant RNAs in the cell and mRNAs, the least. Three rRNAs and about 50 ribosomal proteins make up the two subunits of a bacterial ribosome, as illustrated below.
• 10.3: Details of Transcription
Some proteins bind DNA to regulate transcription, inducing or silencing transcription of a gene. We will discuss their role in the regulation of gene expression later. Other proteins interact with DNA simply to allow transcription. These include one or more that, along with RNA polymerase itself, that must bind to the gene promoter to initiate transcription.
• 10.4: Details of Eukaryotic mRNA Processing
Eukaryotic mRNA primary transcripts undergo extensive processing, including splicing, capping and, polyadenylation. The steps described here are considered in order of (sometimes overlapping!) occurrence. We begin with splicing, an mRNA phenomenon.
• 10.5: Ribosomal RNA Processing in Eukaryotic Nuclei
In most eukaryotes, a large rRNA gene in most eukaryotes transcribes a 45S precursor transcript containing (from shortest to longest) 5.8S rRNA, 18SrRNA and 28S rRNA. The ‘S’ stands for Svedberg, the biochemist who developed the sedimentation velocity ultracentrifugation technique to separate molecules like RNA by size. The higher the S value, the larger the molecule and therefore the faster it moves through the viscous sugar gradient during centrifugation. RNA Polymerase I transcribes 45S precu
• 10.6: tRNA Processing in Eukaryotic Nuclei
RNA polymerase III also transcribes tRNA genes from internal promoters, but unlike the 5S rRNA genes, tRNA genes tend to cluster in the genome. The tRNA folds into several hairpin loops based on internal H-bond formation between complementary bases in the molecule. The 3’-terminal A residue of this (and every) tRNA will bind to an amino acid specific for the tRNA.
• 10.7: RNA and Ribosome Export from the Nucleus
The synthesis and processing of rRNAs are coincident with the assembly of the ribosomal subunits, as shown below. The 45S pre-rRNAs initially bind to ribosomal proteins in the nucleolus (that big nuclear body!) to initiate assembly and then and serve as a scaffold for the continued addition of ribosomal proteins to both the small and large ribosomal subunits.
• 10.8: Key Words and Terms
Thumbnail: Simplified diagram of mRNA synthesis and processing. (CC BY 3.0 - unported ; Kelvinsong).
10: Transcription and RNA Processing
Transcription, the synthesis of RNA based on a DNA template, is the central step of the Central Dogma proposed by Crick in 1958. The basic steps of transcription are the same as for replication: initiation, elongation and termination. Differences between transcription in prokaryotes and eukaryotes are in the details.
• E.coli uses a single RNA polymerase enzyme to transcribe all kinds of RNAs while eukaryotic cells use different RNA polymerases to catalyze ribosomal RNA (rRNA), transfer RNA (tRNA) and messenger RNA (mRNA) synthesis.
• In contrast to eukaryotes, some bacterial genes are part of operons whose mRNAs encode multiple polypeptides.
• Bacterial mRNAs are typically translated as they are being transcribed.
• Most RNA transcripts in prokaryotes emerge from transcription ready to use
• Eukaryotic transcripts synthesized as longer precursors undergo processing by trimming, splicing, or both!
• DNA in bacteria is virtually ‘naked’ in the cytoplasm while eukaryotic DNA is wrapped up in chromatin proteins in a nucleus.
• In bacterial cells the association of ribosomes with mRNA and the translation of a polypeptide can begin even before the transcript is finished. This is because these cells have no nucleus. In our cells, RNAs must exit the nucleus before they encounter ribosomes in the cytoplasm.
In this chapter, you will meet bacterial polycistronic mRNAs (transcripts of operons that encode more than one polypeptide) and the split genes of eukaryotes (with their introns and exons). We will look at some details of transcription of the three major classes of RNA and then at how eukaryotes process precursor transcripts into mature, functional RNAs. Along the way, we will see one example of how protein structure has evolved to interact with DNA.
Learning Objectives
1. Discriminate between the three steps of transcription in pro- and eukaryotes, and the factors involved in each.
2. State an hypothesis for why eukaryotes evolved complex RNA processing steps.
3. Speculate on why any cell in its right mind would have genes containing introns and exons so that their transcripts would have to be processed by splicing.
4. Articulate the differences between RNA vs. DNA structure.
5. Explain the need for sigma factors in bacteria.
6. Speculate on why eukaryotes do not have operons.
7. List structural features of proteins that bind and recognize specific DNA sequences.
8. Explain how proteins that do not bind specific DNA sequences can still bind to specific regions of the genome.
9. Formulate an hypothesis for why bacteria do not polyadenylate their mRNAs as much as eukaryotes do.
10. Formulate an hypothesis for why bacteria do not cap their mRNAs. | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/10%3A_Transcription_and_RNA_Processing/10.01%3A_Introduction.txt |
A. The Major Types of Cellular RNA
All cells make three main kinds of RNA: ribosomal RNA (rRNA), transfer RNA (tRNA) and messenger RNA (mRNA). rRNA is a structural as well as enzymatic component of ribosomes, the protein-synthesizing machine in the cell. Quantitatively, rRNAs are by far the most abundant RNAs in the cell and mRNAs, the least. Three rRNAs and about 50 ribosomal proteins make up the two subunits of a bacterial ribosome, as illustrated below.
tRNAs are the decoding devices used in protein synthesis (translation) to convert nucleic acid sequence information into the amino acid sequences of polypeptides. tRNAs attached to amino acids are positioned on ribosomes based on codonanticodon recognition, as shown below.
During translation, tRNAs decode base sequences in messenger RNA (mRNAs) into amino acid sequences of polypeptides.
186 Transcription Overview: Ribosomes and Ribosomal RNAs
187 Transcription Overview: Demonstrating the Major RNAs
In 2009, Venkatraman Ramakrishnan, Thomas A. Steitz and ADA Yonath received the Nobel Prize in Chemistry their studies on the structure and molecular biology of the ribosome. Dr. Yonath is one of five women to receive a Nobel Prize – the others were Marie Curie, Irène Joliot-Curie, Dorothy Hodgkin and Barbara Mclintock.
The fact that genes are inside the eukaryotic nucleus and that the synthesis of polypeptides encoded by those genes happens in the cytoplasm led to the proposal that there must be a messenger RNA (mRNA. Sidney Brenner eventually confirmed the existence of mRNAs. Check out his classic experiment in Brenner S (1961, An unstable intermediate carrying information from genes to ribosomes for protein synthesis. Nature 190:576-581).
Recall polypeptide synthesis by the formation of polyribosomes (polysomes) along a single mRNA, as illustrated below.
While mRNA is a small fraction of total cellular RNA, there are still smaller amounts of other RNAs such as the transient primers that we saw in DNA replication. We’ll encounter still other kinds of low-abundance RNAs later.
B. Key Steps of Transcription
In transcription, an RNA polymerase uses the template DNA strand of a gene to catalyze synthesis of a complementary, antiparallel RNA strand. RNA polymerases use ribose nucleotide triphosphate (NTP) precursors, in contrast to DNA polymerases, which use deoxyribose nucleotide (dNTP) precursors. In addition, RNAs incorporate uracil (U) nucleotides into RNA strands instead of the thymine (T) nucleotides that end up in new DNA. Another contrast to replication - RNA synthesis does not require a primer. With the help of transcription initiation factors, RNA polymerase locates the transcription start site of a gene and begins synthesis of a new RNA strand from scratch. Finally, like replication, transcription is error-prone.
The basic steps of transcription are summarized on the next page. Here we can identify several of the DNA sequences that characterize a gene. The promoter is the binding site for RNA polymerase. It usually lies 5’ to, or upstream of the transcription start site (the bent arrow). Binding of the RNA polymerase positions the enzyme to near the transcription start site, where it will start unwinding the double helix and begin synthesizing new RNA. The transcribed grey DNA region in each of the three panels are the transcription unit of the gene. Termination sites are typically 3’ to, or downstream from the transcribed region of the gene. By convention, upstream refers to DNA 5’ to a given reference point on the DNA (e.g., the transcription start-site of a gene). Downstream then, refers to DNA 3’ to a given reference point on the DNA.
188 Transcription Overview: The Basic Mechanism of RNA Synthesis
In bacteria, some transcription units encode more than one kind of RNA. Bacterial operons are an example of this phenomenon. The resulting mRNAs can be translated into multiple polypeptides at the same time. In the illustration below, RNA polymerase is transcribing a single mRNA molecule encoding three separate polypeptides.
Bacterial transcription of the different RNAs requires only one RNA polymerase. Different RNA polymerases catalyze rRNA, mRNA and tRNA transcription in eukaryotes. Roger Kornberg received the Nobel Prize in Medicine in 2006 for his discovery of the role of RNA polymerase II and other proteins involved in eukaryotic messenger RNA transcription (like father-like son!!).
189 RNA Polymerases in Prokaryotes and Eukaryotes
While mRNAs, rRNAs and tRNAs are most of what cells transcribe, a growing number of other RNAs (e.g., siRNAs, miRNAs, lncRNAs…) are also transcribed. Some functions of these transcripts (including control of gene expression or other transcript use) are discussed elsewhere.
C. RNAs are Extensively Processed After Transcription in Eukaryotes
Many eukaryotic RNAs are processed (trimmed, chemically modified) from large precursor RNAs to mature, functional RNAs. These precursor RNAs (pre-RNAs, or primary transcripts) contain in their sequences the information necessary for their function in the cell.
Processing of the three major types of transcripts in eukaryotes is shown below.
To summarize the illustration:
1. Many eukaryotic genes are ‘split’ into coding regions (exons) and non-coding intervening regions (introns).
2. Transcription of split genes generates a primary mRNA transcript (pre-mRNA).
3. Primary transcripts are spliced to remove the introns from the exons; exons are then ligated into a continuous mRNA. In some cases, the same pre-mRNA is spliced into alternate mRNAs encoding related but not identical polypeptides!
4. Pre-rRNA is cleaved and/or trimmed (not spliced!) to make shorter mature rRNAs.
5. Pre-tRNAs are trimmed, some bases within the transcript are modified and 3 bases (not encoded by the tRNA gene) are enzymatically added to the 3’-end.
190 Post Transcriptional Processing Overview
The details of transcription and processing differ substantially in prokaryotes and eukaryotes. Let’s focus first on details of transcription itself, and then RNA processing. | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/10%3A_Transcription_and_RNA_Processing/10.02%3A_Overview_of_Transcription.txt |
Find a well-written summary of transcription in prokaryotes and eukaryotes at an NIH website (Transcription in Prokaryotes and Eukaryotes). Here (and at this link), you will encounter proteins that bind DNA. Some proteins bind DNA to regulate transcription, inducing or silencing transcription of a gene. We will discuss their role in the regulation of gene expression later. Other proteins interact with DNA simply to allow transcription. These include one or more that, along with RNA polymerase itself, that must bind to the gene promoter to initiate transcription. We will look at bacterial transcription first.
A. Transcription in Prokaryotes
In E. coli, a single RNA polymerase transcribes all kinds of RNA, associating with one of several sigma factor proteins ($\sigma$ -factors) to initiate transcription. It turns out that different promoter sequences and corresponding $\sigma$ -factors play roles in the transcription of different genes (illustrated below).
In the absence of the $\sigma$-factor, the E. coli RNA polymerase can transcribe RNA, but does so at a high rate, and from random sequences in the chromosome. In contrast, when the $\sigma$-factor is bound to the RNA polymerase, the complex seems to scan the DNA, recognize and then bind to the promoter sequence of a gene. In this case, the overall transcription rate is slower, but only genes are transcribed, rather than random bits of the bacterial genome! The Pribnow box, named for its discoverer, was the first promoter sequence characterized.
Elongation is the successive addition of nucleotides complementary to their DNA templates, forming phosphodiester linkages. The enzymatic reactions of elongation are similar to the DNA polymerase-catalyzed elongation during replication.
There are two ways that bacterial RNA polymerase ‘knows’ when it has reached the end of a transcription unit. In one case, as the RNA polymerase nears the 3’ end of the nascent transcript, it transcribes a 72 base, C-rich region. At this point, a termination factor called the rho protein binds to the nascent RNA strand. Rho is an ATP-dependent helicase that breaks the H-bonds between the RNA and the template DNA strand, thereby preventing further transcription.
Rho-dependent termination is illustrated below.
In the other mechanism of termination, the polymerase transcribes RNA whose termination signal assumes a secondary hairpin loop structure that causes the dissociation of the RNA polymerase, template DNA and the new RNA transcript. The role of the hairpin loop in rho-independent termination is illustrated below.
191 Details of Prokaryotic Transcription
B. Transcription in Eukaryotes
Whereas bacteria rely on a single RNA polymerase for their transcription needs, eukaryotes use three different RNA polymerases to synthesize the three major different kinds of RNA, as shown below.
Note that catalysis of the synthesis of most of the RNA in a eukaryotic cell (rRNAs) is by RNA polymerase I. With the help of initiation proteins, each RNA polymerase initiates transcription at a promoter sequence. Once initiated, the RNA polymerases then catalyze the successive formation of phosphodiester bonds to elongate the transcript. Recall that mRNAs are the least abundant in eukaryotes as they are in bacterial cells.
Unfortunately, the details of the termination of transcription in eukaryotes are not as well understood as they are in bacteria. Therefore, we will focus on initiation, and then consider the processing of different eukaryotic RNAs into ready-to-use molecules.
1. Eukaryotic mRNA Transcription
The multiple steps of eukaryotic mRNA transcription are shown on the next page.
Transcription of eukaryotic mRNAs by RNA polymerase II begins with the sequential assembly of a eukaryotic initiation complex at a gene promoter. The typical eukaryotic promoter for a protein-encoding gene contains a TATA box DNA sequence motif as well as additional short upstream sequences. TATA-binding protein (TBP) first binds to the TATA box along with TFIID (transcription initiation factor IID).
This intermediate recruits TFIIA and TFIIB. Next, TFGIIE, TFIIF and TFIIH, several other initiation factors and RNA polymerase II bind to form the transcription initiation complex. Phosphorylation adds several phosphates to the aminoterminus of the RNA polymerase, after which some of the TF’s dissociate from the initiation complex. The remaining RNA polymerase-TF complex can now start making the mRNA.
Unlike prokaryotic RNA polymerase, eukaryotic RNA Polymerase II does not have an inherent helicase activity. For this, eukaryotic gene transcription relies on the multi-subunit TFIIH protein, in which two subunits have helicase activity. Consistent with the closer relationship of archaea to eukaryotes (rather to prokaryotes), archaeal mRNA transcription initiation resembles that of eukaryotes, albeit requiring fewer initiation factors during formation of an initiation complex.
192 Eukaryotic mRNA Transcription
A significant difference between prokaryotic and eukaryotic transcription is that RNA polymerase and other proteins involved at a gene promoter do not see naked DNA. Instead, they must recognize specific DNA sequences through chromatin proteins. On the other hand, all proteins that interact with DNA have in common a need to recognize the DNA sequences to which they must bind…, within the double helix. In other words, they must see the bases within the helix, and not on its uniformly electronegative phosphate backbone surface. To this end, they must penetrate the DNA, usually through the major groove of the double helix. We will see that DNA regulatory proteins face the same problems in achieving specific shape-based interactions!
193 Recognition of Transcription factors at Promoters
2. Eukaryotic tRNA and 5SRNA Transcription
Transcription of 5S rRNA and tRNAs by RNA Polymerase III is unusual in that the promoter sequence to which it binds (with the help of initiation factors) is not upstream of the transcribed sequence, but lies within the transcribed sequence. After binding to this internal promoter, the polymerase re-positions itself to transcribe the RNA from the transcription start site so that the final transcript thus contains the promoter sequence!
5S rRNA by RNA polymerase III is shown below.
3. Transcription of the Other Eukaryotic rRNAs
tRNAs are also transcribed by RNA polymerase III in much the same way as the 5S rRNA. The other rRNAs are transcribed by RNA polymerase I, which binds to an upstream promoter along with transcription initiation factors. We know less of the details of this process compared to our understanding of mRNA transcription. We’ll explore what we do know next. As already noted, transcription termination is not as well understood in eukaryotes as in prokaryotes. Coupled termination and polyadenylation steps common to most prokaryotic mRNAs are discussed in more detail below, with a useful summary at the NIH-NCBI website here. | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/10%3A_Transcription_and_RNA_Processing/10.03%3A_Details_of_Transcription.txt |
Eukaryotic mRNA primary transcripts undergo extensive processing, including splicing, capping and, polyadenylation. The steps described here are considered in order of (sometimes overlapping!) occurrence. We begin with splicing, an mRNA phenomenon.
A. Spliceosomal Introns
Bacterial gene coding regions are continuous. The discovery of eukaryotic split genes with introns and exons came as quite a surprise. Not only did it seem incongruous for evolution to have stuck irrelevant DNA in the middle of coding DNA, no one could have dreamt up such a thing! For their discovery of split genes, by Richard J. Roberts and Phillip A. Sharp shared the Nobel Prize for Physiology in 1993. In fact, all but a few eukaryotic genes are split, and some have one, two (or more than 30-50!) introns separating bits of coding DNA, the exons. Splicing is summarized below.
Splicing involves a number of small ribonuclear proteins (snRNPs). snRNPs are particles composed of RNA and proteins. They bind to specific sites in an mRNA and then direct a sequential series of cuts and ligations (the splicing) necessary to process the mRNAs.
The role of snRNPs in splicing pre-mRNAs is illustrated below.
snRNP binding to a pair of splice sites flanking an intron in a pre-mRNA forms the spliceosome that completes the splicing, including removal of the lariat (the intermediate structure of the intron). The last step is to ligate exons into a continuous mRNA with all its codons intact and ready for translation. Spliceosome action is summarized below.
194 The Discovery of Split Genes
195 mRNA Splicing
B. Specific Nuclear bodies and their associated proteins facilitate the assembly and function of the SnRNPs
Recall the organization of nuclei facilitated by nuclear bodies. Cajal bodies (CBs) and Gems are nuclear bodies that are similar in size and have related functions in assembling spliceosomal SnRNPs. Some splicing defects correlate with mutations in the coil protein that associate with Cajal bodies; others correlate with mutations in SMN proteins normally associated with Gems. An hypothesis was that CBs and Gems interact in SnRNP and spliceosome assembly…, but how? Consider the results of an experiment in which antibodies to coilin and the SMN protein were localized in undifferentiated and differentiated neuroblastoma cells.
A and C are undifferentiated cells in culture; B and D are cells that were stimulated to differentiate. In the fluorescence micrographs at the right, arrows point to fluorescent nuclear bodies. The coilin protein is associated with CBs and SMN is found in Gems. Therefore, we expect that fluorescent antibodies to coilin (green) will localize to CBs and antibodies to SMN protein (red) will bind to Gems. This is what happens in the nuclei of undifferentiated cells (panel C). But in panel D, the two antibodies colocalize, suggesting that the CBs and Gems aggregate in the differentiated cells. This would explain the need for both functional coilin and SMN protein to produce functional SnRNPs. The CBs and Gems may be aggregating in differentiated cells due to an observed increase in expression of the SMN protein. This could lead to more active Gems more able to associate with the CBs.
This and similar experiments demonstrate that different nuclear bodies do have specific functions. They are not random structural artifacts, have evolved to organize nuclear activities in time and space in ways that are essential to the cell.
C. Group I and Group II Self-Splicing Introns
While Eukaryotic Spliceosomal introns are spliced using snRNPs as described above, Group I or Group II introns are removed by different mechanisms. Group I introns interrupt mRNA and tRNA genes in bacteria and in mitochondrial and chloroplast genes. They are occasionally found in bacteriophage genes, but rarely in nuclear genes, and then only in lower eukaryotes. Group I introns are self-splicing! Thus, they are ribozymes that do not require snRNPs or other proteins. Instead, they fold into a secondary stem-loop structure that positions catalytic nucleotides at appropriate splice sites, excise themselves, and re-ligate the exons. Group II introns in chloroplast and mitochondrial rRNA, mRNA, tRNA and some bacterial mRNAs can be quite long, form complex stem-loop tertiary structures, and self-splice, at least in a test tube! However, Group II introns encode proteins required for their own splicing in vivo. Like spliceosomal introns, they form a lariat structure at an A residue branch site. All this suggests that the mechanism of spliceosomal intron splicing evolved from that of Group II introns.
D. So, Why Splicing?
The puzzle implied by the question of course is why higher organisms have split genes in the first place. While the following discussion can apply to all splicing, it will reference mainly spliceosomal introns. Here are some answers to the question “Why splicing?”
• Introns in nuclear genes are typically longer (often much longer!) than exons. Since they are non-coding, they are large targets for mutation. In effect, noncoding DNA, including introns can buffer the ill effects of random mutations.
• You may recall that gene duplication on one chromosome (and loss of a copy from its homolog) arise from unequal recombination (non-homologous crossing over). It occurs when similar DNA sequences align during synapsis of meiosis. In an organism that inherits a chromosome with both gene copies, the duplicate can accumulate mutations as long as the other retains original function. The diverging gene then becomes part of a pool of selectable DNA, the grist of evolution, in the descendants of organisms that inherit the duplicated genes, increasing species diversity. Unequal recombination can also occur between similar sequences (e.g., in introns) in the same or different genes. Introns can also enable the sharing of exons between genes. After unequal recombination between introns flanking an exon, one gene will acquire another exon while the other will lose it. Once again, as long as an organism retains a copy of the participating genes with original function, the organism can make the required protein and survive. Meanwhile, the gene with the extra exon may produce the same protein, but one with a new structural domain and function. Like a complete duplicate gene, one with a new exon and added function is in the pool of selectable DNA. Thus, this phenomenon of exon shuffling increases species diversity! The evidence indicates that exon shuffling has occurred, creating proteins with different overall functions that nonetheless share at least one domain and one common function. An example discussed earlier involves calcium-binding proteins that regulate many cellular processes. Structurally related calcium (Ca++) binding domains are common to many otherwise structurally and functionally unrelated proteins. Consider exon shuffling in the unequal crossover (non-homologous recombination) illustrated below.
In this example, regions of strong similarity in different (non-homologous) introns in the same gene align during synapsis of meiosis. Unequal crossing over between the genes inserts exon C in one of the genes. The other gene loses the exon (not shown in the illustration). In sum, introns are buffers against deleterious mutations, and equally valuable, are potential targets for gene duplication and exon shuffling. This makes introns key players in creating genetic diversity, the hallmark of evolution.
196 Origin of Introns
197 Intron Evolution-What was selected here?
E. Capping
A methyl guanosine cap added 5’-to-5’ to an mRNA functions in part to help mRNAs leave the nucleus and associate with ribosomes. The cap is added to an exposed 5’ end, even as transcription and splicing are still in progress. A capping enzyme places a methylated guanosine residue at the 5’-end of the mature mRNA. The 5’ cap structure is shown below (check marks are 5’-3’ linked nucleotides).
F. Polyadenylation
After transcription termination, poly(A) polymerase catalyzes the addition of multiple AMP residues (several hundred in some cases) to the 3’ terminus by the enzyme. The enzyme binds to an AAUAA sequence near the 3’ end of an mRNA and begins to catalyze the addition of the adenosine monophosphates. The AAUAA poly(A) recognition site is indicated in red in the illustration of polyadenylation shown below.
The result of polyadenylation is a 3’ poly (A) tail whose functions include assisting in the transit of mRNAs from the nucleus and regulating the half-life of mRNAs in the cytoplasm. The poly (A) tail shortens each time a ribosome completes translating the mRNA.
198 mRNA 5' Capping and 3' Polyadenylation | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/10%3A_Transcription_and_RNA_Processing/10.04%3A_Details_of_Eukaryotic_mRNA_Processing.txt |
In most eukaryotes, a large rRNA gene in most eukaryotes transcribes a 45S precursor transcript containing (from shortest to longest) 5.8S rRNA, 18SrRNA and 28S rRNA. The ‘S’ stands for Svedberg, the biochemist who developed the sedimentation velocity ultracentrifugation technique to separate molecules like RNA by size. The higher the S value, the larger the molecule and therefore the faster it moves through the viscous sugar gradient during centrifugation. RNA Polymerase I transcribes 45S precursor rRNAs (preRNAs) from multiple large transcription units in the genome (shown below).
The 45S pre-rRNA is processed by cleavage. The many copies (200-400!) of the 45S gene in eukaryotic cells might be expected, since making proteins (and therefore ribosomes) will be an all-consuming cellular activity. In humans, 45S genes (45S rDNA) are distributed among five acrocentric chromosomes (those that have a centromere very near one end of the chromosome). The 45S rDNA in chromosomes is packed in the nucleolus inside nuclei.
Because these genes are present in so many copies and organized into a specific region of chromatin, it is possible to visualize 45S transcription in progress in electron micrographs such as the ones below.
The term lampbrush came from the shape of the 45S genes in the process of transcription; the RNAs extending from the DNA template look like an old-fashioned brush used to clean the chimney of a kerosene lamp.
Multiple gene copies encode 5S rRNAs. However, unlike the 45S rRNA genes, 5S rRNA gene may be spread among many chromosomes (seven in Neurospora crassa, the bread mold). Or in the case of humans, 5S RNA gene copies are distributed along chromosome 1. The 5S rRNA genes are transcribed by RNA polymerase III with minimal posttranscriptional processing. As already noted, the promoters of the 5S genes are within the transcribed part of the genes, rather than upstream of their 5S transcription units.
199 rRNA Transcription and Processing
10.06: tRNA Processing in Eukaryotic Nuclei
RNA polymerase III also transcribes tRNA genes from internal promoters, but unlike the 5S rRNA genes, tRNA genes tend to cluster in the genome (below).
tRNA primary transcripts are processed by
• trimming,
• enzymatic addition of -C-C-A base triplet at the 3' end
• the modification of bases internal to the molecule
A yeast tRNA showing these modifications is illustrated below.
The tRNA folds into several hairpin loops based on internal H-bond formation between complementary bases in the molecule. The 3’-terminal A residue of this (and every) tRNA will bind to an amino acid specific for the tRNA.
200 tRNA Transcription and Processing
10.07: RNA and Ribosome Export from the Nucleus
A. rRNA and Ribosomes
The synthesis and processing of rRNAs are coincident with the assembly of the ribosomal subunits, as shown below.
The 45S pre-rRNAs initially bind to ribosomal proteins in the nucleolus (that big nuclear body!) to initiate assembly and then and serve as a scaffold for the continued addition of ribosomal proteins to both the small and large ribosomal subunits. After the 5S rRNA added to the nascent large ribosomal subunit, processing (cleavage) of 45S rRNA is completed and the subunits are separated. The separated ribosomal subunits exit the nucleus o the cytoplasm where they will associate with mRNAs to translate new proteins. To better understand what is going on, try summarizing what you see here in the correct order of steps. You can also see this process animated at this link: here.
B. mRNA
The 5’ methyl guanosine cap and the poly(A) tail collaborate to facilitate exit of mRNAs from the nucleus into the cytoplasm. We now understand that proteins in the nucleus participate in the export process. A nuclear transport receptor binds along the mature (or maturing) mRNA, a poly-A-binding protein binds along the poly-A tail of the message, and another protein binds at or near the methyl guanosine CAP itself. These interactions enable transport of the mRNA through nuclear pores. After the mRNA is in the cytoplasm, the nuclear transport receptor re-cycles back into the nucleus while a translation initiation factor replaces the protein bound to the CAP. The nuclear transport process is summarized in the illustration below.
See a more detailed description of mRNA transport from the nucleus at this link: here. The mature mRNA, now in the cytoplasm, is ready for translation. Translation is the process of protein synthesis mediated by ribosomes and a host of translation factors (including the initiation factor in the illustration above. The genetic code directs polypeptide synthesis during translation. Details of translation will be discussed shortly.
10.08: Key Words and Terms
16S rRNA internal promoters rRNA
18S rRNA introns rRNA cleavage
23S rRNA lariat rRNA endonucleases
28S rRNA mature RNA transcript $\sigma$-factor
45S pre-rRNA mRNA SINEs
45S rRNA methylation mRNA capping snRNP
4S rRNA mRNA polyadenylation spacer RNA
5'-methyl guanosine capping mRNA splicing splice sites
5S rRNA operons spliceosome
8S rRNA poly (A) polymerase Svedburg unit
adenine poly (A) tail TATA binding protein
Alu polycistronic RNA TBP
branch sites Pribnow box termination
crossing over promoter TFIIB, TFGIIE, TFIIF, TFIIH
cytosine recombination transcription
DNA binding proteins regulatory DNA sequence transcription start site
E. coli RNA polymerase regulatory factor transcription unit
elongation rho termination factor translation
eukaryotic RNA polymerases rho-independent termination transposition
exon shuffling ribonucleoproteins transposons
exons RNA polymerase I tRNA
guanine RNA polymerase II tRNA processing
helitrons RNA polymerase III upstream v. downstream
helix-turn-helix motif RNA processing uracil
initiation RNA secondary structure | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/10%3A_Transcription_and_RNA_Processing/10.05%3A_Ribosomal_RNA_Processing_in_Eukaryotic_Nuclei.txt |
• 11.1: Introduction
We begin this chapter with a look at how the genetic code was broken (deciphered). The very terms genetic code, broken and deciphered came from what was at the time, the recent history of the World War II. We will look at the elegant experiments that first deciphered the amino acid meaning of a few 3-base codons, and then all 64 codons. Of these, 61 encode amino acids and three are stop codons.
• 11.2: An Overview of the Genetic Code
The genetic code is the information for linking amino acids into polypeptides in an order based on the base sequence of 3-base code words (codons) in a gene and its messenger RNA (mRNA). With a few exceptions (some prokaryotes, mitochondria, chloroplasts), the genetic code is universal – it’s the same in all organisms from viruses and bacteria to humans.
• 11.3: Gene and Protein Colinearity and Triplet Codons
Serious efforts to understand how proteins are encoded began after Watson and Crick used the experimental evidence of Maurice Wilkins and Rosalind Franklin (among others) to determine the structure of DNA. Most hypotheses about the genetic code assumed that DNA (i.e., genes) and polypeptides were colinear.
• 11.4: Translation
Like any polymerization in a cell, translation occurs in three steps: initiation brings a ribosome, mRNA and an initiator tRNA together to form an initiation complex. Elongation is the successive addition of amino acids to a growing polypeptide. Termination is signaled by sequences (one of the stop codons) in the mRNA and protein termination factors that interrupt elongation and release a finished polypeptide. The events of translation occur at specific A, P and E sites on the ribosome.
• 11.5: Key Words and Terms
Thumbanil: Diagram of RNA translation. (CC BY 3.0 - unported; Kelvinsong).
11: The Genetic Code and Translation
We begin this chapter with a look at how the genetic code was broken (deciphered). The very terms genetic code, broken and deciphered came from what was at the time, the recent history of the World War II. Winning WWII relied heavily on breaking enemy codes (recall the Enigma machine), and hiding strategic battle information from the enemy (recall the Navajo code talkers). We will look at the elegant experiments that first deciphered the amino acid meaning of a few 3-base codons, and then all 64 codons. Of these, 61 encode amino acids and three are stop codons. The same kinds of experiments that broke the genetic code also led to our under-standing of the mechanism of protein synthesis. Early studies indicated that genes and proteins are colinear, i.e., that the length of a gene was directly proportional to the polypeptide it encoded. It would follow then, that the lengths of mRNAs are also collinear with their translation products.
Colinearity suggested the obvious hypotheses that translation proceeded in three steps (initiation, elongation and termination), just like transcription itself. We now know that initiation is a complex process involving the assembly of a translation machine near the 5’ end of the mRNA. This machine consists of ribosomes, mRNA, several initiation factors and a source of chemical energy. Since mature mRNAs are actually longer than needed to specify a polypeptide (even after splicing!), one function of initiation factors is to position the ribosome and associated proteins near a start codon. The start codon specifies the first amino acid in a new polypeptide. Once the initiation complex forms, elongation begins. Cycles of condensation reactions on the ribosome connect amino acids by peptide linkages, growing the chain from its amino-end to its carboxyl-end. Translation ends when the ribosome moving along the mRNA encounters a stop codon. We will look at how we came to understand the discrete steps of translation.
Learning Objectives
When you have mastered the information in this chapter, you should be able to:
1. Compare and contrast the mechanisms and energetics of initiation, elongation and termination of translation and transcription.
2. Speculate on why the genetic code is universal (or nearly so).
3. Justify early thinking about a 4-base genetic code.
4. Justify early thinking about an overlapping genetic code (for example, one in which the last base of a codon could be the first base of the next codon in an mRNA.
5. Explain why all tRNA structures share some, but not other features.
6. Compare and Contrast the roles of ribosomal A, E and P sites in translation.
7. Trace the formation of an aminoacyl-tRNA and the bacterial Initiation Complex.
8. Describe the steps of translation that require chemical energy.
9. Formulate an hypothesis to explain why stop codons all begin with U.
10. Create a set of rules for inferring an amino acid sequence from a stretch of DNA sequence.
11. Speculate about why large eukaryotic genomes encode so few proteins. | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/11%3A_The_Genetic_Code_and_Translation/11.01%3A_Introduction.txt |
A. The (Nearly) Universal, Degenerate Genetic Code
The genetic code is the information for linking amino acids into polypeptides in an order based on the base sequence of 3-base code words (codons) in a gene and its messenger RNA (mRNA). With a few exceptions (some prokaryotes, mitochondria, chloroplasts), the genetic code is universal – it’s the same in all organisms from viruses and bacteria to humans. The table of the Standard Universal Genetic Code on the next page shows the RNA version of triplet codons and their corresponding amino acids. There is a single codon for two amino acids (methionine and tryptophan), but two or more codons for each of the other 18 amino acids. For the latter reason, we say that the genetic code is degenerate. The three stop codons in the Standard Genetic Code ‘tell’ ribosomes the location of the last amino acid to add to a polypeptide. The last amino acid itself can be any amino acid consistent with the function of the polypeptide being synthesized. However, evolution has selected AUG as the start codon for all polypeptides, regardless of function, as well as for the placement of methionine within a polypeptide. Thus, all polypeptides begin life with a methionine at their amino-terminal end. As we will see in more detail, the mRNA translation machine is the ribosome and the decoding device is tRNA. Each amino acid attaches to a tRNA whose short sequence contains a 3-base anticodon that is complementary to an mRNA codon. Enzymatic reactions catalyze the dehydration synthesis (condensation) reactions that link amino acids in peptide bonds in the order specified by codons in the mRNA.
201 The Genetic Code Dictionary
B. Comments on the Nature and Evolution of Genetic Information
The near-universality of the genetic code from bacteria to humans implies that the code originated early in evolution. It is probable that portions of the code were in place even before life began. Once in place however, the genetic code was highly constrained against evolutionary change. The degeneracy of the genetic code enabled and contributed to this constraint by permitting base many base changes that do not affect the amino acid encoded in a codon.
The near universality of the genetic code and its resistance to change are features of our genomes that allow us to compare gene and other DNA sequences to establish evolutionary relationships between organisms (species), groups of organisms (genus, family, order, etc.) and even individuals within a species.
In addition to constraints imposed by a universal genetic code, some organisms show codon bias, a recent constraint on which universal codons an organism uses. Codon bias is seen in organisms preferably use A-T rich codons, or in organisms that favor codons richer in G and C. Interestingly, codon bias in genes often accompanies corresponding genomic nucleotide bias. An organism with an AT codon bias may also have an AT-rich genome (likewise GC-rich codons in GC-rich genomes). You can recognize genome nucleotide bias in Chargaff’s base ratios!
Finally, we often think of genetic information as genes for proteins. Obvious examples of non-coding genetic information include the genes for rRNAs and tRNAs, common to all organisms. The amount of these kinds of informational DNA (i.e., genes for polypeptides, tRNAs and rRNAs) as a proportion of total DNA can range across species, although it is higher in eukaryotes prokaryotes. For example, ~88% of the E. coli circular chromosome encodes polypeptides, while that figure is less ~1.5% for humans. Some less obvious informative DNA sequences in higher organisms are transcribed (e.g., introns). Other informative DNA in the genome is never transcribed. The latter include regulatory DNA sequences, DNA sequences that support chromosome structure and other DNAs that contribute to development and phenotype. As for that amount of truly non-informative (useless) DNA in a eukaryotic genome, that amount is steadily shrinking as we sequence entire genomes, identify novel DNA sequences and discover novel RNAs (topics covered elsewhere in this text). | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/11%3A_The_Genetic_Code_and_Translation/11.02%3A_An_Overview_of_the_Genetic_Code.txt |
Serious efforts to understand how proteins are encoded began after Watson and Crick used the experimental evidence of Maurice Wilkins and Rosalind Franklin (among others) to determine the structure of DNA. Most hypotheses about the genetic code assumed that DNA (i.e., genes) and polypeptides were colinear.
A. Colinearity
For genes and proteins, colinearity just means that the length of a DNA sequence in a gene is proportional to the length of the polypeptide encoded by the gene. The gene mapping experiments in E. coli already discussed certainly supported this hypothesis.
The concept of colinearity is illustrated below.
If the genetic code is collinear with the polypeptides it encodes, then a one-base codon obviously does not work because such a code would only account for four amino acids. A two-base genetic code also doesn’t work because it could only account for 16 (4 2 ) of the twenty amino acids found in proteins. However, threenucleotide codons could code for a maximum of 43 or 64 amino acids, more than enough to encode the 20 amino acids. And of course, a 4-base code also works; it satisfies the expectation that genes and proteins are collinear, with the’ advantage’ that there would be 256 possible codons to choose from (i.e., 44 possibilities).
B. How is the Genetic Code 'Read' to Account for All of an Organisms' Gene?
George Gamow (a Russian Physicist working at George Washington University) was the first to propose triplet codons to encode the twenty amino acids, the simplest hypothesis to account for the colinearity of gene and protein, and for encoding 20 amino acids. One concern that was raised was whether there is enough DNA in an organism’s genome to fit the all codons it needs to make all of its proteins? Assuming genomes did not have a lot of extra DNA laying around, how might genetic information be compressed into short DNA sequences in a way that is consistent with the colinearity of gene and polypeptide. One idea assumed 44 meaningless and 20 meaningful 3-base codons (one for each amino acid) and 44 meaningless codons, and that the meaningful codons in a gene (i.e., an mRNA) would be read and translated in an overlapping manner.
A code where codons overlap by one base is shown below.
You can figure out how compressed a gene could get with codons that overlapped by two bases. However, as attractive as an overlapping codon hypothesis was in achieving genomic economies, it sank of its own weight almost as soon as it was floated! If you look carefully at the example above, you can see that each succeeding amino acid would have to start with a specific base. A look back at the table of 64 triplet codons quickly shows that only one of 16 amino acids, those that begin with a C can follow the first one in the illustration. Based on amino acid sequences accumulating in the literature, virtually any amino acid could follow another in a polypeptide. Therefore, overlapping genetic codes are untenable. The genetic code must be non-overlapping!
Sidney Brenner and Frances Crick performed elegant experiments that directly demonstrated the non-overlapping genetic code. They showed that bacteria with a single base deletion in the coding region of a gene failed to make the expected protein. Likewise, deleting two bases from the gene. On the other hand, bacteria containing a mutant version of the gene in which three bases were deleted were able to make the protein. The protein it made was slightly less active than bacteria with genes with no deletions.
The next issue was whether there were only 20 meaningful codons and 44 meaningless ones. If only 20 triplets actually encoded amino acids, how would the translation machinery recognize the correct 20 codons to translate? What would prevent the translational machinery from ‘reading the wrong’ triplets, i.e., reading an mRNA out of phase? If for example, if the translation machinery began reading an MRNA from the second or third bases of a codon, it would likely encounter a meaningless 3-base sequence in short order.
One speculation was that the code was punctuated. That is, perhaps there were the chemical equivalent of commas between the meaningful triplets. The commas would be of course, additional nucleotides. In such a punctuated code, the translation machinery would recognize the ‘commas’ and would not translate any meaningless 3- base triplet, avoiding out-of-phase translation attempts. Of course, a code with nucleotide ‘commas’ would increase the amount of DNA needed to specify a polypeptide by a third!
Then, Crick proposed the Commaless Genetic Code. He divided the 64 triplets into 20 meaningful codons that encoded the amino acids, and 44 meaningless ones that did not. The result was such that when the 20 meaningful codons are placed in any order, any of the triplets read in overlap would be among the 44 meaningless codons. In fact, he could arrange several different sets of 20 and 44 triplets with this property! Crick had cleverly demonstrated how to read the triplets in correct sequence without nucleotide ‘commas’.
202 Speculations About a Triplet Code
As we know now, the genetic code is indeed ‘commaless’… but not in the sense that Crick had envisioned. What’s more, Thanks to the experiments described next, we know that ribosomes read the correct codons in the right order because they know exactly where to start!
C. Breaking the Genetic Code
When the genetic code was actually broken, it was found that 61 of the codons specify amino acids and therefore, that the code is degenerate. Breaking the code began when Marshall Nirenberg and Heinrich J. Matthaei decoded the first triplet. They fractionated E. coli and identified which fractions had to be added back together in order to get polypeptide synthesis in a test tube (in vitro translation).
The cell fractionation is summarized below.
Check out the original work in the classic paper by Nirenberg MW and Matthaei JH [(1961) The dependence of cell-free protein synthesis in E. coli upon naturally occurring or synthetic polyribo-nucleotides. Proc. Natl. Acad. Sci. USA 47:1588-1602]. The various cell fractions isolated by this protocol were added back together along with amino acids (one of which was radioactive) and ATP as an energy source. After a short incubation, Nirenberg and his coworkers looked for the presence of high molecular weight radioactive proteins as evidence of cell-free protein synthesis.
They found that all four final sub-fractions (1-4 above) must be added together to make radioactive proteins in the test tube. One of the essential cell fractions consisted of RNA that had been gently extracted from ribosome (fraction 2 in the illustration). Reasoning that this RNA might be mRNA, they substituted a synthetic poly(U) preparation for this fraction in their cell-free protein synthesizing mix, expecting poly(U) to encode a simple repeating amino acid.
They set up 20 reaction tubes, with a different amino acid in each…, and made only poly-phenylalanine. The experiment is illustrated below.
So, the triplet codon UUU means phenylalanine. Other polynucleotides were synthesized by G. Khorana, and in quick succession, poly(A) and poly(C) were shown to make poly-lysine and poly-proline in this experimental protocol. Thus AAA and CCC must encode lysine and proline respectively. With a bit more difficulty and ingenuity, poly di- and tri-nucleotides were also used in the cell free system to decipher several additional codons.
203 Deciphering the First Codon
M. W. Nirenberg, H. G. Khorana and R. W. Holley shared the 1968 Nobel Prize in Physiology or Medicine for their contributions to our understanding of protein synthesis. Deciphering the rest of the genetic code was based on Crick’s realization that chemically, amino acids have no attraction for either DNA or RNA (or triplets thereof). Instead, he predicted the existence of an adaptor molecule that would contain nucleic acid and amino acid information on the same molecule. Today we recognize this molecule as tRNA, the genetic decoding device.
Nirenberg and Philip Leder designed the experiment that pretty much broke the rest of the genetic code. They did this by adding individual amino acids to separate test tubes containing tRNAs, in effect causing the synthesis of specific aminoacyl-tRNAs.
They then mixed their amino acid-bound tRNAs with isolated ribosomes and synthetic triplets. Since they had already shown that synthetic three-nucleotide fragments would bind to ribosomes, they hypothesized that triplet-bound ribosomes would in turn, bind appropriate amino acid-bound tRNAs. The experiment is shown below.
Various combinations of tRNA, ribosomes and aminoacyl-tRNAs were placed over a filter. Nirenberg and Leder knew that aminoacyl-tRNAs alone passed through the filter and that ribosomes did not. They predicted then, that triplets would associate with the ribosomes, and further, that this complex would bind the tRNA with the amino acid encoded by the bound triplet. This 3-part complex would also be retained by the filter, allowing the identification of the amino acid retained on the filter, and therefore the triplet code-word that had enabled binding the amino acid to the ribosome.
204 Deciphering all 64 Triplet Codons
After the code was largely deciphered, Robert Holley actually sequenced a yeast tRNA, and from regions of internal complementarity, predicted the folded structure of the tRNA. This first successful sequencing of a nucleic acid was possible because the tRNA was short, and contained several modified bases that facilitated the sequencing chemistry. Holley found the amino acid alanine at one end of the tRNA and he found one of the anticodons for an alanine codon roughly in the middle of the tRNA sequence. Holley predicted that this (and other) tRNAs would fold and assume a stem-loop, or cloverleaf structure with a central anticodon loop. The illustration below shows this structure for a phenylalanine tRNA along with subsequent computer-generated structures (below right) showing a now familiar “L”-shaped molecule with an amino acid attachment site at the 3’-end at the top of the molecule, and the anticodon loop at the other, bottom ‘end’
205 tRNA Structure and Base Modifications
After a brief overview of translation, we’ll break translation down into its 3 steps and see how aminoacyl-tRNAs function in the initiation and elongation steps of translation, as well as the special role of an initiator tRNA. | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/11%3A_The_Genetic_Code_and_Translation/11.03%3A_Gene_and_Protein_Colinearity_and_Triplet_Codons.txt |
A. Overview of Translation (Synthesizing Proteins)
Like any polymerization in a cell, translation occurs in three steps: initiation brings a ribosome, mRNA and an initiator tRNA together to form an initiation complex. Elongation is the successive addition of amino acids to a growing polypeptide. Termination is signaled by sequences (one of the stop codons) in the mRNA and protein termination factors that interrupt elongation and release a finished polypeptide. The events of translation occur at specific A, P and E sites on the ribosome (see drawing below).
B. Translation - First Steps
1. Making Aminoacyl-tRNAs
Translation is perhaps the most energy-intensive job a cell must do, beginning with the attachment of amino acids to their tRNAs. The basic amino-acylation reaction is the same for all amino acids. A specific aminoacyl-tRNA synthase attaches each tRNA to (charges) an appropriate amino acid. Charging tRNAs requires ATP and proceeds in three steps (shown below).
In the first step, ATP and an appropriate amino acid bind to the aminoacyl-tRNA synthase. ATP is hydrolyzed releasing a pyrophosphate (PPi) and leaving an enzyme-AMP-amino acid complex. Next, the amino acid is transferred to the enzyme, releasing the AMP. Finally, the tRNA binds to the enzyme, the amino acid is transferred to the tRNA and the intact enzyme is regenerated and released. The charged tRNA is ready to use in translation.
Several studies had already established that polypeptides are synthesized from their amino (N-) terminal end to their carboxyl (C-) terminal end. When it became possible to determine the amino acid sequences of polypeptides, it turned out that around 40% of E. coli proteins had an N-terminal methionine, suggesting that all proteins began with a methionine. It also turned out that, even though there is only one codon for methionine, two different tRNAs for methionine could be isolated. One of the tRNAs was bound to a methionine modified by formylation, called formylmethionine-tRNAfmet (or fmet-tRNAf for short). The other was methionine-tRNAmet (met-tRNAmet for short), charged with an unmodified methionine.
Methionine and formylated methionine are shown below.
tRNAmet and tRNAf each have an anticodon to AUG, the only codon for methionine, but have different base sequences encoded by different tRNA genes. tRNAmet is used to insert methionine in the middle of a polypeptide. tRNAf is the initiator tRNA, and is only used to start new polypeptides with formylmethionine. In prokaryotes, methionine on met-tRNAf is formylated at its amino group to make the fmet-tRNAf. The formylating enzyme that does this does not recognize methionine on met-tRNAmet.
In E. coli, a formylase enzyme removes the formyl group from all N-terminal formyl methionines at some point after translation has begun. As we noted, the methionine itself (and sometimes more N-terminal amino acids) are also removed from about 60% of E. coli polypeptides. Eukaryotes have inherited both the initiator tRNAf and the tRNAmet, using only met-tRNAf during initiation. However, methionine on the eukaryotic initiator met-tRNAf is never formylated in the first place. What’s more, methionine is absent from virtually all mature eukaryotic polypeptides.
Early in evolution, the need for an initiator tRNA must have ensured a correct starting point for translation on an mRNA and therefore growth of a polypeptide from one end to the other, that is, from its N- to its C-terminus. At one time, formylation of the N-terminal methionine may have served to block accidental addition of amino acids or other modifications at the N-terminus of a polypeptide. Today, formylation seems to be a kind of molecular appendix in bacteria. Since then, evolution (in eukaryotes at least) has selected other features to replace actual formylation as the protector of the N-terminus of polypeptides.
2. Initiation
Now that we have charged the tRNAs, we can look more closely at the three steps of translation. Understanding translation initiation began with a molecular dissection of the components of E. coli cells required for cell-free (in vitro) protein synthesis, including cell fractionation, protein purification and reconstitution experiments. Initiation starts with when the Shine-Delgarno sequence forms Hbonds with a complementary sequence in the 16S rRNA bound to 30S ribosomal subunit. The Shine-Delgarno sequence is a short nucleotide sequence in the 5’ untranslated region (5’-UTR) of the messenger RNA, just upstream of the initiator AUG codon. This requires the participation of initiation factors IF1 and IF3. In this event, IF1 and IF3 as well as the mRNA are bound to the 30S ribosomal subunit (below).
Demonstration of the binding of an mRNA to a ribosomal subunit required isolation and separation of the 30S ribosomal subunit, an RNA fraction of the cell, and the purification of initiation factor proteins from the bacterial cells. This was followed by reconstitution (adding the separated fractions back together) in the correct order show that mRNA would only bind to the 30S subunit in the presence of the two specific initiation factor proteins.
206 Translation Initiation: mRNA Associates with 30S Ribsomal Subunit
Next, with the help of GTP and another initiation factor (IF2), the initiator fmettRNAf recognizes and binds to the AUG start codon found in all mRNAs. Some call the resulting structure (shown below) the Initiation Complex, which includes the 30S ribosomal subunit, Ifs 1, 2 and 3, and the fmet-tRNAf.
207 Initiation Complex Formation
In the last step of initiation, the large ribosomal subunit binds to this complex. IFs 1, 2 and 3 disassociate from the ribosome and the initiator fmet-tRNAfmet ends up in the P site of the ribosome.
Some prefer to call the structure formed at this point the initiation complex (below).
208 Adding the Large Ribosomal Subunit
Initiation can happen multiple times on a single mRNA, forming the polyribosome, or polysome described in Chapter 1. Each of the complexes formed above will engage in the elongation of a polypeptide described next.
3. Elongation
Elongation is a sequence of protein factor-mediated condensation reactions and ribosome movements along an mRNA. As you will see, polypeptide elongation requires a considerable input of free energy.
a) Elongation 1
The first step in elongation is the entry of the next aminoacyl-tRNA (aa2- tRNAaa2), which requires the free energy of GTP hydrolysis. The energy is supplied by the hydrolysis of GTP bound elongation factor 2 (EF2-GTP). The aa2-tRNAaa2 enters the ribosome based on codon-anticodon interaction at the A site as shown below.
The GDP dissociates from EF2 as aa2-tRNAaa2 binds the anticodon in the A site. To keep elongation moving along, elongation factor (EF3) rephosphorylates the GDP to GTP, which can re-associate with free EF2.
209 Elongation: Elongation Factors and GTP
b) Elongation 2
Peptidyl transferase, a ribozyme component of the ribosome itself, links the incoming amino acid to a growing chain in a condensation reaction.
In this reaction, the fmet is transferred from the initiator tRNAf in the P site to aa2-tRNAaa2 in the A site, forming a peptide linkage with aa2.
210 Elongation: A Ribozyme Catalyzes Peptide Linkage Formation
c) Elongation 3
Translocase catalyzes GTP hydrolysis as the ribosome moves (translocates) along the mRNA. After translocation, the next mRNA codon shows up in the A site of the ribosome and the first tRNA (in this example, tRNAf) ends up on the E site of the ribosome.
The movement of the ribosome along the mRNA is illustrated below.
The tRNAf, no longer attached to an amino acid, will exit the E site as the next (3rd) aa-tRNA enters the empty A site, based on a specific codon-anticodon interaction (assisted by elongation factors and powered by GTP hydrolysis) to begin another cycle of elongation. Note that in each cycle of elongation, an ATP is consumed to attach each amino acid to its tRNA, and two GTPs are hydrolyzed in the cycle itself. In other words, at the cost of three NTPs, protein synthesis is the most expensive polymer synthesis reaction in cells!
212 Adding the Third Amino Acid
213 Big Translation Energy Costs
As polypeptides elongate, they eventually emerge from a groove in the large ribosomal subunit. As noted, a formylase enzyme in E. coli cytoplasm removes the formyl group from the exposed initiation fmet from all growing polypeptides. While about 40% of E. coli polypeptides still begin with methionine, specific proteases catalyze the hydrolytic removal of the amino-terminal methionine (and sometimes even more amino acids) from the other 60% of polypeptides. The removal of the formyl group and one or more N-terminal amino acids from new polypeptides are examples of post-translational processing.
214 The Fates of fMet and Met: Cases of Post-Translational Processing
4. Termination
Translation of an mRNA by a ribosome ends when translocation exposes one of the three stop codons in the A site of the ribosome. Stop codons are not situated some distance from the 3’ end of an mRNA. The region between a stop codon to the end of the mRNA is called the 3’ untranslated region of the messenger RNA (3’UTR).
Since there is no aminoacyl-tRNA with an anticodon to the stop codons (UAA, UAG or UGA), the ribosome actually stalls and the translation slow-down is just long enough for a protein termination factor to enter the A site. This interaction causes release of the new polypeptide and the disassembly of the ribosomal subunits from the mRNA. The process requires energy from yet another GTP hydrolysis. After dissociation, ribosomal subunits can be reassembled with an mRNA for another round of protein synthesis. Translation termination is illustrated below.
215 Translation Termination
We have seen some examples of post-translational processing (removal of formyl groups in E. coli, removal of the N-terminal methionine from most polypeptides, etc.) Most proteins, especially in eukaryotes, undergo one or more additional steps of posttranslational processing before becoming biologically active. We will see examples in upcoming chapters.
Let’s conclude this chapter with a “we thought we knew everything” moment! A recent study reports that ribosomes can sometimes re-initiate translation in the 3’ UTR of an mRNA using AUG codons upstream of the normal start codon of the mRNA. There is evidence that the resulting short polypeptides may be functional! Click here to read more: here.
11.05: Key Words and Terms
64 codons genetic code ribonucleoprotein
adapter molecules initiation ribosome
amino terminus initiation complex small ribosomal subunit
aminoacyl tRNA initiation factors start codon
aminoacyl tRNA synthase large ribosomal subunit termination
anticodon meaningful codons termination factor
AUG mRNA, tRNA translocation
bacterial bound ribosomes nascent chains triplets
Carboxyl-terminus ochre, amber, opal tRNA v. tRNAaa
colinearity peptide linkage UAG, UUA, UGA
comma-less genetic code peptidyl transferase universal genetic code
degenerate genetic code polypeptide UUU
elongation polysome Wobble Hypothesis
free v. bound ribosomes reading phase | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/11%3A_The_Genetic_Code_and_Translation/11.04%3A_Translation.txt |
• 12.1: Introduction
Cells regulate their metabolism in several ways. We have already that allosterically regulated enzymes monitor the cellular levels of metabolites. Recall that glycolytic intermediates rise and fall in cells based on cellular energy needs, binding to or dissociating from allosteric sites
• 12.2: Gene Regulation in Prokaryotes
Many prokaryotic genes are organized in operons, linked genes transcribed into a single mRNA encoding two or more proteins. Operons usually encode proteins with related functions. Regulating the activity of an operon (rather than multiple single genes encoding single proteins) allows better coordination of the synthesis of several proteins at once. In E. coli, the regulated lac operon encodes three enzymes involved in the metabolism of lactose (an alternative nutrient to glucose).
• 12.3: The Problem with Unregulated (Housekeeping) Genes in All Cells
Before we turn our attention to the regulation of gene expression in eukaryotes, consider for a moment the expression of constitutive, or housekeeping, genes that are always active. The requirement that some genes are always “on” raises questions about cellular priorities of gene expression. Constitutive gene products are sets of many polypeptides that form large macromolecular complexes in cells, or enzyme sets that participate in vital biochemical pathways.
• 12.4: Gene Regulation in Eukaryotes
Results of this experiment provided the evidence that even very different cells of an organism contain the same genes. In fact, in any multicellular eukaryotic organism, every cell contains the same DNA (genes). Therefore, the different cell types in an organism differ not in which genes they contain, but which sets of genes they express! Looked at another way, cells differentiate when they turn on new genes and turn off old ones.
• 12.5: Epigenetics
Aristotle thought that an embryo emerged from an amorphous mass, a “less fully concocted seed with a nutritive soul and all bodily parts”. The much later development of the microscope led to more detailed (if inaccurate) descriptions of embryonic development. In 1677, no less a luminary than Anton von Leeuwenhoek, looking at a human sperm with his microscope, thought he saw a miniature human inside! The tiny human, or homunculus, became the epitome of preformation theory.
• 12.6: Key Words and Terms
12: Regulation of Transcription and Epigenetic Inheritance
Cells regulate their metabolism in several ways. We have already that allosterically regulated enzymes monitor the cellular levels of metabolites. Recall that glycolytic intermediates rise and fall in cells based on cellular energy needs, binding to or dissociating from allosteric sites. Allosteric enzymes respond to interaction with allosteric effectors with an increase or decrease in catalytic activity.
Cells can also control absolute levels of enzymes and other proteins by turning genes on and off, typically by controlling transcription. Transcription regulation usually starts with extracellular environmental signaling. The signals are chemicals in the in the air, in the water, or in the case of multicellular organisms, in blood, lymph or other extracellular fluids. Bacterial and protist genes often respond to environmental toxins or fluctuating nutrient levels. Familiar signal molecules in higher organisms include hormones released at the appropriate time in a sequential developmental program of gene expression, or in response to nutrient levels in body fluids.
Some signal molecules get into cells binding to specific intracellular receptors to convey their instructions. Others bind to cell surface receptors that transduce their ‘information’ into intracellular molecular signals. When signaling leads to gene regulation, responding cells ultimately produce transcription factors. These in turn recognize and bind to specific regulatory DNA sequences associated with the genes that they control. DNA sequences that bind transcription factors are relatively short. They can lie proximal (close) to the transcription start site of a gene, and/or in the case of eukaryotes, distal to (far from) it. We will see that binding some regulatory DNA sequences are enhancers, turning on or increasing gene transcription. Others are silencers, down-regulating, or suppressing transcription of a gene. Finally, DNA regulatory sequences are hidden behind a thicket of chromatin proteins in eukaryotes. When patterns of gene expression in cells change during development, chromatin is re-organized, cells differentiate, and new tissues and organs form. To this end, new patterns of gene expression and chromatin configuration in a cell must be remembered in its descendants. CMB3e 257
In this chapter, we look at the path from cell recognition of a signal molecule to the interaction of regulatory proteins with DNA in both prokaryotic and eukaryotic cells. We also consider how eukaryotic cells remember instructions that alter chromatin configuration and patterns of gene expression, topics in the field of epigenetics.
Learning Objectives
When you have mastered the information in this chapter, you should be able to:
1. Compare and contrast transcription factors and so-called cis-acting elements.
2. Discuss the role of DNA bending in the regulation of gene expression.
3. Explain the benefits of organizing bacterial genes into operons, and why some bacterial genes are not part of operons
4. Compare and contrast regulation of the lac and trp operons in E. coli.
5. Define and describe regulatory genes and structural genes in E. coli.
6. Discuss why a fourth gene was suspected in lac operon regulation.
7. Distinguish between gene repression and de-repression and between positive and negative gene regulation, using examples. For example, explain how it is possible to have repression by positive regulation.
8. Draw and label all functional regions of prokaryotic and eukaryotic genes.
9. Compare and contrast different mechanisms of gene regulation in eukaryotic cells.
10. Describe the transcription initiation complex of a regulated gene in eukaryotes.
11. Define and articulate differences between gene expression and transcription regulation.
12. Define a gene
13. Distinguish between the roles of enhancers and other cis-acting elements in transcription regulation.
14. Compare and contrast the genome and the epigenome. | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/12%3A_Regulation_of_Transcription_and_Epigenetic_Inheritance/12.01%3A_Introduction.txt |
Many prokaryotic genes are organized in operons, linked genes transcribed into a single mRNA encoding two or more proteins. Operons usually encode proteins with related functions. Regulating the activity of an operon (rather than multiple single genes encoding single proteins) allows better coordination of the synthesis of several proteins at once. In E. coli, the regulated lac operon encodes three enzymes involved in the metabolism of lactose (an alternative nutrient to glucose). Regulation of an operon (or of a single gene for that matter) can be by repression or by induction. When a small metabolite in a cell binds to a regulatory repressor or inducer protein, the protein undergoes an allosteric change that allows it to bind to a regulatory DNA sequence…, or to un-bind from the DNA. We will see examples of such regulation in the lac and trp operons. Lac operon gene regulation is an example of gene repression as well as induction. Trp (tryptophan) operon regulation is by gene repression. In both the operons, changes in levels of intracellular metabolites reflect the metabolic status of the cell and elicit appropriate changes in gene transcription. We will look at the regulation of both operons.
216 Overview of Prokaryotic Gene Regulation
The mRNA transcribed from the lac operon is simultaneously translated into those three enzymes, as shown below.
A. Mechanisms of Control of the Lac Operon
In the animal digestive tract (including ours), genes of the E. coli lac operon regulate the use of lactose as an alternative nutrient to glucose. Think cheese instead of chocolate! The operon consists of lacZ, lacY, and lacA genes that were called structural genes. By definition, structural genes encode proteins that participate in cell structure and metabolic function. As already noted, the lac operon is transcribed into an mRNA encoding the Z, Y and A proteins.
Let’s take a closer look at the structure of the lac operon and the function of the Y, Z and A proteins (below).
The lacZ gene encodes β-galactosidase, the enzyme that breaks lactose (a disaccharide) into galactose and glucose. The lacY gene encodes lactose permease, a membrane protein that facilitates lactose entry into the cells. The role of the lacA gene (a transacetylase) in lactose energy metabolism is not well understood. The I gene to the left of the lac Z gene is a regulatory gene (to distinguish it from structural genes). Regulatory genes encode proteins that interact with regulatory DNA sequences associated with a gene to control transcription. The operator sequence separating the I and Z genes is a transcription regulatory DNA sequence.
The E. coli lac operon is usually silent (repressed) because these cells prefer glucose as an energy and carbon source. In the presence of sufficient glucose, a repressor protein (the I gene product) is bound to the operator, blocking transcription of the lac operon. Even if lactose is available, cells will not be use it as an alternative energy and carbon source when glucose levels adequate. However, when glucose levels drop, the lac operon is active and the three enzyme products are translated. We will see how limiting glucose levels induce maximal lac operon transcription by both derepression and direct induction, leading to maximal transcription of the lac genes only when necessary (i.e., in the presence of lactose and absence of glucose). Let’s look at some of the classic experiments that led to our understanding of E. coli gene regulation in general, and of the lac operon in particular.
In the late 1950s and early 1960s, Francois Jacob and Jacques Monod were studying the use of different sugars as carbon sources by E. coli. They knew that wild type E. coli would not make the $\beta$-galactosidase, $\beta$-galactoside permease or $\beta$-galactoside transacetylase proteins when grown on glucose. Of course, they also knew that the cells would switch to lactose for growth and reproduction if they were deprived of glucose! They then searched for and isolated different E. coli mutants that could not grow on lactose, even when there was no glucose in the growth medium. Here are some of the mutants they studied:
1. One mutant failed to make active $\beta$-galactosidase enzyme but made permease.
2. One mutant failed to make active permease but made normal amounts of $\beta$-galactosidase.
3. Another mutant failed to make transacetylase..., but could still metabolize lactose in the absence of glucose. Hence the uncertainty of its role in lactose metabolism.
4. Curiosly, one mutant strain failed to make any of the three enzymes!
Since double mutants are very rare and triple mutants even rarer, Jacob and Monod inferred that the activation of all three genes in the presence of lactose were controlled together in some way. In fact, it was this discovery that defined the operon as a set of genes transcribed as a single mRNA, whose expression could therefore be effectively coordinated. They later characterized the repressor protein produced by the lacI gene. Jacob, Monod and Andre Lwoff shared the Nobel Prize in Medicine in 1965 for their work on bacterial gene regulation. We now know that negative and positive regulation of the lac operon (described below) depend on two regulatory proteins that together, control the rate of lactose metabolism.
1. Negative Regulation of the Lac Operon by Lactose
Refer to the illustration below to identify the players in lac operon derepression.
The repressor protein product of the I gene is always made and present in E. coli cells. I gene expression is not regulated! In the absence of lactose in the growth medium, the repressor protein binds tightly to the operator DNA. While RNA polymerase is bound to the promoter and ready to transcribe the operon, the presence of the repressor bound to the operator sequence close to the Z gene physically blocks its forward movement. Under these conditions, little or no transcript is made. If cells are grown in the presence of lactose, the lactose entering the cells is converted to allolactose. Allolactose binds to the repressor sitting on the operator DNA to form a 2-part complex, as shown below.
The allosterically altered repressor dissociates from the operator and RNA polymerase can transcribe the lac operon genes as illustrated below
2. Positive Regulation of the Lac Operon; Induction by Catabolite Activation
The second control mechanism regulating lac operon expression is mediated by CAP (cAMP-bound catabolite activator protein or cAMP receptor protein). When glucose is available, cellular levels of cAMP are low in the cells and CAP is in an inactive conformation. On the other hand, if glucose levels are low, cAMP levels rise and bind to the CAP, activating it. If lactose levels are also low, the cAMP-bound CAP will have no effect. If lactose is present and glucose levels are low, then allolactose binds the lac repressor causing it to dissociate from the operator region. Under these conditions, the cAMP-bound CAP can bind to the operator in lieu of the repressor protein. In this case, rather than blocking the RNA polymerase, the activated Camp-bound CAP induces even more efficient lac operon transcription. The result is synthesis of higher levels of lac enzymes that facilitate efficient cellular use of lactose as an alternative to glucose as an energy source. Maximal activation of the lac operon in high lactose and low glucose is shown below.
217 Regulation of the Lac Operon
cAMP-bound CAP is an inducer of transcription. It does this by forcing the DNA in the promoter-operator region to bend. And since bending the double helix loosens H-bonds, it becomes easier for RNA polymerase to find and bind the promoter on the DNA strand to be transcribed…, and for transcription to begin. cAMP-CAPinduced bending of DNA is illustrated below.
3. Lac Operon Regulation by Inducer Exclusion and Multiple Operators
In recent years, additional layers of lac operon regulation have been uncovered. In one case, the ability of lac permease to transport lactose across the cell membrane is regulated. In another, additional operator sequences have been discovered to interact with a multimeric repressor to control lac gene expression.
a) Regulation of Lactose use by Inducer Exclusion
When glucose levels are high (even in the presence of lactose), phosphate is consumed to phosphorylate glycolytic intermediates, keeping cytoplasmic phosphate levels low. Under these conditions, unphosphorylated EIIAGlc binds to the lactose permease enzyme in the cell membrane, preventing it from bringing lactose into the cell.
The role of phosphorylated and unphosphorylated EIIAGlc in regulating the lac operon are shown below.
High glucose levels block lactose entry into the cells, effectively preventing allolactose formation and the derepression of the lac operon. Inducer exclusion is thus a logical way for the cells to handle an abundance of glucose, whether or not lactose is present. On the other hand, if glucose levels are low in the growth medium, phosphate concentrations in the cells rise sufficiently for a specific kinase to phosphorylate the EIIAGlc. Phosphorylated EIIAGlc then undergoes an allosteric change and dissociates from the lactose permease, making it active so that more lactose can enter the cell. In other words, the inducer is not “excluded” under these conditions!
The kinase that phosphorylates EIIAGlc is part of a phosphoenolpyruvate (PEP)- dependent phosphotransferase system (PTS) cascade. When extracellular glucose levels are low, the cell activates the PTS system in an effort to bring whatever glucose is around into the cell. But the last enzyme in the PTS phosphorylation cascade is the kinase that phosphorylates EIIAGlc. Phosphorylated EIIAGlc dissociates from the lactose permease, re-activating it, bringing available lactose into the cell from the medium.
b) Repressor Protein Structure and Additional Operator Sequences
The lac repressor is a tetramer of identical subunits (below).
Each subunit contains a helix-turn-helix motif capable of binding to DNA. However, the operator DNA sequence downstream of the promoter in the operon consists of a pair of inverted repeats spaced apart in such a way that they can only interact two of the repressor subunits, leaving the function of the other two subunits unknown… that is, until recently!
Two more operator regions were recently characterized in the lac operon. One, called O2, is within the lac z gene itself and the other, called O3, lies near the end of, but within the lac I gene. Apart from their unusual location within actual genes, these operators, which interact with the remaining two repressor subunits, went undetected at first because mutations in the O2 or the O3 region individually do not contribute substantially to the effect of lactose in derepressing the lac operon. Only mutating both regions at the same time results in a substantial reduction in binding of the repressor to the operon.
B. Mechanism of Control of the Tryptophan Operon
If ample tryptophan (trp) is available, the tryptophan synthesis pathway can be inhibited in two ways. First, recall how feedback inhibition by excess trp can allosterically inhibit the trp synthesis pathway. A rapid response occurs when tryptophan is present in excess, resulting in rapid feedback inhibition by blocking the first of five enzymes in the trp synthesis pathway. The trp operon encodes polypeptides that make up two of these enzymes.
Enzyme 1 is a multimeric protein, made from polypeptides encoded by the trp5 and trp4 genes. The trp1 and trp2 gene products make up Enzyme 3. If cellular tryptophan levels drop because the amino acid is rapidly consumed (e.g., due to demands for proteins during rapid growth), E. coli cells will continue to synthesize the amino acid, as illustrated below.
On the other hand, if tryptophan consumption slows down, tryptophan accumulates in the cytoplasm. Excess tryptophan will bind to the trp repressor. The trp-bound repressor then binds to the trp operator, blocking RNA polymerase from transcribing the operon. The repression of the trp operon by trp is shown below.
In this scenario, tryptophan is a co-repressor. The function of a co-repressor is to bind to a repressor protein and change its conformation so that it can bind to the operator.
219 Repression of the Tryptophan (TRP) Operon
12.03: The Problem with Unregulated (Housekeeping) Genes in All Cells
Before we turn our attention to the regulation of gene expression in eukaryotes, consider for a moment the expression of constitutive, or housekeeping, genes that are always active. The requirement that some genes are always “on” raises questions about cellular priorities of gene expression. Constitutive gene products are sets of many polypeptides that form large macromolecular complexes in cells, or enzyme sets that participate in vital biochemical pathways. How do cells maintain such polypeptides in stoichiometrically reasonable amounts? Or, can their levels rise or fall transiently without much effect? Recent studies suggest that transcription of housekeeping genes is in fact, not at all coordinated! Nevertheless, we also saw that the efficiency of glycolysis relied on the evolution of allosteric regulatory mechanisms to control the activities of glycolytic enzymes rather than their transcription. While this takes care some element of metabolic control, a problem remains. Recall that protein synthesis is energy-intensive, each peptide linkage costing three NTPs (not to mention the waste of an additional NTP per phosphodiester linkage made in transcription of an mRNA!). The overproduction of proteins under any circumstances would seem to be a waste of energy. We may not know just how expensive it is to express housekeeping genes. But whatever they are, these energy expenses are the cost of evolving complex structures and biochemical pathways vital to their everyday function and survival. Now back to our focus on regulated gene expression… in eukaryotes. | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/12%3A_Regulation_of_Transcription_and_Epigenetic_Inheritance/12.02%3A_Gene_Regulation_in_Prokaryotes.txt |
A. The Difference between Eukaryotic and Prokaryotic Gene Regulation
Let's Recall an experiment described earlier and illustrated below.
Results of this experiment provided the evidence that even very different cells of an organism contain the same genes. In fact, in any multicellular eukaryotic organism, every cell contains the same DNA (genes). Therefore, the different cell types in an organism differ not in which genes they contain, but which sets of genes they express! Looked at another way, cells differentiate when they turn on new genes and turn off old ones. Thus, gene regulation produces different sets of gene products during differentiation, leading to cells that look and function differently in the organism.
220 An Experiment: All of an Organism's Cells Have the Same Genome
Compared to prokaryotes, many steps in eukaryotes lie between transcription of an mRNA and the accumulation of a polypeptide end product. Eleven of these steps are shown in the pathway from gene to protein below.
Theoretically, cells could turn on, turn off, speed up or slow down any of the steps in this pathway, changing the steady state concentration of a polypeptide in the cells. While regulation of any of these steps is possible, the expression of a single gene is typically controlled at only one or a few steps. A common form of gene regulation is at the level of transcription initiation, similar to transcriptional control in bacteria, in principle if not in detail.
221 Many Options for Regulating Eukaryotic Genes
B. Complexities of Eukaryotic Gene Regulation
Gene regulation in eukaryotes is more complex than in prokaryotes. This is in part because their genomes are larger and because they encode more genes. For example, the E. coli genome houses about 5,000 genes, compared to around 25,000 genes in humans. Furthermore, eukaryotes can produce even more than 25,000 proteins by alternative splicing of mRNAs and in at least a few cases, by initiating transcription from alternative start sites in the same gene. And of course, the activity of many more genes must be coordinated without the benefit of multigene operons! Finally, eukaryotic gene regulation is made more complicated because all nuclear DNA is wrapped in protein in the form of chromatin.
All organisms control gene activity with transcription factors that bind to specific DNA sequences (cis regulatory elements). In eukaryotes, these elements can be proximal to (near) the promoter of a gene, or distal to (quite far from) the gene they regulate. A eukaryotic map showing the components of a typical gene and its associated cis-acting regulatory elements is shown below.
Enhancers are typical distal cis elements that recognize and bind transcription factors to increase the rate of transcription of a gene. Oddly enough, these short DNA elements can be in the 5’ or 3’ non-translated region of the gene, or even within introns, and can lie thousands of base pairs away from the genes they control. Note that enhancer elements are even in introns can also be very far from the start-site of transcription of a gene.
Upstream regulatory regions of eukaryotic genes (to the left of a gene promoter as shown above) often have distal binding sites for more than a few transcription factors, some with positive (enhancing) and others with negative (silencing) effects. Of course, which of these DNA regions are active in controlling a gene depends on which transcription factor(s) are present in the nucleus. Sets of positive regulators will work together to coordinate and maximize gene expression when needed, and sets of negative regulators will bind negative regulatory elements to silence a gene.
222 Transcription Factors Bind DNA Near and Far
We saw that in eukaryotes, the initiation of transcription involves many transcription factors and RNA polymerase II acting at a gene promoter to form a transcription preinitiation complex. TFIID, or TATA binding protein is one of the first factors to bend, causing the DNA in the promoter region to bend, much like the CAP protein in bacteria. TFIID also recruits other transcription factors to the promoter. As in bacteria, bending the DNA loosens H-bonds between bases, facilitating unwinding the double helix near the gene. Bending eukaryotic DNA also brings distal regulatory proteins bound to enhancer sequences far from the promoter together with the proteins bound to more proximal regulatory elements, as shown in the drawing below.
Nucleotide methyation sites may facilitate regulatory protein-enhancer binding. When such regulatory proteins, here called activators (i.e., of transcription), bind to their enhancers, they acquire an affinity for protein cofactors that enable recognition and binding to other proteins in the transcription initiation complex. This attraction stabilizes the bend in the DNA that then makes it easier for RNA polymerase II to initiate transcription
223 Assembling a Eukaryotic Transcription Initiation Complex
It is worth reminding ourselves that it is shape and allosteric change that allow DNAprotein interactions (in fact, any interactions of macromolecules). The lac repressor we saw earlier is a transcription factor with helix-turn-helix DNA binding motifs. This motif and two others (zinc finger, and leucine zipper) characterize DNA binding proteins are illustrated below.
DNA-binding motifs in each regulatory protein shown here bind one or more regulatory elements ‘visible’ to the transcription factor in the major groove of the double helix.
224 Transcription Factor Domains/Motifs Bind Specific DNA Sequences
We will look next at some common ways in which eukaryotic cells are signaled to turn genes on or off, or to increase or decrease their rates of transcription. As we describe these models, remember that eukaryotic cells regulate gene expression in response to changes in extracellular environments. These can be unscheduled, unpredictable changes in blood or extracellular fluid composition (ions, small metabolites), or dictated by changes in a long-term genetic program of differentiation and development. Changes in gene expression even obey circadian (daily) rhythms, the ticking of a clock. In eukaryotes, changes in gene expression, expected or not, are usually mediated by the timely release of chemical signals from specialized cells (e.g., hormones, cytokines, growth factors, etc.). We will focus on some betterunderstood models of gene regulation by these chemical signals.
C. Regulation of Gene Expression by Hormones that enter Cells and Those That Don't
Gene-regulatory (cis) elements in DNA and the transcription factors that bind to them have co-evolved. But not only that! Eukaryotic organisms have evolved complete pathways that respond to environmental or programmed developmental cues and lead to an appropriate cellular response. Chemicals that regulate genes in prokaryotes are not usually signals communicated by other cells. In eukaryotes, chemicals released by some cells signal other cells to respond, thus coordinating the activity of the whole organism. Hormones released by cells in endocrine glands are well-understood signal molecules; hormones affect target cells elsewhere in the body.
225 Chemicals That Control Gene Expression
1. How Steroid Hormones Regulate Transcription
Steroid hormones cross the cell membranes to have their effects. Common steroid hormones include testosterone, estrogens, progesterone, glucocorticoids and mineral corticoids. Once in target cell, such hormones bind to a steroid hormone receptor protein to form a steroid hormone-receptor complex. The receptor may be in the cytoplasm or in the nucleus, but in the end, the hormone-receptor complex must bind to DNA regulatory elements of a gene to either enhance or silence transcription. Therefore, a steroid hormone must cross the plasma membrane, and may also need to cross the nuclear envelope.
Follow the Binding of a steroid hormone to a cytoplasmic receptor below.
Here the hormone (the triangle) enters the cell. An allosteric change in the receptor releases a protein subunit called Hsp90 (the black rectangle in the illustration). The remaining hormone-bound receptor enters the nucleus.
The fascinating thing about Hsp90 is that it was first discovered in cells subjected to heat stress. When the temperature gets high enough, cells shut down most transcription and instead transcribe Hsp 90 and/or other special heat shock genes. The resulting heat shock proteins seem to protect the cells against metabolic damage until temperatures return to normal. Since most cells never experience such high temperatures, the evolutionary significance of this protective mechanism is unclear. As we now know, heat shock proteins have critical cellular functions, in this case blocking the DNA-binding site of a hormone receptor until a specific steroid hormone binds to it.
Back to hormone action! No longer associated with the Hsp90 protein, the receptor bound to its hormone cofactor binds to a cis-acting transcription control element in the DNA, turning transcription of a gene on or off. The hormone receptors for some steroid hormones are already in the nucleus of the cell, so the hormone must cross not only the plasma membrane, but also the nuclear envelope in order to access the receptor.
As for steroid hormone functions, we already saw that glucocorticoids turn on the genes of gluconeogenesis. Steroid hormones also control sexual development and reproductive cycling in females, salt and mineral homeostasis in the blood, metamorphosis in arthropods, etc., all by regulating gene expression.
226 Steroid Hormones Regulate Gene Transcription
2. How Protein Hormones Regulate Transcription
Protein hormones are of course large and soluble, with highly charged surfaces. Other hormones might be relatively small (e.g., adrenalin), but are charged. Large or highly charged signal molecules cannot get across the phospholipid barrier of the plasma membrane. To have any effect at all, they must bind to receptors on the surface of cells. These receptors are typically membrane glycoproteins.
The information (signals) carried by protein hormones must be conveyed into the cell indirectly, by a process called signal transduction. There are two well-known pathways of signal transduction, each of which involves activating pathways of protein phosphorylation in cytoplasm. The phosphorylation cascade that results activates a transcription factor that binds to regulatory DNA, turning a gene on or off.
Binding of a hormone to a cell surface receptor leads to an allosteric change in the receptor. This in turn activates other proteins either in the plasma membrane or in the cytoplasm, leading to the synthesis of a cytoplasmic second messenger. The second messenger typically binds to a protein kinase in the cytoplasm, launching a series of protein phosphorylations, or a phosphorylation cascade. The last in the series of proteins to be phosphorylated is an activated transcription factor that will bind to a cis-regulatory DNA sequence.
cAMP was the first second messenger metabolite to be discovered. It mediates many hormonal responses, controlling both gene activity and enzyme activity. cAMP forms when the hormone-receptor in the membrane binds to and activates a membrane-bound adenylate cyclase enzyme. The cAMP produced then binds to a protein kinase, the first of several in a phosphorylation cascade. Signal transduction mediated by cAMP is summarized in the illustration below.
A different kind of signal transduction involves a hormone receptor that is itself the protein kinase. The role of enzyme-linked hormone receptors in signal transduction is summarized below.
Binding of the signal protein (e.g. hormone) to the enzyme-linked receptor causes an allosteric change that activates the receptor kinase, starting phosphorylation cascade resulting in an active transcription factor. We look at signal transduction in more detail in another chapter.
227 Signal Transduction Can Lead to Gene Regulation
D. Regulating Eukaryotic Genes Means Contending with Chromatin
Consider again the illustration of the different levels of chromatin structure (below).
Transcription factors bind specific DNA sequences by detecting them through the grooves (mainly the major groove) in the double helix. The drawing above reminds us however, that unlike the nearly naked DNA of bacteria, eukaryotic (nuclear) DNA is coated with proteins that, in aggregate are by mass, greater than the mass of DNA that they cover. The protein-DNA complex of the genome is of course, chromatin.
Again, as a reminder, DNA coated with histone proteins forms the 9 nm diameter beads-on-a-string structure in which the beads are the nucleosomes. The association of specific non-histone proteins causes the nucleosomes to fold over on themselves to form the 30 nm solenoid. As we saw earlier, it is possible to selectively extract chromatin. Take a second look at the results of typical extractions of chromatin from isolated nuclei below.
Further accretion of non-histone proteins leads to more folding and the formation of euchromatin and heterochromatin characteristic of non-dividing cells. In dividing cells, the chromatin further condenses to form the chromosomes that separate during either mitosis or meiosis.
Recall that biochemical analysis of the 10 nm filament extract revealed that the DNA wraps around histone protein octamers, the nucleosomes or beads in this beads-on-astring structure. Histone proteins are highly conserved in the eukaryotic evolution (they are not found in prokaryotes). They are also very basic (many lysine and arginine residues) and therefore very positively charged. This explains why they are able to arrange themselves uniformly along DNA, binding to the negatively charged phosphodiester backbone of DNA in the double helix.
Since the DNA in euchromatin is less tightly packed than it is in heterochromatin, perhaps active genes are to be found in euchromatin and not in heterochromatin. Experiments in which total nuclear chromatin extracts were isolated and treated with the enzyme deoxyribonuclease (DNAse) revealed that the DNA in active genes was degraded more rapidly than non-transcribed DNA. More detail on these experiments can be found in the two links below.
228 Question: Is Euchromatic DNA Transcribed?
229 Experiment and Answer: Euchromatin is Transcribed
The results of such experiments are consistent with the suggestion that active genes are more accessible to DNAse because they are in less coiled, or less condensed chromatin. DNA in more condensed chromatin is surrounded by more proteins, and thus is less accessible to, and protected from DNAse attack. When packed up in chromosomes during mitosis or meiosis, all genes are largely inactive.
Regulating gene transcription must occur in non-dividing cells or during the interphase of cells, where changing the shape of chromatin (chromatin remodeling) in order to silence some and activate other genes is possible. Changing chromatin conformation involves chemical modification of chromatin proteins and DNA. For example, chromatin can be modified by histone acetylation, de-acetylation, methylation and phosphorylation, reactions catalyzed by histone acetyltransferases (HAT enzymes), de-acetylases, methyl transferases and kinases, respectively. For example, acetylation of lysines near the amino end of histones H2B and H4 tends to unwind nucleosomes and open the underlying DNA for transcription. De-acetylation then, promotes condensation of the chromatin in the affected regions of DNA. Likewise, methylation of lysines or arginines (the basic amino acids that characterize histones!) of H3 and H4 can open DNA for transcription, while demethylation has the opposite effect. In one case, di-methylation of a lysine in H3 can suppress transcription. These chemical modifications affect recruitment of other proteins that alter chromatin conformation and ultimately activate or block transcription.
This reversible and its effect on chromatin are illustrated below.
Nucleosomes themselves can be moved, slid and otherwise repositioned by complexes that hydrolyze ATP for energy to accomplish the physical shifts. Some cancers are associated with mutations in genes for proteins involved in chromatin remodeling. This is no doubt, because failures of normal remodeling could adversely affect normal cell cycling and normal replication. In fact, a single, specific pattern of methylation may mark DNA in multiple cancer types (check out Five Cancers with the Same Genomic Signature - Implications).
E. Regulating all the Genes on a Chromosome at Once
Recall that X chromosomes in human female somatic cells is inactivated, visible in the nucleus as a Barr body. One of the two X chromosomes in female fruit flies is also inactivates. However, both males and females of Drosophila (presumably also us!) require X chromosome gene expression during embryogenesis. Given the difference in X chromosome gene dosage between males and females, do males get by with fewer X chromosome gene products than females?
Experiments looking at the expression of X chromosome gene in male and female flies revealed similar levels of gene products. It turns out that the activity of a nuclear body called HLB (Histone Locus Body) is required for increase in X chromosome gene transcription. A protein, called CLAMP (Chromatin-Linked Adaptor for Male-specific lethal (MSL) Protein), was shown to bind to GAGA nucleotide repeats lying between the genes for histones 3 and 4. As there are about 100 repeats of the fivegene histone locus on X chromosomes, and thus about 100 repeats of the GAGA repeats. Therefore, many CLAMP proteins bind to the HLBs, where they recruit many MSL proteins. The MSL protein complexes that form then globally increase male X chromosome gene expression, compensating for the lower X gene dosage in males. Read the original research here (L.E. Reider et al. (2018) Genes & Development 31:1-15). And finally, there is emerging evidence that the HLB action may also be involved in inactivation of an entire female X chromosome later in embryogenesis in females! | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/12%3A_Regulation_of_Transcription_and_Epigenetic_Inheritance/12.04%3A_Gene_Regulation_in_Eukaryotes.txt |
Aristotle thought that an embryo emerged from an amorphous mass, a “less fully concocted seed with a nutritive soul and all bodily parts”. The much later development of the microscope led to more detailed (if inaccurate) descriptions of embryonic development. In 1677, no less a luminary than Anton von Leeuwenhoek, looking at a human sperm with his microscope, thought he saw a miniature human inside! The tiny human, or homunculus, became the epitome of preformation theory.
William Harvey, also in the 17 th century, described changes in morphology in the developing embryos of chickens (and other animals). Harvey coined the term epigenesis to counter the notion that any tiny adult structures in eggs or sperm simply grew bigger during embryonic gestation. Meanwhile, other experiments were leading embryologists to the conclusion that the physical and chemical environment of an embryo strongly affected development. Thus temperature, pH, and in the case of chicken eggs, position of incubation, affect embryonic development. In a series of very elegant experiments reported in 1924, Hans Speeman reported that cells associated with differentiation of one region of an embryo could be transplanted to a different part of the same embryo, or to another embryo entirely, where it would induce new tissue development. He won the 1935 Nobel Prize in Physiology and Medicine for his discovery of embryonic organizers that induced morphogenesis.
Other embryologists (including Conrad Waddington) demonstrated that cells killed by freezing or boiling still induced morphogenesis after being placed on an embryo. Thus, actual chemicals influence embryogenesis. The fact that differences in physical or chemical environment could affect embryonic development led many to conclude that environment played the dominant role and that genes played only a minor one in an organism’s ultimate phenotype. Unlike most of his fellow embryologists, Waddington believed in a more equitable role of genes and environment in determining phenotype. Adapting the term epigenesis, he coined the term epigenetics to describe the impact of environment on embryonic development (1942, The Epigenotype. Endeavour. 1: 18–20).
At the time, the concept of epigenetics led to a nature vs. nurture controversy. We now understand that differences in environmental influence can cause individuals with the same genes (genotype) to vary in appearance (phenotype). A modern version of thenature vs. nurture argument has more to do with complex traits, for example how much do genetics vs. environment influence intelligence, psychology and behavior. There is much to-do and little evidence to resolve these questions…, and likely too many factors affecting these traits to separate them experimentally.
These days, the field of epigenetics looks closely at protein interactions in eukaryotes affecting gene expression. These interactions change the structure NOT of genes (or DNA), but of the proteins (and other molecules) that affect how DNA and genes are used. As we have seen, the control of transcription involves transcription factors that recognize and bind to regulatory sequences in DNA such as enhancers or silencers. These proteinDNA interactions often require selective structural changes in the conformation of the chromatin surrounding genes. These changes can be profound and stable, and they are not easily undone.
An example of epigenetics is inheritance of chromatin protein alterations that accompany gene expression changes in development. Given an appropriate signal, say a hormone at the right time, a few cells respond with chromatin rearrangements and the expression of a new set of genes. The new pattern of gene expression defines a cell that has differentiated. Hundreds, even thousands of such changes accompany progress from fertilized egg to fully mature eukaryotic organism. Every one of these changes in a cell is passed on to future generations of cells by mitosis, accounting for different tissues and organs in the organism. Hence, the many different epigenomes representing our differentiated cells are heritable.
To sum up, epigenetics is the study of when and how undifferentiated cells (embryonic and later, adult stem cells) acquire their epigenetic characteristics and then pass on their epigenetic information to progeny cells. As we’ll see shortly, epigenetic inheritance is not limited to somatic cells, but can span generations! First, let’s look at this brief history of our changing understanding of evolution.
Jean-Baptiste Lamarck proposed (for instance) that when a giraffe’s neck got longer so that it could reach food higher up in trees, that character would be inherited by the next giraffe generation. According to Lamarck, evolution was purposeful, with the goal of improvement.
Later, Darwin published his ideas about evolution by natural selection, where nature selects from pre-existing traits in individuals (the raw material of evolution). The individual that just randomly happens to have a useful trait then has a survival (and reproductive) edge in an altered environment.
Later still, the rediscovery of Mendel’s genetic experiments, it became increasingly clear that it is an organism’s genes that are inherited, are passed down the generations, and are the basis of an organism’s traits. By the start of the 20th century, Lamarck’s notion of purposefully acquired characters was discarded.
Epigenetic inheritance implies an epigenetic blueprint in addition to our DNA blueprint. This means that, in addition to passing on the genes of a male and female parent, epigenomic characteristics (which genes are expressed and when) are also passed to the next generation. Waddington suspected as much early on, calling the phenomenon genetic assimilation, and once again created controversy! Does genetic assimilation make Lamarck right after all? Prominent developmental biologists accused Waddington of promoting purposeful evolution. Waddington and others denied the accusation, trying to explain how epigenetic information might be heritable, without leading to purposeful evolution.
Is there in fact, an epigenetic code? Data from the small Swedish town of Överkalix led to renewed interest in epigenetic phenomena. Consider the meticulous harvest, birth, illness, death and other demographic and health records collected and analyzed by L. O. Bygren and colleagues at Sweden’s Karolinska Institute.
A sample of Bygren’s data is shown in the table below.
It looked to the good doctor as if environment was influencing inheritance! It is as if the environment was indeed causing an acquired change in the grandparent that is passed not to one, but through two generations… and in a sex-specific way!
230 Epigenetic Inheritance: First Inkling
This phenomenon was subsequently demonstrated experimentally with the exposure of pregnant rats to a toxin. Rat pups born to exposed mothers suffered a variety of illnesses. This might be expected if the toxic effects on the mother were visited on the developing pups, for example through the placenta. However, when the diseased male rat pups matured and mated with females, the pups in the new litter grew up suffering the same maladies as the male parent. This even though the pregnant females in this case were NOT exposed to the toxins. Because the original female was already pregnant when she was exposed, the germ line cells (eggs, sperm) of her litter had not suffered mutations in utero. This could only mean that epigenetic patterns of gene expression caused by the toxin in pup germ line cells (those destined to become sperm & eggs) in utero were retained during growth to sexual maturity, and then passed on to their progeny, even while gestating in a normal unexposed female.
For some interesting experimental findings on how diet influences epigenetic change in Drosophila click here. For recent evidence for a role of male DNA methylation in trans-generational epigenetic inheritance, check out this link.
These days, the term epigenetics describes heritable changes in chromatin modifications and gene expression. We now know that epigenetic configurations of chromatin that are most stable include patterns of histone modification (acetylation, phosphorylation, methylation…) or DNA (methylation, phosphorylation…). Such changes can convert the 30nm fiber to the 10nm ‘beads-on-a-string’ nucleosome necklace… and vice versa. Such changes in chromatin (chromatin remodeling) lead to altered patterns of gene expression, whether during normal development or when deranged by environmental factors (abundance or limits on nutrition, toxins/poisons or other life-style choices). The active study of DNA methylation patterns even has its own name, methylomics! Check out Epigenetics Definitions and Nomenclature for more epigenetic nomenclature.
Let’s close this chapter with a question and some observations. Can you be sure that your smoking habit will not affect the health of your children or grandchildren? What about your eating habits? Drinking? It is not a little scary to know that I have a gullible germline epigenome that can be influenced by my behavior, good and bad. And that my children (and maybe grandchildren) will inherit my epigenetic legacy long before they get my house and my money. And that may not be all… epigenetic memory in C. elegans can stretch to 14 generations! Read about epigenetic inheritance resulting from Dad’s cocaine use at Sins of the Father and about multigenerational epigenetic inheritance at Epigenetic Memory in Caenorhabditis elegans.
231 Experimental Demonstration of Germ-Line Epigenetic Inheritance
12.06: Key Words and Terms
10 nm fiber galactose pseudogene
3' non-transcribed DNA galactoside PTS
30 nm solenoid fiber gene activation regulatory genes
5' non-transcribed DNA gene derepression second messenger
adaptive immune system gene expression nucleosomes
adult stem cells gene induction O1 and O2 lac operators
allolactose gene regulation operator
antisense RNA gene repression operon regulation
basic v. non-basic proteins HAT enzymes PEP-dependent P-transferase system
beads-on-a-string helix-turn-helix motif phage DNA
$\beta$-galactosidase heterochromatin phophodiester backbone
cAMP histone acetylation phosphorlyation
cAMP receptor protein histone kinases pluripotent cells
CAP protein histone methyl transferases polycistronic mRNA
CAT box histone methylation positive regulation
catabolite activator protein histone phosphorlyation promoter
chromatin remodeling housekeeping genes proximal regulatory element
cis-acting elements inducer exclusion signal transduction
condensed chromatin interphase steroid hormone
developmental program introns structural genes
differential gene lac operon TATA box
distal regulatory element lacl gene tetrametric lac repressor
DNA bending lactose totipotent cells
DNAse lactose permease transcription factors
embryonic stem cells lactose repressor transcription regulation
enhancers lac Z, lac Y, lac A genes transcription start site
environmental signals leucine zipper motif translation regulation
epigenome levels of chromatin structure trp operon
euchromatin major groove trp repressor
exons minor groove zinc finger motif
extended chromatin miRNA (micro RNA)
fully differentiated cells negative regulation | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/12%3A_Regulation_of_Transcription_and_Epigenetic_Inheritance/12.05%3A_Epigenetics.txt |
• 13.1: Introduction
The metabolic potential of cells is flexible, depending on various mechanisms that ultimately determine the levels and activities of proteins that dictate a cell’s metabolic state. We have seen some of these regulatory mechanisms. In this chapter, we look at different kinds of post-transcriptional regulation, events somewhere between mRNA transcription and controls on the activity of finished proteins. These control mechanisms are most diverse in eukaryotes.
• 13.2: Post-transcriptional Control of Gene Expression
Not too long ago we thought that very little of the eukaryotic genome was ever transcribed. We also thought that the only non-coding RNAs were tRNAs and rRNAs. Now we know that other RNAs play roles in gene regulation and the degradation of spent cellular DNA or unwanted foreign DNA. These are discussed in detail below.
• 13.3: Eukaryotic Regulation of Translation
In many respects, the overall process is similar to prokaryotic translation initiation described elsewhere. The 40S ribosomal subunit itself can bind to and scan an mRNA, seeking the start site of an ORF (open reading frame) encoding a polypeptide. When GTP-bound eukaryotic initiation factor 2 (GTP-eIF2) binds met-tRNAf, it forms a ternary complex (TC).
• 13.4: Key Words and Terms
Thumbnail: N-linked protein glycosylation (N-glycosylation of N-glycans) at Asn residues (Asn-x-Ser/Thr motifs) in glycoproteins. (Public Domain; Kosi Gramatikoff).
13: Post Transcriptional Regulation of Gene Expression
The metabolic potential of cells is flexible, depending on various mechanisms that ultimately determine the levels and activities of proteins that dictate a cell’s metabolic state. We have seen some of these regulatory mechanisms:
• the regulation of transcription by extracellular chemical signals or developmental chemical prompts
• the control of enzyme or other protein activity by allosteric regulation or chemical modification (e.g., phosphorylation or dephosphorylation).
In this chapter, we look at different kinds of post-transcriptional regulation, events somewhere between mRNA transcription and controls on the activity of finished proteins. These control mechanisms are most diverse in eukaryotes.
Like other pathways for regulating gene expression, post-transcriptional regulation begins with extracellular chemical signaling. Responses include changes in the rate of polypeptide translation, and changes in macromolecular turnover rate (e.g., changes in the half-life of specific RNAs and proteins in cells). Regardless of mechanism, each upor down-regulation of gene expression contributes to changes in the steady state of a particular RNA or protein required for proper cell function. In considering posttranscriptional regulation, we will see how cells use specific proteins and different noncoding RNA transcripts to target unwanted proteins or RNAs for degradation.
Learning Objectives
When you have mastered the information in this chapter, you should be able to:
1. Explain what it is about C. elegans makes it a model organism for studying development and the regulation of gene expression.
2. Compare and contrast the origins and functions of miRNA and siRNA.
3. Search for examples of miRNAs, siRNAs, lncRNAs and circRNAs that regulate the expression of specific genes and explain their mechanisms.
4. Explain how a riboswitch functions to control bacterial gene expression.
5. Explain the origins and roles of bacterial CRISPR-Cas immune system components.
6. Explain how eif2 activity is modulated to coordinate red cell heme and globin levels.
7. Describe how eukaryotic cells degrade unwanted proteins and speculate on how bacteria might do so
8. answer the questions “How did junk DNA arise?” and “Does junk DNA have value?” | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/13%3A_Post_Transcriptional_Regulation_of_Gene_Expression/13.01%3A_Introduction.txt |
Not too long ago we thought that very little of the eukaryotic genome was ever transcribed. We also thought that the only non-coding RNAs were tRNAs and rRNAs. Now we know that other RNAs play roles in gene regulation and the degradation of spent cellular DNA or unwanted foreign DNA. These are discussed in detail below.
A. Ribosomes
The riboswitches is a bacterial transcription mechanism for regulating gene expression. While this mechanism is not specifically post-transcriptional, it is included here because the action occurs after transcription initiation and aborts completion of an mRNA. When the mRNA for an enzyme in the guanine synthesis pathway is transcribed, it folds into stem-&-loop structures. Enzyme synthesis will continue for as long as the cell needs to make guanine. But if guanine accumulates in the cell, excess guanine will bind stem-loop elements near the 5’ end of the mRNA, causing the RNA polymerase and the partially completed mRNA dissociate from the DNA, prematurely ending transcription. The basis of guanine riboswitch regulation of expression of a guanine synthesis pathway enzyme is shown below.
232 Riboswitches Interrupt Bacterial Transcription
The ability to form folded, stem-loop structures at the 5’ ends of bacterial mRNAs seems to have allowed the evolution of translation regulation strategies. Whereas guanine interaction with the stem-loop structure of an emerging 5’ mRNA can abort its own transcription, similar small metabolite/mRNA and even protein/mRNA interactions can also regulate (in this case prevent) translation. As we will see shortly, 5’ mRNA folded structures also play a role in eukaryotic translation regulation.
233 Small Metabolites Also Regulate Bacterial mRNA translation
B. CRISPR/Cas: RNA-Protein Complex of a Prokaryotic Adaptive Immune System
In higher organisms, the immune system is adaptive. It remembers prior exposure to a pathogen, and can thus mount a response to a second exposure to the same pathogen. The discovery of an ‘adaptive immune system’ in many prokaryotes (bacteria, archaebacteria) was therefore something of a surprise.
CRISPR (Clustered Regularly Interspaced Short Palindromic Repeat) RNAs are derived from phage transcripts that have interacted with CRISPR-Associated (Cas) proteins. They make up the CRISPR/Cas system that seems to have evolved to fight of viral infection by targeting phage DNA for destruction. When viral DNA gets into a cell during a phage infection, it can generate a CRISPR/Cas gene array in the bacterial genome, with spacer DNA sequences separating repeats of the CRISPR genes. These remnants of a phage infection are the memory of this prokaryotic immune system. When a phage attempts to re-infect a previously exposed cell, spacer RNAs and Cas genes are transcribed. After Cas mRNA translation, the Cas protein and spacer RNAs will engage and target the incoming phage DNA for destruction to prevent infection. Thus, the CRISPR/Cas systems (there is more than one!) remember prior phage attacks, and transmit that memory to progeny cells. The CRISPR/Cas9 system in Streptococcus pyogenes is one of the simplest of these immune defense systems (illustrated below).
The CRISPR/Cas gene array consists of the following components:
• Cas: Genes native to host cells
• CRISPR: 24-48 bp repeats native to host cells
• Spacer DNA: DNA between CRISPR repeats: typically, phage DNA from prior phage infection or plasmid transformation
• leader DNA: Contains promoter for CRISPR/spacer RNA transcription
• tracr gene: Encodes transcription activator (tracr) RNA (not all systems)
Let's look at CRISPR/Cas in action.
1. The CRISPR/Cas Immune Response
Consider the mechanism of action of this prokaryotic immune system. The action begins when infectious phage DNA gets into the cell, as drawn below.
Let’s summarize what has happened here:
a) Incoming phage DNA was detected after phage infection.
b) Then the tracr and Cas genes are transcribed along with the CRISPR/spacer region. Cas mRNAs are translated to make the Cas protein. Remember, the spacer DNAs in the CRISPR region are the legacy of a prior phage infection.
c) CRISPR/spacer RNA forms hydrogen bonds with a complementary region of the tracr RNA as the two RNAs associate with Cas proteins.
d) Cas protein endonucelases hydrolyze spacer RNA from CRISPR RNA sequences. The spacer RNAs remain associated with the complex while the actual, imperfectly palindromic CRISPR sequences (shown in blue in the illustration above) fall off.
In the next steps, phage-derived spacer RNAs, now called guide RNAs (or gRNAs) ‘guide’ mature Cas9/tracrRNA/spacer RNA complexes to new incoming phage DNA resulting from a phage attack. The association of the complex with the incoming phage DNA and subsequent events are illustrated below.
Once again, let’s summarize:
a) Spacer (i.e., gRNA) in the complex targets incoming phage DNA.
b) Cas helicase unwinds incoming phage DNA at complementary regions.
c) gRNA H-bonds to incoming phage DNA.
d) Cas endonucleases create a double-stranded break (hydrolytic cleavage) at specific sites in incoming phage DNA. Because precise site DNA strand cleavage is guided by RNA molecules, CRISPR/Cas endonucleases are classified as type V restriction enzymes.
e) The incoming phage DNA is destroyed and a new phage infection is aborted.
Check out here to learn more about how bacteria acquire spacer DNAs, and therefore how this primitive adaptive immune system ‘remembers’) in the first place
2. Using CRISPR/Cas to Edit/Engineer Genes
Early studies demonstrated the reproducible cleavage of incoming phage DNA at specific nucleotides. Several labs quickly realized that it might be possible to adapt the system to cut DNA at virtually any specific nucleotide in a target DNA! It has turned out that the system works both in vivo and in vitro, allowing virtually unlimited potential for editing genes and RNAs in a test tube… or in any cell. Here is the basic process:
a) Engineer gDNA with a Cas-specific DNA sequence that targets a desired target in genomic DNA.
b) Fuse the gDNA to tracr DNA to make a single guide DNA (sgDNA) so that it can be made as a single guide transcript (sgRNA).
c) Engineer a CRISPR/Cas9 gene array that substitutes this sgDNA for its original spacer DNAs.
d) Place engineered array in a plasmid next to regulated promoters.
e) Transform cells by ‘electroporation’ (works for almost any cell type!)
f) Activate the promoter to transcribe the CRISPR/Cas9 genes…
The applications are powerful… and controversial!
3. The Power and the Controversy
The application of gene editing with CRISPR/Cas systems has already facilitated studies of gene function in vitro, in cells and in whole organisms. Click here for a description of CRISPR/Cas applications already on the market! The efficiency of specific gene editing using CRISPR/Cas systems holds great promise for understanding basic gene structure and function, for determining the genetic basis of disease, and for accelerating the search for gene therapies. Here are just a few examples of how CRISPR/Cas approaches are being applied.
• One can engineer an sgRNA with desired mutations targeting specific sites in chromosomal DNA. Then clone sgRNA into the CRISPR/Cas9 array on a plasmid. After transformation of appropriate cells, the engineered CRISPR/Cas9 forms a complex with target DNA sequences. Following nicking of both strands of the target DNA, DNA repair can insert the mutated guide sequences into the target DNA. The result is loss or acquisition of DNA sequences at specific, exact sites, or Precision Gene Editing. It is the ability to do this in living cells that has excited the basic and clinical research communities.
• Before transforming cells, engineer the CRISPR/Cas9 gene array on the plasmid to eliminate both endonuclease activities from the Cas protein. Upon transcription of the array in transformed cells, the CRISPR/Cas9-sgRNA still finds an sgRNA-targeted gene. However, lacking CAS protein endonuclease activities, the complex that forms just sits there blocking transcription. This technique is sometimes referred to as CRISPRi (CRISPER interference), by analogy to RNAi. Applied to organisms (and not just in vitro or to cells), it mimics the much more difficult knockout mutation experiments that have been used in studies of behavior of cells or organisms rendered unable to express a specific protein.
• There are now several working CRISPR/Cas systems capable of Precision Gene Editing. They are exciting for their speed, precision, their prospects for rapid, targeted gene therapies to fight disease, and their possibilities to alter entire populations (called Gene Drive). By inserting modified genes into the germline cells of target organisms, gene drive can render harmless entire malarial mosquito populations, to eliminate pesticide resistance in e.g. insects, eliminate herbicide resistance in undesirable plants, or genetically eliminate invasive species. For more information, click Gene drive; for an easy read about this process and the controversies surrounding applications of CRISPR technologies to mosquitoes in particular, check out J. Adler, (2016) A World Without Mosquitoes. Smithsonian, 47(3) 36-42, 84.
• It is even possible to delete an entire chromosome from cells. This bit of global genetic engineering relies on identifying multiple unique sequences on a single chromosome and then targeting these sites for CRISPR/Cas. When the system is activated, the chromosome is cut at those sites, fragmenting it beyond the capacity of DNA repair mechanisms to fix the situation. Click here to learn more.
If for no other reason than its efficiency and simplicity, precision gene editing with CRISPR/Cas techniques has raised ethical issues. Clearly, the potential exists for abuse, or even for use with no beneficial purpose at all. It is significant that, as in all discussions of biological ethics, scientists are very much engaged in the conversation. Despite the controversy, we will no doubt continue to edit genes with CRISPR/Cas, and we can look for a near future Nobel Prize for its discovery and application! If you still have qualms, maybe RNA editing will be the answer. Check out the link at Why edit RNA? for an overview of the possibilities!
Finally, “mice and men” (and women and babies too) have antibodies to Cas9 proteins, suggesting prior exposure to microbial CRISPR/Cas9 antigens. This observation may limit clinical applications of the technology! See Uncertain Future of CRISPR-Cas9 Technology.
C. The Small RNAs: miRNA and siRNA in Eukaryotes
Micro RNAs (miRNAs) and small interfering RNAs (siRNAs) are found in C. elegans, a small nematode (roundworm) that quickly became a model for studies of cell and molecular biology and development. The particular attractions C. elegans are that (a) its genome has ~21,700 genes, comparable to the ~25,000 genes in a human genome!; (b) it uses the products of these genes to produce an adult worm consisting of just 1031 cells organized into all of the major organs found in higher organisms; (c) It is possible to trace the embryonic origins of every single cell in its body! C. elegans is illustrated below.
1. Small Interfering RNA (siRNA)
siRNA was first found in plants as well as in C. elegans. However, siRNAs (and miRNAs) are common in many higher organisms. siRNAs were so-named because they interfere with the function of other RNAs foreign to the cell or organism. Their action was dubbed RNA interference (RNAi). For their discovery of siRNAs, A. Z. Fire and C. C. Mello shared the 2006 Nobel Prize in Physiology or Medicine. The action of siRNA targeting foreign DNA is illustrated below.
When cells recognize foreign double-stranded RNAs (e.g., some viral RNA genomes) as alien, the DICER a nuclease called hydrolyzes them. The resulting short double-stranded hydrolysis products (the siRNAs) combine with RNAi Induced Silencing Complex, or RISC proteins. The antisense siRNA strand in the resulting siRNA-RISC complex binds to complementary regions of foreign RNAs, targeting them for degradation. Cellular use of RISC to control gene expression in this way may have derived from the use of RISC proteins by miRNAs as part of a cellular defense mechanism, to be discussed next.
Custom-designed siRNAs have been used to disable expression of specific genes in order to study their function in vivo and in vitro. Both siRNAs and miRNAs are being investigated as possible therapeutic tools to interfere with RNAs whose expression leads to cancer or other diseases.
234 siRNA Post Transcriptional Regulation
235 Did siRNA Coopt RISC strategy to Trash Corrupt or Worn out RNA?
For an example check out a Youtube video of unexpected results of an RNAi experiment at this link. In the experiment described, RNAi was used to block embryonic expression of the orthodenticle (odt) gene that is normally required for the growth of horns in a dung beetle. The effect of this knock-out mutation was, as expected, to prevent horn growth. What was unexpected however, was the development of an eye in the middle of the beetle’s head (‘third eye’ in the micrograph).
The 3rd eye not only looks like an eye, but is a functional one. This was demonstrated by preventing normal eye development in odt-knockout mutants. The 3rd eye appeared…, and was responsive to light! Keep in mind that this was a beetle with a 3rd eye, not Drosophila! To quote Justin Kumar from Indiana University, who though not involved in the research, stated that “…lessons learned from Drosophila may not be as generally applicable as I or other Drosophilists, would like to believe … The ability to use RNAi in non-traditional model systems is a huge advance that will probably lead to a more balanced view of development.”
2. Micro RNAs (miRNA)
miRNAs target unwanted endogenous cellular RNAs for degradation. They are transcribed from genes now known to be widely distributed in eukaryotes. The pathway from pre-miRNA transcription through processing and target mRNA degradation is illustrated on the next page.
As they are transcribed, pre-miRNAs fold into a stem-loop structure that is lost during cytoplasmic processing. Like SiRNAs, mature miRNAs combine with RISC proteins. The RISC protein-miRNA complex targets old or no-longer needed mRNAs or mRNAs damaged during transcription.
An estimated 250 miRNAs in humans may be sufficient to H-bond to diverse target RNAs; only targets with strong complementarity to a RISC protein-miRNA complex will be degraded.
236 miRNA Post-Transcriptional Regulation
D. Long Non-Coding RNAs
Long non-coding RNAs (lncRNAs) are a yet another class of eukaryotic RNAs. They include transcripts of antisense, intronic, intergenic, pseudogene and retroposon DNA. Retroposons are one kind of transposon, or mobile DNA element; pseudogenes are recognizable genes with mutations that make them non-functional. While some lncRNAs might turn out to be incidental transcripts that the cell simply destroys, others have a role in regulating gene expression.
A recently discovered lncRNA is XistAR that, along with the Xist gene product, is required to form Barr bodies. Barr bodies form in human females when one of the X chromosomes in somatic cells is inactivated. For a review of lncRNAs, see Lee, J.T. (2012. Epigenetic Regulation by Long Noncoding RNAs; Science 338, 1435-1439).
An even more recent article (at lncRNAs and smORFs) summarizes the discovery that some long non-coding RNAs contain short open reading frames (smORFs) that are actually translated into short peptides of 30+ amino acids! Who knows? The human genome may indeed contain more than 21,000-25,000 protein-coding genes!
E. Circular RNAs (circRNA)
Though discovered more than 20 years ago, circular RNAs (circRNAs) are made in different eukaryotic cell types. Click Circular RNAs (circRNA) to learn more about this peculiar result of alternative splicing. At first circRNAs were hard to isolate. When they were isolated, circRNAs contained “scrambled” exonic sequences and were therefore thought to be nonfunctional errors of mRNA splicing.
In fact, circRNAs are fairly stable. Their levels can rise and fall in patterns suggesting that they are functional molecules. Levels of one circRNA, called circRims1, rise specifically during neural development. In mice, other circRNAs accumulate during synapse formation, likely influencing how these neurons will ultimately develop and function. Thus, circRNAs do not seem to be ‘molecular mistakes’. In fact, errors in their own synthesis may be correlated with disease! Speculation on the functions of circRNAs also includes roles in gene regulation, particularly the genes or mRNAs from which they themselves are derived.
F. "Junk DNA" in Perspective
Not long ago, we thought that less than 5% of a eukaryotic genome was transcribed (i.e., into mRNA, rRNA and tRNA), and that much of the non-transcribed genome served a structural function… or no function at all. The latter, labeled junk DNA, included non-descript intergenic sequences, pseudogenes, ‘dead’ transposons, long stretches of intronic DNA, etc. Thus, junk DNA was DNA we could do without. Junk DNAs were thought to be accidental riders in our genomes, hitchhikers picked up on the evolutionary road.
While miRNA genes are a small proportion of a eukaryotic genome, their discovery, and that of more abundant lnc RNAs suggest a far greater amount of functional DNA in the genome. Might there be in fact, no such thing as “junk DNA”? The debate about how much of our genomic DNA is a relic of past evolutionary experiments and without genetic purpose continues. Read all about it at Junk DNA - not so useless after all and Only 8.2% of human DNA is functional.
Perhaps we need to re-think what it means for DNA to be “junk” or to be without “genetic purpose”. Maintenance of more than 90% of our own DNA with no known genetic purpose surely comes at an energy cost. At the same time, all of that DNA is grist for future selection, a source of the diversity required for long-term survival. The same natural selection that picks up ‘hitchhiker’ DNA sequences, as we have seen, can at some point, put them to work!
G. The RNA Methylome
Call this an RNA epi-transcriptome if you like! Recall that methyl groups direct cleavage of ribosomal RNAs from eukaryotic 45S pre-RNA transcripts. tRNAs among other transcripts, are also post-transcriptionally modified. Known since the 1970s, such modifications were thought to be non-functional. But are they? | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/13%3A_Post_Transcriptional_Regulation_of_Gene_Expression/13.02%3A_Post-transcriptional_Control_of_Gene_Expression.txt |
A. The basics of Eukaryotic mRNA Translation
The basic features of translation initiation in eukaryotes are shown below.
In many respects, the overall process is similar to prokaryotic translation initiation described elsewhere. The 40S ribosomal subunit itself can bind to and scan an mRNA, seeking the start site of an ORF (open reading frame) encoding a polypeptide. When GTP-bound eukaryotic initiation factor 2 (GTP-eIF2) binds met-tRNAf, it forms a ternary complex (TC). The TC can associate with the scanning 40S subunit. When a TC-associated scanning subunit encounters the start site of the ORF, scanning stalls. Additional eIFs enable formation of the initiation complex, positioning the initiator tRNA anticodon over the start site AUG in the mRNA. The initiation complex then recruits the large (60S) ribosomal subunit. Binding of the 60S ribosomal subunit to the initiation complex causes the release of all the eIFs and hydrolysis of the GTP on eIF2. The GDP remains bound to eIF2. For protein syntheses to continue, new GTP must replace GDP on eIF2. Another initiation factor, eIF2B, facilitates this GTP/GDP swap, recycling GTP-eIF2 for use in initiation. The regulation of translation is superimposed on these basic processes.
B. Translation Regulation
Since mRNAs are made to be translated, it is likely that by default, they are! We know that CAP and poly(A) tails on mRNAs are required for efficient translation because mRNAs engineered to lack one and/or the other are poorly translated. Also, there is little evidence to that cells modify the process of capping or polyadenylation, or the structures themselves.
Translation regulation typically targets initiation. It may be global, affecting the synthesis of many polypeptides at once, or specific, affecting a single polypeptide. Global regulation involves changes in the activity of eukaryotic initiation factors (eIFs) that would typically affect all cellular protein synthesis. Specific regulation involves binding sequences or regions on one or a few mRNAs that recognize and bind specific regulatory proteins and/or other molecules. That binding controls translation of only those mRNAs, without affecting general protein biosynthesis. mRNA structural features involved in translation and in translation regulation are illustrated below.
We will consider three examples of translational control of gene expression.
1. Specific Translation Control by mRNA Binding Proteins
Ferritin is a cellular iron-storage protein made up of heavy and light chain polypeptides. Translation of ferritin in iron-deficient cells is inhibited. In the absence of ferritin production, ferritin-iron complexes release iron for metabolic use. The 5’-UTR of mRNAs for both chains contain stem-loop binding sites that specifically recognize iron regulatory proteins (IRP1, IRP2). When ferritin mRNAs are bound to IRPs, translation initiation is blocked. The inhibition of ferritin translation by IRPs is illustrated below.
Normally, the initiation complex scans the 5’-UTR of an mRNA. When it finds the normal translation start site, it can bind the large subunit and begin translating the polypeptide. In iron-deficient cells, scanning by the initiation complex is thought to be physically blocked by steric hindrance.
2. Coordinating Heme & Globin Synthesis
Consider that reticulocytes (the precursors to erythrocytes, the red blood cells in mammals) synthesize globin proteins. They also synthesize heme, an iron-bound porphyrin-ring molecule. Each globin must bind to a single heme to make a hemoglobin protein subunit. Clearly, it would not do for a reticulocyte to make too much globin protein and not enough heme, or vice versa. It turns out that hemin (a precursor to heme) regulates the initiation of translation of both $\alpha$ and $\beta$ globin mRNAs. Recall that, to sustain globin mRNA translation, the GDP-eIF2 generated after each cycle of translation elongation must be exchanged for fresh GTP. This is facilitated by the eIF2B initiation factor. eIF2B can exist in phosphorylated (inactive) or un-phosphorylated (active) states. Making sure that globin is not under- or overproduced relative to heme biosynthesis involves controlling levels of active vs. inactive eIF2B by hemin. Hemin accumulates when there is not enough globin polypeptide to combine with heme in the cell. Excess hemin binds and inactivates an HCR kinase, preventing phosphorylation of eIF2B. Since unphosphorylated eIF2B is active, it facilitates the GTP/GDP swap needed to allow continued translation. Thus, ongoing initiation ensures that globin mRNA translation can keep up with heme levels. In other words, if hemin production gets ahead of globin, it will promote more globin translation.
When globin and heme levels become approximately equimolar, hemin is no longer in excess. It then dissociates from the active HCR kinase. The now- active kinase catalyzes eIF2B phosphorylation. Phospho-eIF2B is inactive, and cannot facilitate the GTP/GDP swap on eIF2. Globin mRNA translation initiation, thus blocked, allows a lower rate of globin polypeptide translation to keep pace with heme synthesis. The regulation of globin mRNA translation initiation by hemin is shown below.
237 Translation Regulation of Globin Polypeptide Synthesis
3. Translational Regulation of Yeast GCN4
Like the coordination of heme and globin production, the regulation of the GCN4 protein is based on controlling the ability of the cells to swap GTP for GDP on eIF2. However, this regulation is quite a bit more complex, despite the fact that yeast is a more primitive eukaryote! GCN4 is a global transcription factor that controls the transcription of as many as 30 genes in pathways for the synthesis of 19 out of the 20 amino acids! The discovery that amino acid starvation caused yeast cells to increase their production of amino acids in the cells led to the discovery the General Amino Acid Control (GAAC) mechanism involving GCN4. GCN is short for General Control Nondepressible, referring to its global, positive regulatory effects. It turns out that the GCN4 protein is also involved in stress gene expression, glycogen homeostasis, purine biosynthesis…, in fact in the action of up to 10% of all yeast genes! Here we focus on the GAAC mechanism.
Yeast cells provided with ample amino acids do not need to synthesize them. Under these conditions, GCN4 is present at basal (i.e., low) levels. When the cells are starved of amino acids, GCN4 levels increase as much as ten-fold within two hours, resulting in an increase in general amino acid synthesis. This rapid response occurs because amino acid starvation signals an increase in the activity of GCN2, a protein kinase. The GCN2 kinase catalyzes phosphorylation of GDPeIF2. As we have already seen, phosphorylated eIF2B cannot exchange GTP for GDP on the eIF2, in this case with the results shown below.
There is a paradox here. You would expect a slowdown in GTP-eIF2 regeneration to inhibit overall protein synthesis, and it does. However, the reduced levels of GTP-eIF2 somehow also stimulate translation of the GCN4 mRNA, leading to increased transcription of the amino acid synthesis genes. In other words, amino acid starvation leads yeast cells to use available substrates to make their own amino acids in order that protein synthesis can continue… at the same time as initiation complex formation is disabled!
Let’s accept that paradox for now, and look at how amino acid starvation leads to increased translation of the GCN4 protein and the up-regulation of amino acid biosynthesis pathways. To begin with, we are going to need to understand the structure of GCN4 mRNA. In the illustration below, note the 4 short uORFs in the 5’UTR of the RNA; these play a key role in GCN4 translation regulation.
We noted earlier that when a Ternary Complex (TC)-associated 40S ribosomal subunit scans an mRNAs and find the ORF start sites for its polypeptide, initiation complexes form, 60S ribosomal subunits bind and translation starts. GCN4 mRNA has four uORFs in its 5’ UTR. While uORFs encode only a few amino acids before encountering a stop codon, they can also be recognized during scanning. When TCs and 40S subunits are plentiful, they seem to engage uORFs in preference to the GCN4 coding region ORF, as illustrated below.
Under these conditions, active eIF2B allows the GTP/GDP swap on GDP-eIF2, leading to efficient GTP-eIF2 recycling and high TC levels. TCs bind small subunits during scanning and/or at the start sites of uORFs, forming initiation complexes that then bind 60S ribosomal subunits and begin uORF translation. The effect is to slow down scanning past the uORFs, thereby inhibiting initiation complex formation at the actual GCN4 ORF.
What happens in amino acid-starved cultures of yeast cells, when GTP-eIF2 cannot be efficiently regenerated and TCs are in short supply? To review, amino acid starvation signals an increase in GCN2 kinase activity resulting in phosphorylation and inactivation of eIF2B. Inactive phospho-eIF2 will not facilitate the GTP/GDP swap at GDP-eIF2, inhibiting overall protein synthesis. The resulting reduction in GTP-eIF2 also lowers the levels of TC and TC-associated 40S subunits. The illustration below shows how this phenomenon up-regulates GCN4 translation, even as the translation of other mRNAs has declined.
C. Regulating Protein Turnover (Half-Life)
We have already seen that organelles have a finite life span, or half-life. Recall that lysosomes participate in destroying worn out mitochondria and their molecular components. We also saw the role of small RNAs (especially miRNA) in destroying old, damaged or otherwise unwanted RNAs from cells. All cell structures and molecules have a finite half-life, defined as the time it takes for half of them to disappear in the absence of new synthesis of the structure or molecule. As we already know, the steady-state level of any cellular structure or molecule exists when the rate of its manufacture or synthesis is balanced by the rate of its turnover. Of course, steady state levels of things can change. For example, the level of gene expression (the amount of a final RNA or protein gene product in a cell) can change if rates of transcription, processing or turnover change. We should also expect the same for the steady-state levels of cellular proteins. Here we consider the factors that govern the half-life of cellular proteins.
The half-life of different proteins seems to be inherent in their structure. Thus, some amino acid side chains are more exposed at the surface of the protein and are thus more susceptible to change or damage over time than others. Proteins with fewer ‘vulnerable’ amino acids should have a longer half-life than those with more of them. Proteins damaged by errors of translation, folding, processing gone awry or just worn out from use or ‘old age’ will be targeted for destruction. All molecules have a half-life!
The mechanism for detecting and destroying unwanted old, damaged or misbegotten proteins involves a 76-amino acid polypeptide called ubiquitin that targets the protein for destruction, delivering it to a large complex of polypeptides called the proteasome. Here is what happens:
1. The first step is to activate an ubiquitin. This starts when ATP hydrolysis fuels the binding of ubiquitin to an ubiquitin-activating enzyme.
2. An ubiquitin-conjugating enzyme then replaces the ubiquitin-activation enzyme.
3. The protein destined for destruction replaces the ubiquitin-conjugating enzyme.
4. Several more ubiquitins then bind to this complex.
5. The poly-ubiquinated protein delivers its protein to one of the 19S ‘CAP’ structures of a proteasome.
6. After binding to one of the CAP structures of a proteasome, the poly-ubiquinated target proteins dissociate and the ubiquitins are released and recycled as the target protein unfolds (powered by ATP hydrolysis). The unfolded protein then enters a 20S core proteasome.
The target protein is digested to short peptide fragments by proteolytic enzymes in the interior of the proteasome core. The fragments are release from the CAP complex at the other end of the proteasome and digested down to free amino acids in the cytoplasm. There is a mind-boggling variety of proteins in a cell…, and there are as many as 600 different ubiquitin proteins, encoded by as many genes! Presumably, each ubiquitin handles a subclass of proteins based on common features of their structure.
With its complex quaternary structure, the 26S proteasome is smaller than a eukaryotic small ribosomal subunit (40S), but is still one of the largest cytoplasmic particles… and without the benefit of any RNA in its structure! The illustration on the next page details the role of ubiquitin in the degradation of a worn out protein by a proteasome. Click on Proteasome in Action to see an animated version of the illustration.
13.04: Key Words and Terms
19S proteasome cap complex gene editing RISC endonuclease
20S proteasome complex global transcription factor RISC proteins
amino acid starvation globin RNA interface
Barr Bodies gRNA RNA turnover rates
C. Elegans GTP/GDP swap RNAi
Cas GTP-eiF2 recycling RNA-induced silencing complex
Cas helicase activity half life sgRNA
Cas9 endonuclease HCR kinase siRNA (small interfering RNA)
circRNA heme small RNAs
circular RNA hemin smORF
CRISPR HRC kinase spacer RNA
CRISPR interference initiation complex scanning steady state
CRISPR/Cas iron regulatory protein Streptococcus pyogenes
CRISPR/Cas9 gene array IRP tracr
CRISPRi Junk DNA tracr gene
dicer IncRNA tracr RNA
eiF2 phosphorlyation long non-coding RNA translation elongation
eiF2B micro RNA ubiquitin
EIIAGlc miRNA ubiquitination
Ferritin mRNA scanning uORF
GAAC proteasome XistAR
GCn2 protein turnover rates Yeast GCN4
GDP-eiF2 riboswitch
Gene Drive RISC | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/13%3A_Post_Transcriptional_Regulation_of_Gene_Expression/13.03%3A_Eukaryotic_Regulation_of_Translation.txt |
• 14.1: Introduction
Because of their small size, bacterial genomes have few repetitive DNA sequences. In contrast, repetitive DNA sequences make up a large part of a eukaryotic genome. Much of this repeated DNA consists of identical or nearly identical sequences of varying length repeated many times in a genome. Examples include satellite DNA (minisatellite and microsatellite DNA) and transposons, or transposable elements. Here we look at experiments that first revealed the existence and proportion of repeated DNA
• 14.2: The Complexity of Genomic DNA
By the 1960s, when Roy Britten and Eric Davidson were studying eukaryotic gene regulation, they knew that there was more than enough DNA to account for the genes needed to encode an organism. It was also likely that DNA was more structurally complex than originally thought. They knew that cesium chloride (CsCl) density gradient centrifugation separated molecules based on differences in density and that fragmented DNA would separate into a main and a minor band of different density in centrifuge
• 14.3: The 'Jumping Genes' of Maize
Barbara McClintock’s report that bits of DNA could jump around and integrate themselves into new loci in DNA was so dramatic and arcane that many thought the phenomenon was either a one-off, or not real! Only with the subsequent discovery of transposons in bacteria (and in other eukaryotes) were McClintock’s jumping genes finally recognized for what they were!
• 14.4: Transposons Since McClintock
Transposons exist everywhere we look in prokaryotes and account for much of eukaryotic repetitive DNA. As such, they can be a large proportion of eukaryotic genomes, including some that no longer even transpose. Transposons were once considered useless or junk DNA, with no obvious function…, or selfish genes with no other purpose than selfreplication. But in light of some new evidence, perhaps not!
• 14.5: On the Evolution of Transposons, Genes, and Genomes
We noted that transposons in bacteria carry antibiotic resistance genes, a clear example of benefits of transposition in prokaryotes. Of course, prokaryotic genomes are small, as is the typical bacterial transposon load. Yeast species also have low transposon load. But, what can we make of the high transposon load in eukaryotes?
• 14.6: Roles of Transposition in Evolution and Diversity
A role for unequal recombination in moving exons in and out of different eukaryotic split genes was described earlier. This kind of exon shuffling could happen when short DNA sequences in two different introns misalign during meiotic synapsis, allowing for unequal crossing over. Expression of a gene with a ‘new’ exon produces a protein with a new domain and a new activity. If the event is not harmful, diversity is increased!
• 14.7: Coping with the Dangers of Rampant Transposition
Most organisms do not have the high transposon load that we have. For those like us, and given a general tendency of transposons to insert at random into new DNA loci, how come we exist at all? Isn’t the danger of transposition into essential gene sequences magnified by the possibility of multiple simultaneous transpositions of elements generated by cut-and-paste and especially replicative mechanisms? Indeed, transposons have been found in genes that are inactive as a result.
• 14.8: Key Words and Terms
Thumbnail: Maize grains (Hopi Blue) with pigmentation modified by the action of transposons. (CC BY-SA 3.0 Unported; Abrahami and modified by LibreTexts via Wikipedia)
14: Repetitive DNA A Eukaryotic Genomic Phenomenon
Because of their small size, bacterial genomes have few repetitive DNA sequences. In contrast, repetitive DNA sequences make up a large part of a eukaryotic genome. Much of this repeated DNA consists of identical or nearly identical sequences of varying length repeated many times in a genome. Examples include satellite DNA (minisatellite and microsatellite DNA) and transposons, or transposable elements. Here we look at experiments that first revealed the existence and proportion of repeated DNA in genomes. Next we describe Barbara McClintock’s even earlier (and pretty amazing!) discovery of transposable elements. After we describe the different classes of transposons and different mechanisms of transposition, we tackle the question of why they and other repetitive DNAs even exist. Elsewhere we introduced the notion of junk DNA as DNA sequences that serve no known purpose. Is repeated DNA junk DNA? Are transposable elements junk? We are now learning that transposons and other repetitive DNAs can have specific functions, from regulating gene expression to reshaping genomes to increasing genetic diversity in evolution. So, far from being ‘junk’, much redundant DNA exists in genomes because of evolutionary selection.
Learning Objectives
When you have mastered the information in this chapter, you should be able to:
1. Compare and contrast renaturation kinetic data.
2. Explain CoT curves and DNA complexity
3. List physical and chemical properties of main band and satellite DNAs
4. Outline an experiment to determine if a given sequence of DNA is repetitive or not.
5. Summarize how Barbara McClintock revealed the genetics of maize mosaicism.
6. Outline the experiments suggesting that the Ds gene moves from one lovus to another in the maize genome.
7. Compare and contrast cut-&-paste and replicative transposition.
8. Compare the behaviors of autonomous and non-autonomous transposons.
9. List the difference between Mu phage infection and transposition.
10. Describe the common structural features of transposons.
11. Compare the mechanisms of LINE and SINE transposition.
12. Speculate on how species avoid potentially lethal consequences of transposition.
13. Speculate on which came first in evolution: DNA transposons, RNA transposons or retroviruses, and explain your reasoning. | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/14%3A_Repetitive_DNA_A_Eukaryotic_Genomic_Phenomenon/14.01%3A_Introduction.txt |
By the 1960s, when Roy Britten and Eric Davidson were studying eukaryotic gene regulation, they knew that there was more than enough DNA to account for the genes needed to encode an organism. It was also likely that DNA was more structurally complex than originally thought. They knew that cesium chloride (CsCl) density gradient centrifugation separated molecules based on differences in density and that fragmented DNA would separate into a main and a minor band of different density in centrifuge tube. The minor band was dubbed satellite DNA, recalling the Sputnik satellite recently launched by Russia. DNA bands of different density could not exist if the proportions of A, G, T and C in DNA (already known to be species-specific) were the same throughout a genome. Instead, there must be regions of DNA that are richer in A-T than G-C pairs and vice versa. Analysis of satellite bands that moved further on the gradient (i.e., were more dense) than the main band were indeed richer in GC content. Those that lay above the main band were more AT-rich.
Consider early estimates of how many genes it might take to make a human, mouse, chicken or petunia: about 100,000! We know now that it takes fewer! Nevertheless, even with inflated estimates of the number of genes it takes to make a typical eukaryote, their genomes contain 100-1000 times more DNA than necessary to account for 100,000 genes. How then to explain this extra DNA? Britten and Davidson’s elegant renaturation kinetics experiments revealed some physical characteristics of genes and so-called ‘extra’ DNA. Let’s look at these experiments in some detail.
A. The Renaturation Kinetic Protocol
The first step in a renaturation kinetic experiment is to shear DNA isolates to an average size of 10 Kbp by pushing high molecular weight DNA through a hypodermic needle at constant pressure. The resulting double-stranded fragments (dsDNA) is then heated to 100oC to denature (separate) the two strands. The solutions are then cooled to 600C to allow the single stranded DNA (ssDNA) fragments to slowly re-form complementary double strands. At different times after incubation at 60oC, the partially renatured DNA was sampled and ssDNA and dsDNA were separated and quantified.
The experiment is summarized in the drawing below.
The amount, or percent of DNA that had renatured over time could be graphed.
B. Renaturation Kinetic Data
A plot of dsDNA formed at different times (out to many days!) is shown below for a renaturation kinetics experiment using rat DNA.
In this example, the DNA fragments could be placed in three main groups with different overall rates of renaturation. Britten and Davidson reasoned that the dsDNA that had formed most rapidly was composed of sequences that must be more highly repetitive than the rest of the DNA. The rat genome also had a lesser amount of more moderately repeated dsDNA fragments that took longer to anneal than the highly repetitive fraction, and even less of a very slowly re-annealing DNA fraction. The latter sequences were so rare in the extract that it could take days for them to re-form double strands, and were classified as non-repetitive, unique (or nearly unique) sequence DNA, as illustrated below.
It became clear that the rat genome (in fact most eukaryotic genomes) consists of different classes of DNA that differ in their redundancy. From the graph, a surprisingly a large fraction of the genome was repetitive to a greater or lesser extent.
238 Discovery of Repetitive DNA
When renaturation kinetics were determined for E. coli DNA, only one ‘redundancy class’ of DNA was seen, as is shown below.
Based on E. coli gene mapping studies and the small size of the E. coli ‘chromosome’, the reasonable assumption was that there is little room for ‘extra’ DNA in a bacterial genome, and that the single class of DNA on this plot must be unique-sequence DNA.
C. Genomic Complexity
Britten and Davidson defined the relative amounts of repeated and unique (or singlecopy) DNA sequences in an organism’s genome as its genomic complexity. Thus, prokaryotic genomes have a lower genomic complexity than eukaryotes. Using the same data as is in the previous two graphs, Britten and Davidson demonstrated the difference between eukaryotic and prokaryotic genome complexity by a simple expedient. Instead of plotting the fraction of dsDNA formed vs. time of renaturation, they plotted the percent of re-associated DNA against the concentration of the renatured DNA multiplied by the time that DNA took to reanneal (the CoT value). When CoT values from rat and E. coli renaturation data are plotted on the same graph, you get the CoT curves in the graph below.
This deceptively simple extra calculation (from the same data!) allows comparison of the complexities of any number of genomes. These CoT curves tell us that ~100% of the bacterial genome consists of unique sequences, compared to the rat genome with its three DNA redundancy classes. Prokaryotic genomes are indeed largely composed of unique (non-repetitive) sequence DNA that must include single-copy genes (or operons) that encode proteins, ribosomal RNAs and transfer RNAs.
239 CoT Curves and DNA Complexity Explained!
D. Functional Differences between CoT Classes of DNA
The next question of course was what kinds of sequences are repeated and which are ‘unique’ in eukaryotic DNA? Eukaryotic satellite DNAs, transposons and ribosomal RNA genes were early suspects. To begin to answer these questions, satellite DNA was isolated from the CsCl gradients, made radioactive and then heated to separate the DNA strands. In a separate renaturation kinetic experiment, rat DNA was sampled at different times. The isolated Cot fractions were once again denatured and mixed with heat-denatured radioactive satellite DNA. The mixture was then cooled to allow renaturation. The experimental protocol is illustrated below.
The results of this experiment showed that radioactive satellite DNA only annealed to DNA from the low Cot fraction (highly repeated) fraction of DNA. Satellite DNA is thus highly repeated in the eukaryotic genome. In similar experiments, isolated rRNAs made radioactive formed RNA-DNA hybrids when mixed and cooled with the denatured middle CoT fraction of eukaryotic DNA. Thus, rRNA genes were moderately repetitive. With the advent of recombinant DNA technologies, the redundancy of other kinds of DNA were explored using cloned genes (encoding rRNA, proteins, transposons and other sequences) to probe DNA fractions obtained from renaturation kinetics experiments. Results of such experiments are summarized in the table below.
The table compares properties (lengths, copy number, functions, percent of the genome, location in the genome, etc.) of different kinds of repetitive sequence DNA. The observation that most of a eukaryotic genome is made up of repeated DNA, and that transposons can be as much as 80% of a genome was a surprise!
240 Identifying Different Kinds of DNA Each CoT Fraction
241 Some Repetitive DNA Functions
We’ll focus next on the different kinds of transposable elements | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/14%3A_Repetitive_DNA_A_Eukaryotic_Genomic_Phenomenon/14.02%3A_The_Complexity_of_Genomic_DNA.txt |
Barbara McClintock’s report that bits of DNA could jump around and integrate themselves into new loci in DNA was so dramatic and arcane that many thought the phenomenon was either a one-off, or not real! Only with the subsequent discovery of transposons in bacteria (and in other eukaryotes) were McClintock’s jumping genes finally recognized for what they were! As we describe her experiments, keep in mind that McClintock’s research and intuitions about gene regulation and epigenetic inheritance came long before molecular technologies made it possible to prove and give names to these phenomena. To begin our tale of transposons, look at the illustration of maize reproduction below.
The different colors of corn seeds (ker nels) result from anthocyanin pigments that are expressed differentially by cells of the aleurone tissue. Mclintock was studying the inheritance of color variation, which ranged from colorless (white or yellow due to an absence of anthocyanins) to brown, purple, spotted or streaked.
The mosaic of kernel colors are vividly shown the corncobs in the photograph below
Clearly, kernel color is inherited. The inheritance of colorless and purple seed color did indeed follow Mendelian rules, but the genetics of mosaicism did not. Mosaic color patterns after genetic crosses were not consistent, implying that the mutations responsible for kernel color were not due to mutations in germ cells. Rather, genes controlling anthocyanin synthesis must be undergoing mutations in somatic cells that would become (or already were) the ones in which the pigments were produced.
242 What Interested McClintock About Maize
A. Discovering the Genes of Mosaicism; the Unstable Ds Gene
McClintock was looking for a genetic explanation for seed color variation in the 1940s and early 1950s. DNA structure had only recently been published. Gene cloning and DNA sequencing were decades into the future! Her only available technologies were based on understanding Mendelian allelic assortment in traditional breeding studies. Nevertheless, since seed color is expressed in cells derived from endosperm, she knew that the inheritance of kernel color phenotype must be studied against a triploid genetic background. McClintock was also aware of proposals that the variegated color phenotype might result when an ‘unstable mutation’ that produced colorless kernels ‘reverted’ in some cells but not others to create a spotted or streaked phenotype. Just what made for an ‘unstable mutation’ was of course, unknown. McClintock ultimately identified three genes involved in seed kernel coloration. Two of the genes initially studied by McClintock controlled the presence vs. absence of kernel color. These are the C and Bz genes:
1. C' is the dominant inhibitor allele, so-called because if even one copy was present, the kernels were colorless (yellow), regardless of the rest of the genetic background
2. Bz and bz are dominant and recessive alleles of the Bz gene, respectively. In the absence of a C’ (dominant) allele, the presence of a Bz allele would lead to purple kernels. If the bz allele was present without both C’ and Bz alleles, the kernels would be dark brown.
3. The gene required to get variegated kernel color was the Ds (Dissociator) gene. Without a viable Ds gene, kernels were either colored or colorless depending on the possible genotypes dictated by the C and Bz alleles.
In other words, it must be the Ds gene that suffers ‘unstable mutations. Because the Ds gene effect was random and only affected some aleurone layer cells, it was suspected to be a region of chromosomal instability (prone to damage or breakage) in some cells but not others. Let’s look at what McClintock did to figure out what was going on in corn kernel color genetics.
Having already demonstrated crossing-over in maize (actually, another remarkable achievement!), McClintock mapped the C’, Bz and Ds genes to Chromosome 9. She then selectively mated corn with the genotypes shown in the protocol below.
Remember that triploid cell genotypes are being considered in this illustration! You can refer to the phenotypic effects of the allelic backgrounds of three genes as we follow McClintock’s cross. Her cross of a homozygous recessive with a homozygous dominant plant should ring a bell! Let’s look more closely at this cross.
The expected triploid genotypes from the cross are shown below.
Aleurone cells resulting from this cross should all be colorless (yellow) because of the presence of the dominant C’ allele. However, while there were indeed many colorless kernels on the hybrid cob, there were also many mosaic kernels with dark spots/streaks against a colorless background. McClintock’s interpretation of events is illustrated below
According to McClintock, if some aleurone layer cells in some kernels suffered chromosome breakage at the Ds (Dissociator) locus (indicated by the double slash, //), the C’ allele is inactivated. Without a functional C’ allele, the operative genotype in the affected cells is CCbzbz. These cells then revert to making the brow pigment as directed by the bz allele. When these cells divide, they create clusters of brown cells surrounded by cells with an unbroken chromosome and thus an active C’ allele, creating the appearance of pigment spots or streaks in the kernel, against the otherwise colorless background in the surrounding cells.
243 Variegated Maize Kernels result from "Loss" of the Ds Gene
B. The Discovery of Mobile Genes: the Ac/Ds System
The experiments just described were reproducible using a single breeding stock of maize. But when McClintock tried to repeat the experiments by crossing the homozygous dominant males with homozygous recessive females from a different breeding stock, all the kernels of the progeny cobs were colorless, as if the Ds gene had not caused any chromosomal damage.
It seemed that the Ds gene contributed by the male was unable to function (i.e., ‘break’) in females of this new breeding stock. McClintock hypothesized that the female in the original cross must have contributed a factor that could somehow activate the Ds gene to break, and that this factor, yet another gene, was absent or inactive in the females of the new breeding stock. McClintock called the new factor the activator, or Ac gene. Based on the dependence of Ds on the Ac locus, McClintock recognized that these ‘genes’ were part of as a 2-element, Ac/Ds system influencing mosaicism in maize kernels.
She then demonstrated that Ac-dependent Ds ‘breakage’ was in some cases also associated with inactivation of a normal Bz gene, leading to a loss of purple color kernels. It was at this point that McClintock concluded that far from simply ‘breaking’ the chromosome at a fragile Ds locus, the Ds gene had actually moved to (or into) the Bz gene, disrupting its function. Again, this could not happen in the absence of an active Ac gene. McClintock had discovered the first transposon, earning the 1983 Nobel Prize in Physiology or Medicine! With the advent of recombinant DNA technologies, we now know that:
1. The Ds element is a transposon missing a gene for a transposase enzyme required for transposition.
2. The Ac element has this gene and is capable of independent transposition.
3. Ac provides the transposase needed to mobilize itself and the Ds element
4. The sequence similarity of Ds and Ac elements support their common ancestory.
The basic features of the maize Ac/Ds system are:
1. Ac is 4563 bp long.
2. Ds is a truncated version of Ac.
3. There are eleven bp inverted repeats at either end of the Ac and Ds element.
4. There are eight bp direct repeats (NOT inverted repeats) of 'target DNA' at the site of insertion of either transposon.
Look for these features as we describe prokaryotic and eukaryotic transposons.
244 Discovery of Mobile Elements and the Ac-Ds System
245 The Ac-Ds System Today | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/14%3A_Repetitive_DNA_A_Eukaryotic_Genomic_Phenomenon/14.03%3A_The_%27Jumping_Genes%27_of_Maize.txt |
Transposons exist everywhere we look in prokaryotes and account for much of eukaryotic repetitive DNA. As such, they can be a large proportion of eukaryotic genomes, including some that no longer even transpose. Transposons were once considered useless or junk DNA, with no obvious function…, or selfish genes with no other purpose than selfreplication. But in light of some new evidence, perhaps not!
As you will see, mechanisms of transposition share many features with DNA replication, recombination and repair, and even viral infection. As you study these mechanisms, keep in the back of your mind that transposition is often triggered by cellular stress.
A. Insertion Sequences (IS Elements)
Bacterial IS elements were the first mobile elements described after those in maize. As we’ll see, they share some structural features of eukaryotic transposons. Discovered in the late 1960s, many have been identified (IS1, IS2…, IS10 etc.). Some are inserted into well-known genes (e.g., those of the lac operon), but most are not, likely because there is little ‘extra’ DNA in the compact bacterial genome. Without extra non-coding DNA to buffer against damaging mutations, few bacterial cells would live to tell a tale of transposition! It should surprise us that IS elements can be made to transpose in the lab, but are generally silent in nature.
Members of the IS element family vary in length from about 750 to 1425 bp. Within this stretch of DNA lie transposase and resolvase genes whose products are necessary for mobility. At either end of the IS element are inverted repeats, and when found in either genomic or plasmid DNA, the IS sequence itself is flanked by direct repeats of host genome or plasmid DNA that result from the mechanism of transposition. Again, because of their compact genomes, bacteria can only tolerate low copy numbers of IS elements in their genome or on plasmids (less than ten copies and as few as one!). A typical IS element is illustrated below.
B. Composite Transposons: Tn Elements
If a pair of IS elements should lie close to each other, separated by a short stretch of genomic or plasmid DNA, they can transpose together, carrying the DNA between them as part of a composite transposon, or Tn element. If some of the DNA between IS elements in a Tn element contains antibiotic resistance genes, its transposition can carry and spread these genes to other DNA in the cell. Tn elements (like IS elements) are present in low copy number. A generic Tn element is drawn below.
Antibiotic resistance genes have the medical community worried; their spread has led to antibiotic-resistant pathogens that cause diseases that are increasingly hard and even impossible to treat. Earlier we saw genetic ‘transformation’ of streptococcal cells that pick up virulence genes in DNA from dead cell. We routinely transform cells with plasmids as part of recombinant DNA experiments. But bacteria can transfer plasmid DNA between themselves quite naturally. During bacterial conjugation, an F (fertility) plasmid normally transfers DNA between compatible bacterial mating types (review bacterial conjugation elsewhere in this text for more details). An F plasmid containing a Tn element harboring an antibiotic resistance gene can thus is passed from donor to recipient during conjugation. The Tn element can transpose into to the recipient bacterial genome. In this way, transposition is a major pathway for the transfer and spread of antibiotic resistance.
C. Complex Transposons
Bacterial Complex Transposons also contain other genes in addition to those required for mobility. Some complex transposons resemble a bacteriophage, or as in the case of phage Mu, actually are phage! In fact, Mu can function either as an infectious phage that reproduces in an infected cell, or as a transposon in the bacterial genome. Transposon genes in Mu phage are illustrated below.
After infecting a bacterium, Mu can enter the lytic phase of its life cycle, replicating its DNA, producing and ultimately releasing new infectious phage ‘particles’ by lysing the host bacterial cell. Alternatively, like other phage, Mu can undergo lysogeny, inserting its DNA into the host cell chromosome. Integrated copies of Mu might excise and re-enter the lytic phase to produce more phage, particularly if some environmental stress threatens host bacterial survival. But, a third lifestyle choice, transposition, is available to Mu once the phage integrates into the bacterial chromosome. The three lifestyle options for Mu phage are illustrated in the next few pages.
Lytic and lysogenic lifestyle options for Mu phage are shown below.
Mu phage DNA can act as a transposable element while in the lysogenic pathway, as shown below
264 Bacterial Mobile Elements
As we turn to a description of eukaryotic transposons, look for similarities to bacterial IS and Tn elements.
D. Overview of Eukaryotic Transposable Elements
There are two classes transposons in eukaryotes:
Class I (Retrotransposons) move/’jump’ by transcription of RNA at one locus, followed by reverse transcription and integration of the cDNA back into genomic DNA at a different location. Retrotransposons may be derived from (or be the source of) retroviruses since active retroviruses excise from and integrate into DNA much like retrotransposons. Retroposons are a sub-class of retrotransposons (see below).
Class II (DNA Transposons) move by one of two mechanisms. In the cut-&-paste pathway, the transposon leaves one locus and integrates at another. In the replicative pathway, the original transposon remains in place while new copies are mobile. The table below shows the distribution and proportion of genomes represented by different classes/types of transposable elements.
The table confirms that bacteria contain few transposons, while eukaryotes vary widely in transposon load (transposons as a percentage of genomic DNA), from as low as 4% to more than 70%.
The table below summarizes transposable elements by class, sub-type, size, genomic distribution, mechanism of transposition, etc.
Between the two tables above, we can conclude the following:
• Transposon load is not correlated with evolutionary complexity of organisms.
• Shared Transposons have different evolutionary histories in different organisms.
• Where transposons remain active, they continue to shape genomic landscapes, especially in organisms with a high transposons load.
We will revisit some of these conclusions later, after looking at the structure and mechanism of mobility of different transposable elements.
247 Introduction to Eukaryotic Transposons
E. The Structure of Eukaryotic DNA (Class II) Transposons
Active eukaryotic DNA transposons share structural features with bacterial mobile elements, including genes required for transposition, flanking inverted repeats and flanking insertion-site direct repeats of host cell DNA. The characteristic structure of a eukaryotic DNA transposon is shown below.
Class II transposons can ‘jump’ by cut-and-paste or replicative mechanisms. Cut-and-paste transposition removes a copy from one location and moves (transposes) it to another location. As its name suggests, replicative transposition leaves a copy of the original transposon in place while inserting a new copy elsewhere in the genome. Transposition by the cut-and-paste mechanism is diagrammed below.
Note that after transcription of the transposase gene, the enzyme nicks the DNA and trims the 3’OH ends to create a staggered cut to excise the transposon. The transposase actually brings the transposon ends together during the cut step and mediates its insertion at a new DNA site. After ligation of the 3’OH ends of the transposon to the 5’OH at the insertion site, replication replaces the missing bases, generating the direct repeats of host cell genomic DNA at the insertion site. A final ligation step completes transposition.
In the replicative transposition, the transposon also nicks and trims the DNA at its source (original) insertion site. But, unlike the cut and paste mechanism, the source transposon is not excised.
Details of the replicative mechanism of transposition is summarized below.
After nicking the 3’ ends of the transposon at the insertion site, transposase holds the transposon ends together while catalyzing a hydrolytic attack of DNA at a new insertion site. This is followed by priming of transposon strand replication from the 3’OH ends of the insertion site DNA strands. A cointegrate structure forms in which each transposon copy has been made by semi-conservative replication. The cointegrate is resolved by one of two recombinational mechanisms. The result leaves copies of the transposon at both the original site and the new insertion site.
Let’s compare and contrast the features of cut-&-paste and replicative DNA transposition. The common features are that:
• Transposon-encoded transposase binds, brings transposon ends together and catalyzes single-stranded cleavage (hydrolysis) leaving ‘staggered ends’.
• Transposase holds the transposon ends together for the remaining steps.
The differences between the two mechanisms are that in cut & paste transposition, the transposon is completely excised and then transposed to a new site in genomic DNA. In contrast, after single stranded cleavage in replicative transposition, transposase-bound free 3’ ends of the transposon hydrolyze both strands of stranded DNA at a new insertion site. After ligation of the 3’ ends of transposon strands to 5’ ends of cut genomic DNA insertion-site ends, the remaining 3’ ends of the insertion site DNA ends prime replication of the transposon, forming the cointegrate, which is followed by its resolution by one of two recombination pathways.
248 Eukaryotic Class II (DNA) Transposition
F. The Structures of Eukaryotic RNA (Class I) Transposons
Like DNA transposons, all RNA transposons leave insert-site footprints, i.e., direct repeats of genomic DNA flanking the element. Unlike DNA transposons, active eukaryotic Class I transposons move via an RNA intermediate. Also unlike DNA transposons, they lack terminal inverted repeats.
The mobility of the RNA intermediate of all retrotransposons requires a promoter that recognizes a reverse transcriptase enzyme as well as endonuclease and integrase enzymes (to be described below). Autonomous Class I RNA transposons include LTR retrotransposons (e.g., the yeast Ty element) as well as Non-LTR retrotransposons). The latter include the autonomous LINEs (Long Interspersed Nuclear Elements). The autonomous LTR and Non-LTR LINEs contain and express genes needed for enzymes required for transposition. On the other hand, SINEs (a sub-class of Non-LTR retrotransposons) lack genes for enzymes required for transposition and therefore can’t transpose independently. Thus, they are non-autonomous retrotransposons that rely on “true” (autonomous) retrotransposon activity for mobility. SINEs are sometimes called retroposons to distinguish them from the autonomous retrotransposons.
249 Introduction to Features of Retrotransposition
Next we take a closer look at Retrotransposon structures and the genes and enzyme activities required for retrotransposition
1. LTR retrotransposons: The Yeast Ty Element
The Ty transposon harbors several genes needed for transposition. These include:
• the Gag gene that encodes group-specific antigen, a protein that forms a viruslike particle that will contain reverse-transcribed transposon DNA,
• the RT gene that encodes the reverse transcriptase that will make reversetranscribed copies of retrotransposon transcript RNAs.
• the Prt gene that encodes a protease that will break down the virus-like particle as the retrotransposon enters the nucleus.
• the Int gene that encodes the integrase required for integration of the retrotransposon into a genomic DNA insertion site.
A representative Ty element is shown below as it would exist integrated into yeast genomic DNA.
In fact, many of the events in Ty transposition occur in the cytoplasmic “virus-like particle” in yeast cells. To see more, click here. Note that the Pol region in the illustration above consists of overlapping open reading frames (ORFs) encoding the Prt, RT and Int genes. The ready-to-move transposon consists only of the region of DNA symbolized in yellow.
250 LTR Retrotransposons- the TY Element
2. Non-LTR Retrotransposons: LINEs
LINEs (Long Interspersed Nuclear Elements) also encode enzymes needed for transposition and like other transposons, generate target-site direct repeats flanking the inserted element. But they do not have the long terminal repeats! Instead, their ORFs (genes) are flanked by 5’ and a 3’ untranslated regions (UTRs).
The structure of the human L1 Line is drawn below.
The 5’ UTR contains a promoter from which cellular RNA polymerase II can transcribe the downstream genes (see the Transcription chapter). The second of these (ORF2) encodes the reverse transcriptase and an integrase activity essential for transposition of the LINE. All Class I (RNA-intermediate) autonomous transposons share the following features:
a) a Promoter in the 5’ UTR from which they can be transcribed.
b) a Reverse Transcriptase that generates a cDNA copy of the transposable element.
c) RNAse H (an endonuclease) that degrades that transcript after reverse transcription.
d) Integrase (like a transposase) that catalyzes insertion of the retrotransposon copy at insertion sites.
251 Non-LTR Retrotransposons: LINEs
3. Non-LTR SINE retrotransposons
Non-LTR SINE retrotransposons typically lack genes, but their non-genic DNA is nonetheless flanked by 5’ and 3’ UTRs. RNA polymerase III, which also transcribes transfer RNAs, also transcribes SINEs. However, to transpose, they rely on the concurrent activity of a Non-LTR transposon (a LINE) to provide the requisite enzymatic activities.
A typical SINE (e.g., the Alu element) is shown below.
252 Non-LTR Retrotransposons: SINEs
G. Mechanisms of Retrotransposition
There are two mechanisms of retrotransposition: Extrachromosomally Primed Retrotransposition (LTR retrotransposons for example) and Insertion Target-Site Primed Retrotransposition (non-LTR Retrotransposons like LINEs and SINEs). These will be considered next.
1. Extrachromosomally Primed Retrotransposition (e.g., of a LINE)
As its name suggests, in extrachromosomally primed retrotransposition, a circular reverse transcript of the retrotransposon attacks, nicks and integrates into a genomic insertion site. In this mechanism, reverse transcriptase creates a cDNA copy of a transcribed retro-element. Integrase/endonuclease then binds the cDNA copy, holding the ends together, in effect circularizing it. This isolable ribonucleoprotein resembles an intasome, a structure similar to the nucleoprotein complex that catalyzes the integration of retroviral cDNAs during lysogeny.
Extrachromosomally primed retrotransposition is illustrated below.
The three-dimensional structure of a retroviral intasome interacting with DNA and nucleosomes was recently determined (for more, see Retroviral Intasome 3D Structure). In this form, the retrotransposon attacks DNA at an insertion site, creating staggered ends. After insertion, the gaps in the DNA are filled in. Ligation seals the retrotransposon in its new location, creating direct insertion site repeats.
253 Extrachromosomally Primed Retrotransposition
2. Target-Site Primed SINE Retrotransposition (e.g., of a SINE)
A key feature of target-site primed retrotransposition (retroposition) is the absence of an integrase-bound, circular double-stranded reverse transcript. In SINE transposition, RNA polymerase III (the same enzyme that catalyzes tRNA and 5S rRNA transcription) transcribes the SINE. If a LINE is concurrently transcribed, its enzymes will be made. When its integrase-endonuclease catalyzes hydrolysis of one strand of DNA at a new insertion site, the 3’OH end of this strand can prime reverse transcription of the one SINE cDNA strand by the LINE reverse transcriptase. After hydrolysis of the second target site DNA strand, its 3’-OH end primes replication of the second strand of the SINE cDNA. Integrase completes insertion of the copy-SINE in its new genomic location. The target-site primed retrotransposition mechanism of retrotransposition is illustrated below.
254 Target Primed Retrotransposition | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/14%3A_Repetitive_DNA_A_Eukaryotic_Genomic_Phenomenon/14.04%3A_Transposons_Since_McClintock.txt |
We noted that transposons in bacteria carry antibiotic resistance genes, a clear example of benefits of transposition in prokaryotes. Of course, prokaryotic genomes are small, as is the typical bacterial transposon load. Yeast species also have low transposon load. But, what can we make of the high transposon load in eukaryotes?
To many, the fact that genes encoding proteins typically represent only 1-2% of a eukaryotic genome meant that the rest of the genome was informationally non-essential. Even though transposons turn out to be much of the non-coding DNA in some eukaryotic genomes, they seemed to serve no purpose other than their own replication. For many organisms, large amounts of transposon DNA were dubbed selfish DNA and their genes, selfish genes.
Are transposons just junk DNA, some kind of invasive or leftover genomic baggage? Given their propensity to jump around and potential to raise havoc in genomes, how do we tolerate and survive them? Is the sole ‘mission’ of transposons really just to reproduce themselves? Or are transposons tolerated because they are neither selfish nor junk? By their sheer proportions and activity in eukaryotic genomes, we will see that transposons have dispersed into, and re-shaped genomic landscapes. Do the consequences of transposition (relocation dispersal through a genome, structural alteration and mutation of genes) have any functional or evolutionary value? While all of these questions are a reasonable response to the phenomena of jumping genes, a rational hypothesis would be that, like all genetic change, transposons began by accident. But, their spread and ubiquity in genomes of higher organisms must in the long term have been selected by virtue of some benefit that they provide to their host cells and organisms. Let’s briefly looks at the evolutionary history of transposons to see if this assumption has some merit.
A. A Common Ancestory DNA and RNA (i.e., All) Transposons
Transposases catalyze the cut-and-paste as well as the replicative transposition of Class II (DNA) transposons. Integrases catalyze insertion of reverse-transcribed retrotransposons. Bottom line: both enzymes end by catalyzing insertion of transposons into new DNA locations. So, it should not be surprising that class I and II transposons enzymes share similar amino acid sequence and domain structures. These similarities support a common ancestry of class I and II transposons. Sequence comparisons of transposable elements themselves reveal that they comprise distinct families of related elements.
This allows us to speculate on the origins of these families in different species. For example, the TC1/mariner (DNA) transposon is found in virtually all organisms examined (except diatoms and green algae). Based on sequence analysis, there is even an insertion element in bacteria related to the mariner element. This amount and diversity of conservation bespeaks an early evolution of the enzymes of transposition, and of transposition itself, within and even between species. Linear descent, or the ‘vertical” transmission of transposons from parents to progeny, is the rule. However, the presence of similar transposons in diverse species is best explained by interspecific DNA (“horizontal”) transfer. That is, a transposon in one organism must have been the ‘gift’ of an organism of a different species! This is further discussed below. Clearly, moveable genes have been a part of life for a long time, speaking more to an adaptive value for organisms than to the parasitic action of a selfish, rogue DNA!
B. Retroviruses and LTR Retrotransposons Share a Common Ancestry
The ‘integration’ domain of retrotransposons and retroviruses share significant similarities as shown below.
The question raised by these observations is: Did transposons (specifically retrotransposons) arise as defective versions of integrated retrovirus DNA (i.e., reverse transcripts of retroviral RNA)? Or, did retroviruses emerge when retrotransposons evolved a way to leave their host cells. To approach this question, let’s first compare mechanisms of retroviral infection and retrotransposition.
In addition to the structural similarities between the enzymes encoded by retrotransposon and retroviral RNAs, LTR retrotransposons and retroviruses both contain flanking long terminal repeats. However, retrotransposition occurs within the nucleus of a cell while retroviruses must first infect a host cell before the retroviral DNA can be replicated and new viruses produced (check out Visualizing Retroviral Infection to see how immunofluorescence microscopy using antibodies to singlestranded cDNAs was used to track the steps of HIV infection!). A key structural difference between retrotransposons and most retroviruses is an ENV gene-encoded protein envelope surrounding retroviral DNA. After infection, the incoming retrovirus sheds its envelope proteins and viral RNA is reverse transcribed. After the reverse transcripts enter the nucleus, transcription of genes and translation of enzymes here.
• Retroviral DNA, like any genomic DNA, is mutable. If a mutation inactivates one of the genes required for infection and retroviral release, it could become an LTR retrotransposon. Such a genetically damaged retroviral integrate might still be transcribed and its mRNAs translated. If detected by its own reverse transcriptase, the erstwhile viral genomes would be copied. The cDNAs, instead of being packaged into infectious viral particles, would become a source of so-called endogenous retroviruses (ERVs). In fact, ERVs exist, making up a substantial portion of the mammalian genome (8% in humans)… and do in fact, behave like LTR retrotransposons!
• Yeast TY elements transcribe several genes during retrotransposition (see the list above), producing not only reverse transcriptase and integrase, but also a protease and a structural protein called Gag (Group-specific antigen). All of the translated proteins enter the nucleus. Mimicking the retroviral ENV protein, the Gag protein makes up most of a coat protein called VLP (virus-like particle). VLP encapsulates additional retrotransposon RNA in the cytoplasm, along with the other proteins. Double-stranded reverse transcripts (cDNAs) of the viral RNA are then made within the VLPs. But, instead of bursting out of the cell, the encapsulated cDNAs (i.e., new retrotransposons) shed their VLP coat and re-enter the nucleus, where they can now integrate into genomic target DNA. Compare this to the description of retroviral infection. During infection, retroviral envelope proteins attach to cell membranes and release their RNA into the cytoplasm. There, reverse transcriptase copies viral RNA into double-stranded cDNAs that then enter the nucleus where they can integrate into host cell DNA. When transcribed, the integrated retroviral DNA produces transcripts that are translated in the cytoplasm into proteins necessary to form an infectious viral particle. The resulting viral RNAs are encapsulated by an ENV (envelope) protein encoded in the viral genome. Of course, unlike VLP-coated retrotransposon RNAs, the enveloped viral RNAs do eventually lyse the host cell, releasing infectious particles. Nevertheless, while VLP coated Ty elements are not infectious, they sure do look like a retrovirus!
Common mechanisms of retrovirus and retrotransposon replication and integration clearly support their common ancestry, but they do not indicate origins. On the one hand, the origin of ERVs from retroviruses might imply an origin of retrotransposons from retroviruses. On the other, transposons have been around since the earliest prokaryotic cells, but that retrotransposons arose with eukaryotes. In that case, Type II (DNA) transposable elements were around before retroviruses.
The phylogenetic analysis below is based on comparisons of retroviral and retrotransposon reverse transcriptase gene DNA sequences.
Comparisons of aligned DNA sequences permit evolutionary analyses that reflect phylogenetic relationships of genes (in this case, retrotransposon and viral genes), in much the same way the evolutionary biologists historically demonstrated evolutionary relationships of plants and animals by comparing their morphological characteristics. The data in the analysis supports the evolution of retroviruses from retrotransposon ancestors. From the ‘tree’, TY3 and a few other retrotransposons share common ancestry with Ted, 17.6 and Gypsy ERVs (boxed) in the ”Gypsi-TY3 subgroup”. Further, this sub-group shares common ancestry with more distantly related retroviruses (e.g., MMTV, HTLV…), as well as the even more distantly related (older, longer diverged!) Copia-TY1 transposon sub-group. This and similar analyses suggest strongly that retroviruses evolved from a retrotransposon lineage [For a review of retroposon/retrovirus evolution, check Lerat P. & Capy P. (1999, Retrotransposons and retroviruses: analysis of the envelope gene. Mol. Biol. Evol. 19(9): 1198-1207).
C. Transposons Can Be Acquired by "Horizontal Gene Transfer"
As noted, transposons are inherited vertically, meaning that they are passed from cell to cell or parents to progeny by reproduction. But they also may have spread between species by horizontal gene transfer. This just means that organisms exposed to DNA containing transposons might inadvertently pick up such DNA and become transformed as the transposon becomes part of the genome. Accidental mobility of transposons between species would have been rare, but an exchange of genes by horizontal gene transfer would have accelerated with the evolution of retroviruses. Once again, despite the potential to disrupt the health an organism, retroviral activity might also have supported a degree genomic diversity useful to organisms.
255 Transposon Evolution | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/14%3A_Repetitive_DNA_A_Eukaryotic_Genomic_Phenomenon/14.05%3A_On_the_Evolution_of_Transposons_Genes_and_Genomes.txt |
A. Transposons and Exon Shuffling
A role for unequal recombination in moving exons in and out of different eukaryotic split genes was described earlier. This kind of exon shuffling could happen when short DNA sequences in two different introns misalign during meiotic synapsis, allowing for unequal crossing over. Expression of a gene with a ‘new’ exon produces a protein with a new domain and a new activity. If the event is not harmful, diversity is increased!
When found in introns, transposons are long regions of DNA similarity that can stabilize synapsis, increasing the chances of unequal recombination and exon shuffling. For example, Alu (SINE) elements are often found within introns, where they can integrate with no ill effect. The similarity of Alu elements in the introns of unrelated genes does seem to account for exon shuffling by unequal crossing over between the different genes that share domains and specific functions as a result. Another way in which transposons facilitate germ line cell exon shuffling is more direct. Imagine a pair of transposons in introns of a gene on either side of an exon. Should such transposons behave like the two outer IS elements in a bacterial Tn element (discussed above), they might be excised as a single, large transposon containing an exon. The paired transposons flanking the exon might then insert in an intron of a completely different gene! This possibility is illustrated on the next page.
Transposon-mediated exon shuffling can explain insertion of exon-encoded domains of epidermal growth factor (EGF) into several unrelated genes. The mitogen EGF was discovered because it stimulated skin cells to start dividing. The gene for TPA (tissue plasminogen activator, a blood-clot dissolving protease) shares EGF gene domains. TPA is a treatment for heart attack victims that, if administered rapidly after the attack, can dissolve the clot and allow coronary artery blood flow to heart muscle to resume. Other genes that contain EGF domains include those for Neu and Notch proteins, both involved in cellular differentiation and development.
Some exon shuffling events may have been mediated by LINE transposition and by a special group of recently discovered transposons called helitrons. Helitrons replicate by a rolling circle mechanism. If you are curious about helitrons, do a google search to learn more about them, and what role they may have had in refashioning and reconstructing genomes in evolution. The general pathway of exon shuffling involving paired proximal DNA transposons is illustrated below.
In the generic example shown above, exon 2 of gene A has been inserted, along with flanking transposons, into another gene (gene B).
B. Transposon Genes and Immune System and Genes Have History
Several important eukaryotic genes may have been derived from transposons. Perhaps the most intriguing example of this is to be found in the complex vertebrate immune system. Our immune system includes immunoglobulins (antibodies). You inherited genes for immunoglobulin proteins from your parents.
These genes contain multiple variant V, D, and J regions linked to a C region. V, D, J and C are defined as Variable, Joining, Diversity and Constant DNA regions, respectively. They will recombine to create many diverse V-D-J-C immunoglobulin antibody molecules (the D region is not always included in the final recombined gene). These gene rearrangements occur during the maturation of certain stem cells in bone marrow that will become immune cells (B or T lymphocytes). In response to a challenge by foreign substances called antigens, cells will be selected that contain rearranged immunoglobulin genes coding for immunoglobulins that can recognize, bind and eliminate the invading antigens.
A discussion of the molecular biology of the immune system is beyond our scope here. Suffice it to say that the recombinational pathway of immunoglobulin gene rearrangements includes enzymatic activities very similar to those of transposition. In fact, the so-called RAG1 enzyme active in immunoglobulin gene rearrangement is closely related to genes in a family of transposons (transib) found in invertebrates and fungi. Thus, it looks like genes of the immune system might have their origins in a transposon!
14.07: Coping with the Dangers of Rampant Transposition
Most organisms do not have the high transposon load that we have. For those like us, and given a general tendency of transposons to insert at random into new DNA loci, how come we exist at all? Isn’t the danger of transposition into essential gene sequences magnified by the possibility of multiple simultaneous transpositions of elements generated by cut-and-paste and especially replicative mechanisms? Indeed, transposons have been found in genes that are inactive as a result.
An obvious explanation for our survival of transposon activity is that most transposition is into the >90% percent of the genome that does not code for proteins. Another is that eukaryotic organisms have two copies of every gene, so that if one is inactive, the other may sustain us. Beyond this, several mechanisms exist to silence a transposon after transposition has occurred, mitigating the dangers of rampant transposition. As long as a transposition is not lethal (e.g., because its integration disrupts an activity essential to life), the cell and organisms can survive the event. In time, mutations at the ends of CMB3e 344 transposons or in genes responsible for transposition would render them inactive. Finally, there may be a more direct curb on transposition. The small interfering RNAs (siRNAs) we encountered earlier could complement and target viral RNAs for destruction (see the Transcription chapter for more information on siRNAs). There is some evidence that siRNAs similarly target transposon transcripts.
Summing up, transposon activity is moderated by mutational loss of function and/or by more direct mechanisms that limit transposition and thus genetic damage. If an accumulation of transposons to a high load, as occurs in many species, were deleterious, they would be limited or eliminated from genomes. Instead, persistent transposons and acts of transposition are largely neutral, increasing options for diversity in the selection of new genotypes and phenotypic characteristics. We also know now that transposons can function in genetic regulation. Thus, transposons are neither selfish nor junk DNA. Check out these links for more: Not junk after all? and Eulogy for Junk DNA.
256 Transposons- Junk or Not
14.08: Key Words and Terms
Alu Gag non-homologous recombination
anthocyanins genomic complexity Non-LTR transposons
antibiotic resistance genes heterochromatin protease
antibodies immune system protein coat
autonomous transposon immunoglobulin genes prt
bacterial composite transposons integrase renaturation kinetics
bacterial IS elements inverted repeats Repetitive DNA
bacterial Tn elements jumping genes replicative transposition
bacteriophage L1 resolvase
centromere LINE retrotransposon
chromatin LTR (long terminal repeats) retrovirus
chromosomes LTR transposons RNA transposon
Class I transposon lysis satellite DNA
Class II transposon lysogeny SINE
cointegrate lytic pathway of phage spindle fibers
CoT curves maize AC (activator) gene telomeres
cut-and-paste transposition maize Ds (dissociator) gene transposase
density gradient centrifugation mariner triploid endosperm
direct repeats McClintock Ty
DNA sequence phylogeny mosaicism viral infection
exon shuffling Mu phage
fertility (F) plasmids non-autonomous transposon | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/14%3A_Repetitive_DNA_A_Eukaryotic_Genomic_Phenomenon/14.06%3A_Roles_of_Transposition_in_Evolution_and_Diversity.txt |
Learning Objectives
1. Suggest molecular techniques to design experiments (e.g., how would you use cDNA or a PCR product to clone a gene).
2. Determine when to make or use a cDNA library or a genomic library
3. Outline an experiment to purify rRNA from eukaryotic cells.
4. Outline an experiment to isolate a cDNA for a human protein and clone it so you can manufacture insulin for the treatment of disease.
5. Explain why you might want to clone and express a human growth hormone gene.
6. List components needed to make a cDNA library using purified poly(A) RNA.
7. List the components needed to make a genomic library from isolated genomic DNA.
8. Compare PCR and genomic cloning as strategies for isolating a gene.
9. Outline a strategy for using fly DNA to obtain copies of a human DNA sequence.
10. Ask a question that requires screening a genomic library to obtain a gene you want to study
11. Ask a question that requires using a microarray to obtain a gene you want to study
• 15.1: Overview
We start this chapter by looking at technologies that led to genetic engineering. The ability of make recombinant DNA is such a seminal technology that just realizing it could be done and then doing it in a test tube for the first time earned Paul berg a half-share in the 1980 Nobel Prize in Chemistry (the other half was shared by Walter Gilbert and Frederick Sanger for studies that enabled efficient DNA sequencing).
• 15.2: Make and Screen a cDNA Library
The first step in making a cDNA library is to isolate cellular mRNA. This mRNA extract should represent all of the transcripts in the cells at the time of isolation, or the cell’s transcriptome. This term is used by analogy to genome. However, a genome is all of the genetic information of an organism. In contrast, a transcriptome (usually eukaryotic) reflects all of the genes expressed in a given cell type at a moment in time.
• 15.3: DNA Sequencing
RNA sequencing came first, when Robert Holley sequenced a tRNA in 1965. The direct sequencing of tRNAs was possible because tRNAs are small, short nucleic acids, and because many of the bases in tRNAs are chemically modified after transcription. An early method for DNA sequencing developed by Walter Gilbert and colleagues involved DNA fragmentation, sequencing of the small fragments of DNA, and then aligning the overlapping sequences of the short fragments to assemble longer sequences.
• 15.4: Genomic Libraries
A genomic library might be a tube full of recombinant bacteriophage. Each phage DNA molecule contains a fragmentary insert of cellular DNA from a foreign organism. The library is made to contain a representation of all of possible fragments of that genome. The need for vectors like bacteriophage that can accommodate long inserts becomes obvious from the following bit of math.
• 15.5: The Polymerase Chain Reaction (PCR)
The polymerase chain reaction (PCR) can amplify a region of DNA from any source, even from a single cell’s worth of DNA or from fragments of DNA obtained from a fossil. This amplification usually takes just a few hours, generating millions of copies of the desired target DNA sequence. The effect is to purify the DNA from surrounding sequences in a single reaction!
• 15.6: Genomic Approaches- The DNA Microarray
Traditionally, when cellular levels of a protein were known to change in response to a chemical effector, molecular studies focused on control of the transcription of its gene. These studies often revealed that the control of gene expression was at the level of transcription, turning a gene on or off through interactions of transcription factors with DNA.
• 15.7: Ome-Sweet Ome
Early molecular technologies, including the ones described in this chapter, were applied to understanding the structure, function and regulation of specific genes. Some of the more recent technologies (e.g., microarrays) are well adapted to holistic approaches to understanding cell function. Terms we have already seen (genome, epigenome, transcriptome) were coined in an effort to define the different objects of study whose underlying network of molecular interactions can more accurately explain
• 15.8: From Genetic Engineering and Genetic Modification
By enabling us to focus on how genes and their regulation have evolved, these genomic, transcriptomic and proteomic technologies have vastly increased our knowledge of how cells work at a molecular level. We continue to add to our knowledge of disease process and in at least a few cases, how we can treat disease.
• 15.9: Key Words and Terms
15: DNA Technologies
We start this chapter by looking at technologies that led to genetic engineering. The ability of make recombinant DNA is such a seminal technology that just realizing it could be done and then doing it in a test tube for the first time earned Paul berg a half-share in the 1980 Nobel Prize in Chemistry (the other half was shared by Walter Gilbert and Frederick Sanger for studies that enabled efficient DNA sequencing). First we’ll look at cDNA synthesis, the synthesis of DNA copies from RNA, something retroviruses routinely do as part of the pathway of their reproduction. The retrovirus injects its RNA into target cells where it transcribes a reverse transcriptase enzyme. The enzyme reversetranscribes a copy DNA (the cDNA) complementary to the viral RNA. The First steps in retroviral infection is summarized in the illustration below.
The same reverse transcriptase enzyme makes a double stranded cDNA, or (ds)cDNA, which then replicates. These cDNAs are transcribed into new viral RNA genomes and mRNAs for viral proteins. The latter encapsulate the RNA genomes into new viruses. Reverse transcriptase is now a laboratory tool, used to reverse transcribe cDNA from virtually any RNA sequence. It, along with many viral, bacterial and even eukaryotic enzymes and biomolecules, are now part of our recombinant DNA and genetic engineering toolkit.
We will see how a cDNA library is made and screened for a cDNA clone, and how a cloned cDNA can fish an entire gene out of a genomic library. Next we will see how the polymerase chain reaction (PCR) can produce (amplify) millions of copies of a single gene (or other DNA sequence) from as little DNA as is found in a single cell. Apart from its well-publicized use in forensics, PCR is another important laboratory tool for fetching, amplifying and studying sequences of interest. These venerable technologies illustrate important principles of cloning and sequence analysis. Of course, the analysis of traditionally cloned and amplified DNA sequences has been used to study the evolution and expression of individual genes. And sometimes we are misled! For example, knowing that a genetic mutation is associated with an illness usually leads to a search for how the mutation might cause the illness. But, as researchers in any discipline keep warning us, correlation is not causation! In fact, we know that many phenotypes, including genetic disease, are not the result of a single mutant gene. Autism is just one example.
The newer fields of genomics and proteomics leverage a growing battery of powerful tools to study many genes and their regulatory networks at the same time. The molecular networking made possible by genomics and proteomics (and other colorful holistic terms we’ll discuss later) promise to get us past naïve and often incorrect notions of causation. We may be soon able to identify many correlations that might sum up to causation or propensity to genetic illness. | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/15%3A_DNA_Technologies/15.01%3A_Overview.txt |
The first step in making a cDNA library is to isolate cellular mRNA. This mRNA extract should represent all of the transcripts in the cells at the time of isolation, or the cell’s transcriptome. This term is used by analogy to genome. However, a genome is all of the genetic information of an organism. In contrast, a transcriptome (usually eukaryotic) reflects all of the genes expressed in a given cell type at a moment in time. Reversetranscribed cDNAs from an mRNA extract are also referred to as a transcriptome…, and likewise, a cDNA library. A cDNA library is a tube full of bacterial cells that have taken up (i.e., been transformed with) plasmids recombined with cDNAs. cDNA libraries made from mRNAs taken from different cell types or the same cells grown under different conditions are in effect, different transcriptomes. Each reflects mRNAs transcribed in cells at the moment of their extraction. When cells in a cDNA library are spread out on a nutrient agar petri dish, each cell grows into a colony of cells; each cell in the colony is a clone of a starting cell. cDNA libraries can be used isolate and sequence the DNA encoding a polypeptide that you are studying.
Recall that the mature mRNA in eukaryotic cells has been spliced. This means that cDNAs from eukaryotic cells do not include introns. Introns, as well as sequences of enhancers and other regulatory elements in and surrounding a gene must be studied in genomic libraries, to be discussed later. Here we look at how to make a cDNA library.
A. cDNA Construction
mRNA is only a few percent of a eukaryotic cell; most is rRNA. But that small amount of mRNA can be separated from other cellular RNAs by virtue of their 3’ poly(A) tails. Simply pass a total RNA extract over an oligo-d(T) column (illustrated below).
The strings of thymidine (T) can H-bond with the poly(A) tails of mRNAs, tethering them to the column. All RNAs without a 3’ poly(A) tail will flow through the column as waste. A second buffer is passed over the column to destabilize the A-T H-bonds to allow elution of an mRNA fraction. When free’ oligo d(T) is added to the eluted mRNA, it forms H-bonds with the poly(A) tails of the mRNAs, serving as a primer for the synthesis of cDNA copies of the poly(A) mRNAs originally in the cells. Finally, four deoxynucleotide DNA precursors and reverse transcriptase (originally isolated from chicken retrovirus-infected cells) are added to start reverse transcription. The synthesis of a cDNA strand complementary to an mRNA is shown below.
After heating to separate the cDNAs from the mRNAs, the cDNA is replicated to produce double-stranded, or (ds)cDNA, as illustrated below.
Synthesis of the second cDNA strand is also catalyzed by reverse transcriptase! The enzyme recognizes DNA as well as RNA templates, and has the same 5’-to-3’ DNA polymerizing activity as DNA polymerases. After 2nd cDNA strand synthesis, S1 nuclease (a single-stranded endonuclease originally isolated from an East Asian fungus!) is added to open the loop of the (ds) cDNA structure and trim the rest of the single-stranded DNA. What remains is the (ds) cDNA.
258 Isolate mRNA and Make cDNA
259 Reverse Transcriptase
B. Cloning cDNAs into Plasmid Vectors
To understand cDNA cloning and other aspects of making recombinant DNA, we need to talk a bit more about the recombinant DNA tool kit. In addition to reverse transcriptase and S1 nuclease, other necessary enzymes in the ‘kit’ include restriction endonucleases (restriction enzymes) and DNA ligase. The natural function of restriction enzymes in bacteria is to recognize specific restriction site sequences in phage DNA (most often palindromic DNA sequences), hydrolyze it and thus avoid infection.
Restriction enzymes that make a scissors cut through the two strands of the double helix leaves blunt ends. Restriction enzymes that make a staggered cut on each strand at their restriction site leave behind complementary (‘sticky’) ends (below).
If you mix two of double-stranded DNA fragments with the same sticky ends from different sources (e.g., different species), they will form H-bonds at their complementary ends, making it easy to recombine plasmid DNA with (ds)cDNA, that have the same complementary ‘sticky ends’. Using the language of recombinant DNA technologies, let’s look at how plasmid vectors and cDNAs can be made to recombine.
1. Preparing Recombinant Plasmid Vectors Containing cDNA Inserts
Vectors are carrier DNAs engineered to recombine with foreign DNAs of interest. When a recombinant vector with its foreign DNA insert gets into a host cell, it can replicate many copies of itself, enough in fact for easy isolation and study. cDNAs are typically inserted into plasmid vectors that are usually purchased “off-the-shelf”. They can be cut with a restriction enzyme at a suitable location, leaving those sticky ends. On the other hand, it would not do to digest (ds)cDNA with restriction endonucleases since the goal is not to clone cDNA fragments, but entire cDNA molecules. Therefore, it will be necessary to attach linkers to either end of the (ds)cDNAs. Plasmid DNAs and cDNA-linker constructs can then be digested with the same restriction enzyme to produce compatible ‘sticky ends’. Steps in the preparation of vector and (ds)cDNA for recombination are shown below.
To prepare for recombination, a plasmid vector is digested with a restriction enzyme to open the DNA circle. To have compatible sticky ends, double-stranded cDNAs to be inserted are mixed with linkers and DNA ligase to put a linker DNA at both ends of the (ds) cDNA. DNA ligase is another tool in the recombinant DNA toolkit. Linkers are short, synthetic double-stranded DNA oligomers containing restriction sites recognized and cut by the same restriction enzyme as the plasmid. Once the linkers are attached to the ends of the plasmid DNAs, they are digested with the appropriate restriction enzyme. This leaves both the (ds)cDNAs and the plasmid vectors with complementary sticky ends.
260 Restriction Enzymes and Recombinant DNA
2. Recombining Plasmids and cDNA Inserts and Transforming Host Cells
The next step is to mix the cut plasmids with the digested linker-cDNAs in just the right proportions so that the most of the cDNA (linker) ends will anneal (form Hbonds) with the most of the sticky plasmid ends. Adding DNA ligase to the plasmid/linker-cDNA mixture forms phosphodiester bonds between plasmid and cDNA insert, completing the recombinant circle of DNA, as shown below.
In early cloning experiments, an important consideration was to generate plasmids with only one copy of a given cDNA insert, rather than lots of re-ligated plasmids with no inserts or lots of plasmids with multiple inserts. Using betterengineered vector and linker combinations, this issue became less important.
261 Recombine a cDNA Insert with a Plasmid Vector
3. Transforming Host Cells with Recombinant Plasmids
The recombinant DNA molecules are now ready for ‘cloning’. They are added to E. coli (sometimes other host cells) made permeable so that they can be easily transformed. Recall that transformation as defined by Griffith is bacterial uptake of foreign DNA leading to a genetic change. The transforming principle in cloning is the recombinant plasmid! The transformation step is shown below.
The tube full of transformed cells is the cDNA Library.
262 Making the cDNA Library.
After all these treatments, not all plasmid molecules in the mix are recombinant; some cells in the mix haven’t even taken up a plasmid. So when the recombinant cells are plated on agar, how do you tell which of the colonies that grow came from cells that took up a recombinant plasmid? Both the host strain of E. coli and plasmid vectors used these days were further engineered to solve this problem. One such plasmid vector carries an antibiotic resistance gene. In this case, ampicillin-sensitive cells would be transformed with recombinant plasmids containing the resistance gene. When these cells are plated on media containing ampicillin (a form of penicillin), they grow, as illustrated below.
Untransformed cells (cells that failed to take up a plasmid) lack the ampicillin resistance gene and thus, do not grow on ampicillin-medium. But, there is still a question. How can you tell whether the cells that grew were transformed by a recombinant plasmid containing a cDNA insert? It is possible that some of the transformants contain only non-recombinant plasmids that still have the ampicillin resistance gene!
To address this question, plasmids were further engineered with a streptomycin resistance gene. But this antibiotic resistance gene was also engineered to contain restriction enzyme sites in the middle of the gene. Thus, inserting a cDNA in this plasmid would disrupt and inactivate the gene. Here is how this second bit of genetic engineering enabled growth only of cells transformed with a recombinant plasmid containing a cDNA insert. We can tell transformants containing recombinant plasmids apart from those containing non-recombinant plasmids by the technique of replica plating shown (illustrated below).
After colonies grow on the ampicillin agar plate, lay a filter over the plate. The filter will pick up a few cells from each colony, in effect becoming a replica (mirror image) of the colonies on the plate. Place the replica filter on a new agar plate containing streptomycin; the new colonies that grow on the filter must be streptomycin-resistant, containing only non-recombinant plasmids. Colonies containing recombinant plasmids, those that did not grow in streptomycin are easily identified on the original ampicillin agar plate. In practice, highly efficient recombination and transformation procedures typically reveal very streptomycinresistant cells (i.e., colonies) after replica plating. In this case, ampicillin-resistant cells constitute a good cDNA library, ready for screening.
263 Making a Replica Plate Filter
4. Identifying Colonies Containing Plasmids with Inserts of Interest
The next step is to screen the colonies from the cDNA library for those containing the specific cDNA that you’re after. This typically begins preparing multiple replica filters like the one above. Remember, these filters are replicas of bacterial cells containing recombinant plasmids that grow on ampicillin but not streptomycin. The number of replica filters that must be screened can be calculated from assumptions and formulas for estimating how many colonies must be screened to represent an entire transcriptome (i.e., the number of different mRNAs in the original cellular mRNA source). Once the requisite number of replica filters are made, they are subjected to in situ lysis to disrupt cell walls and membranes. The result is that the cell contents are released and the DNA is denatured (i.e., becomes single-stranded). The DNA then adheres to the filter in place (in situ, where the colonies were). The result of in situ lysis is a filter with faint traces of the original colony (below).
Next, a molecular probe is used to identify DNA containing the sequence of interest. The probe is often a synthetic oligonucleotide whose sequence was inferred from known amino acid sequences. These oligonucleotides are made radioactive and placed in a bag with the filter(s). DNA from cells that contained recombinant plasmids with a cDNA of interest will bind the complementary probe. The results of in situ lysis and hybridization of a radioactive probe to a replica filter are shown below.
264 Probing a Replica Plate Filter
The filters are rinsed to remove un-bound radioactive oligomer probe, and then placed on X-ray film. After a period of exposure, the film is developed. Black spots will form on the film from radioactive exposure, creating an autoradiograph of the filter. The black spots in the autoradiograph correspond to colonies on a filter that contain a recombinant plasmid with your target cDNA sequence (below).
Once a positive clone is identified on the film, the corresponding recombinant colony is located on the original plate. This colony is grown up in a liquid culture and the plasmid DNA is isolated. At that point, the cloned plasmid DNA can be sequenced and the amino acid sequence encoded by its cDNA can be inferred from the genetic code dictionary to verify that the cDNA insert in fact encodes the protein of interest. Once verified as the sequence of interest, a cloned plasmid cDNA can be made radioactive or fluorescent, and used to
• probe for the genes from which they originated.
• identify and quantitate the mRNA even locate the transcripts in the cells.
• quantitatively measure amounts of specific mRNAs.
Isolated plasmid cDNAs can even be expressed in suitable cells to make the encoded protein. These days, diabetics no longer receive pig insulin, but get synthetic human insulin human made from expressed human cDNAs. Moreover, while the introduction of the polymerase chain reaction (PCR, see below) has superseded some uses of cDNAs, they still play a role in genome-level and transcriptome-level studies.
265 Pick a Clone From a Replica Filter and Play With It! | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/15%3A_DNA_Technologies/15.02%3A_Make_and_Screen_a_cDNA_Library.txt |
A. A Brief History of DNA Sequencing
RNA sequencing came first, when Robert Holley sequenced a tRNA in 1965. The direct sequencing of tRNAs was possible because tRNAs are small, short nucleic acids, and because many of the bases in tRNAs are chemically modified after transcription. An early method for DNA sequencing developed by Walter Gilbert and colleagues involved DNA fragmentation, sequencing of the small fragments of DNA, and then aligning the overlapping sequences of the short fragments to assemble longer sequences. Another method, the DNA synthesis-based ‘dideoxy’ DNA sequencing technique, was developed by Frederick Sanger in England. Sanger and Gilbert both won a Nobel Prize in Chemistry in 1983 for their DNA sequencing efforts. However, because of its simplicity, Sanger’s method quickly became the standard for sequencing all manner of cloned DNAs.
The first complete genome to be sequenced was that of a bacteriophage (bacterial virus) called φX174. At the same time as the advances in sequencing technology were occurring, so were some of the early developments in recombinant DNA technology. Together these led to more efficient and rapid cloning and sequencing of DNA from increasingly diverse sources. The first focus was of course on genes and genomes of important model organisms, such as E. coli, C. elegans, yeast (S. cerevisiae)…, and of course us! By 1995, Craig Venter and colleagues at the Institute for Genomic Research had completed the sequence of an entire bacterial genome (Haemophilus influenzae) and by 2001, Venter’s private group along with Frances Collins and colleagues at the NIH had published a first draft of the sequence of the human genome. Venter had proven the efficacy of a whole-genome sequencing approach called shotgun sequencing, which was much faster than the gene-by-gene, fragment-by-fragment ‘linear’ sequencing strategy being used by other investigators (more later!). Since Sanger’s dideoxynucleotide DNA sequencing method remains a common and economical methodology, let’s consider the basics of the protocol.
B. Details of DiDeoxy Sequencing
Given a template DNA (e.g., a plasmid cDNA), Sanger used in vitro replication protocols to demonstrate that he could:
1. Replicate DNA under conditions that randomly stopped nucleotide addition at every possible position in growing strands.
2. Separate and then detect these DNA fragments of replicated DNA.
Recall that DNA polymerases catalyze the formation of phosphodiester bonds by linking the $\alpha$ phosphate of a nucleotide triphosphate to the free 3’ OH of a deoxynucleotide at the end of a growing DNA strand. Recall also that the ribose sugar in the deoxynucleotide precursors of replication lack a 2’ OH (hydroxyl) group. Sanger’s trick was to add dideoxynucleotide triphosphates to his in vitro replication mix. The ribose on a dideoxynucleotide triphosphate (ddNTP) lacks a 3’ OH, in addition to the 2’ OH group (as shown below).
Adding a dideoxynucleotide to a growing DNA strand stops replication. No further nucleotides can add to the 3’-end of the replicating DNA strand because the 3’–OH necessary for the dehydration synthesis of the next phosphodiester bond is absent! Because they can stop replication in actively growing cells, ddNTPs such as dideoxyadenosine (tradename, cordycepin) are anti-cancer chemotherapeutic drugs.
266 Treating Cancer with Dideoxynucleosides
A look at a manual DNA sequencing protocol reveals what is going on in the sequencing reactions. Four reaction tubes are set up, each containing the template DNA to be sequenced, a primer of known sequence and the four required deoxynucleotide precursors necessary for replication.
The set-up for manual DNA sequencing is shown below.
A different ddNTP, (ddATP, ddCTP, ddGTP or ddTTP) is added to each of the four tubes. Finally, DNA polymerase is added to each tube to start the DNA synthesis reaction. During DNA synthesis, different length fragments of new DNA accumulate as the ddNTPs incorporate randomly, opposite complementary bases in the template DNA being sequenced. The expectations of the didieoxy sequencing reactions in the four tubes are illustrated below.
A short time after adding the DNA polymerase to begin the reactions, the mixture is heated to separate the DNA strands and fresh DNA polymerase is added to repeat the synthesis reactions. These sequencing reactions are repeated as many as 30 times in order to produce enough radioactive DNA fragments to be detected. When the heat-stable Taq DNA polymerase from the thermophilic bacterium Thermus aquaticus became available ( more later!), it was no longer necessary to add fresh DNA polymerase after each replication cycle. The many heating and cooling cycles required for what became known as chain-termination DNA sequencing were soon automated using inexpensive programmable thermocyclers.
Since a small amount of a radioactive deoxynucleotide (usually 32P-labeled ATP) was present in each reaction tube, the newly made DNA fragments are radioactive. After electrophoresis to separate the new DNA fragments in each tube, autoradiography of the electrophoretic gel reveals the position of each terminated fragment. The DNA sequence can then be read from the gel as illustrated in the simulated autoradiograph below.
As shown in the cartoon, the DNA sequence can be read by reading the bases from the bottom of the gel, starting with the C at the bottom of the C lane. Try reading the sequence yourself!
267 Manual Dideoxy Sequencing
The first semi-automated DNA sequencing method was invented in Leroy Hood’s California lab in 1986. Though still Sanger sequencing, the four dideoxynucleotides in the sequencing reaction were tagged for detection with a fluorescent dyes instead radioactive phosphate-tagged nucleotides. After the sequencing reactions, the reaction products are electrophoresed on an ‘automated DNA sequencer’. UV light excites the migrating dye-terminated DNA fragments as they pass through a detector. The color of their fluorescence is detected, processed and sent to a computer, generating color-coded graph like the one below, showing the order (and therefore length) of fragments passing the detector and thus, the sequence of the strand.
A most useful feature of this sequencing method is that a template DNA could be sequenced in a single tube, containing all the required components, including all four dideoxynucleotides! That’s because the fluorescence detector in the sequencing machine separately sees all the short ddNTP-terminated fragments as they move through the electrophoretic gel.
Hood’s innovations were quickly commercialized making major sequencing projects possible, including whole genome sequencing. The rapidity of automated DNA sequencing led to the creation of large sequence databases in the U.S. and Europe.
The NCBI (National Center for Biological Information) maintains the U.S. database. Despite its location, the NCBI archives virtually all DNA sequences determined worldwide. New ‘tiny’ DNA sequencers have made sequencing DNA so portable that in 2016, one was even used in the International Space Station. Expanding databases and new tools and protocols (some are described below) to find, compare and analyze DNA sequences have also grown rapidly.
268 Automated Sequencing Leads to Large Genome Projects
C. Large Scale Sequencing
Large-scale sequencing targets entire prokaryotic, and typically much larger eukaryotic genomes. The latter require strategies that either sequence long DNA fragments and/or sequencing DNA fragments more quickly. We already noted the shotgun sequencing used by Venter to sequence smaller and larger genomes (including our own… or more accurately, his own!). In shotgun sequencing, cloned DNA fragments 1000 base pairs or longer are broken down at random into smaller, more easily sequenced fragments. The fragments are themselves cloned and sequenced and non-redundant sequences are assembled by aligning overlapping regions of sequence. Today’s computer software is quite adept at rapid overlapping sequence alignment as well as connecting and displaying long contiguous DNA sequences. Shotgun sequencing is summarized below.
Sequence gaps that remain after shotgun sequencing can be filled in by primer walking, in which a known sequence near the gap is the basis of creating a sequencing primer to “walk” into the gap region on an intact DNA that has not been fragmented. Another ‘gap-filling’ technique involves PCR (the Polymerase Chain Reaction, to be described shortly). Briefly, two oligonucleotides are synthesized based on sequence information on either side of a gap. Then PCR is used to synthesize the missing fragment, and the fragment is sequenced to fill in the gap. | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/15%3A_DNA_Technologies/15.03%3A_DNA_Sequencing.txt |
A genomic library might be a tube full of recombinant bacteriophage. Each phage DNA molecule contains a fragmentary insert of cellular DNA from a foreign organism. The library is made to contain a representation of all of possible fragments of that genome. Bacteriophage are often used to clone genomic DNA fragments because:
• phage genomes are bigger than plasmids and can be engineered to remove a large amount of DNA that is not needed for infection and replication in bacterial host cells.
• the missing DNA can thus be replaced by foreign insert DNA fragments as long as 18- 20kbp (kilobase pairs), nearly 20X as long as typical cDNA inserts in plasmids.
• purified phage coat proteins can be mixed with the recombined phage DNA to make infectious phage particles that would infect host bacteria, replicate lots of new recombinant phage, and then lyse the cells to release the phage.
The need for vectors like bacteriophage that can accommodate long inserts becomes obvious from the following bit of math. A typical mammalian genome consists of more than 2 billion base pairs. Inserts in plasmids are very short, rarely exceeding 1000 base pairs. Dividing 2,000,000,000 by 1000, you get 2 million, a minimum number of phage clones that must be screened to find a sequence of interest. In fact, you would need many more than this number of clones to find a gene (or parts of one!). Of course, part of the solution to this “needle in a haystack” dilemma is to clone larger DNA inserts in more accommodating vectors.
From this brief description, you may recognize the common strategy for genetically engineering a cloning vector: determine the minimum properties that your vector must have and remove non-essential DNA sequences. Consider the Yeast Artificial Chromosome (YAC), hosted by (replicated in) yeast cells. YACs can accept humongous foreign DNA inserts! This is because to be a chromosome that will replicate in a yeast cell requires one centromere and two telomeres… and little else!
Recall that telomeres are needed in replication to keep the chromosome from shortening during replication of the DNA. The centromere is needed to attach chromatids to spindle fibers so that they can separate during anaphase in mitosis (and meiosis). So along with a centromere and two telomeres, just include restriction sites to enable recombination with inserts as long as 2000 Kbp. That’s a YAC! The tough part of course is keeping a 2000Kbp long DNA fragment intact long enough to get it into the YAC.
However a vector is engineered and chosen, sequencing its insert can tell us many things. They can show us how a gene is regulated by revealing known and uncovering new regulatory DNA sequences. They can tell us what other genes are nearby, and where genes are on chromosomes. Genomic DNA sequences from one species can probe for similar sequences in other species and comparative sequence analysis can then tell us a great deal about gene evolution and the evolution of species.
One early surprise from gene sequencing studies was that we share many common genes and DNA sequences with other species, from yeast to worms to flies… and of course vertebrates and our more closely related mammal friends. You may already know that the chimpanzee’s and our genomes are 99% similar. Moreover, we have already seen comparative sequence analysis showing how proteins with different functions nevertheless share structural domains.
Let’s look at cloning a genomic library in phage. As you will see, the principles are similar to cloning a foreign DNA into a plasmid, or in fact any other vector, but the numbers and details used here exemplify cloning in phage.
A. Preparing Genomic DNA of a Specific Length for Cloning
To begin with, high molecular weight (i.e., long molecules of) the desired genomic DNA are isolated, purified and then digested with a restriction enzyme. Usually, the digest is partial, aiming to generate overlapping DNA fragments of random length. When the digest is electrophoresed on agarose gels, the DNA (stained with ethidium bromide, a fluorescent dye that binds to DNA) looks like a bright smear on the gel. All of the DNA could be recombined with suitably digested vector DNA. But, to further reduce the number of clones to be screened for a sequence of interest, early cloners would generate a Southern blot (named after Edward Southern, the inventor of the technique) to determine the size of genomic DNA fragments most likely to contain a desired gene.
Beginning with a gel of genomic DNA restriction digests, the Southern blot protocol is illustrated below
To summarize the steps:
a) Digest genomic DNA with one or more restriction endonucleases.
b) Run the digest products on an agarose gel to separate fragments by size (length). The DNA appears as a smear when stained with a fluorescent dye.
c) Place a filter on the gel. The DNA transfers (blots) to the filter for e.g., 24 hours
d) Remove the blotted filter and place it in a bag containing a solution that can denature the DNA.
e) Add radioactive probe (e.g., cDNA) containing the gene or sequence of interest. The probe hybridizes (bind) to complementary genomic sequences on the filter
f) Prepare an autoradiograph of the filter and see a ‘band’ representing the size of genomic fragments of DNA that include the sequence of interest.
Once you know the size (or size range) of restriction digest fragments that contain the DNA you want to study, you are ready to:
a) run another gel of digested genomic DNA.
b) cut out the piece of gel containing the fragments that ‘lit up’ with your probe in the autoradiograph.
c) remove (elute) the DNA from the gel piece into a suitable buffer
d) prepare the DNA for insertion into (recombination with) a genomic cloning vector
B. Recombining Size-Restricted Genomic DNA with Phage DNA
After elution of restriction digested DNA fragments of the right size range from the gels, the DNA is mixed with compatibly digested phage DNA at concentrations that favor the formation of H-bonds between the ends of the phage DNA and the genomic fragments. Addition of DNA ligase covalently links the recombined DNA molecules. These steps are abbreviated in the illustration below.
The recombinant phage that are made next will contain sequences that become the genomic library.
C. Creating Infectious Viral Particles with Recombinant Phage DNA
The next step is to package the recombined phage DNA with added purified viral coat proteins to make infectious phage particles (below)
269 Genomic Libraries: Make and Package Recombinant Phage DNA
Packaged phage are added to a culture tube full of host bacteria (typically E. coli). After infection, the recombinant DNA enters the cells where it replicates and directs the production of new phage that eventually lyse the host cell (illustrated below).
The recombined vector can also be introduced directly into the host cells by transduction (which is to phage DNA what transformation is to plasmid DNA). Whether by infection or transduction, the recombinant phage DNA ends up in host cells which produce new phage that eventually lyse the host cell. The released phages go on to infect more host cells until all cells have lysed. What remains is a tube full of lysate containing cell debris and lots of recombinant phage particles.
270 Infect Host with Recombinant Phage to Make a Genomic Library
D. A Note About Some Other Vectors
We’ve seen that phage vectors accommodate larger foreign DNA inserts than plasmid vectors, and YACs even more…, and that for larger genomes, the goal is to choose a vector able to house larger fragments of ‘foreign’ DNA so that you end up screening fewer clones. Given a large enough eukaryotic genome, it may be necessary to screen more than a hundred thousand clones in a phage-based genomic library. Apart from size-selection of genomic fragments before inserting them into a vector, selecting the appropriate vector is just as important. The table below lists commonly used vectors and the sizes of inserts they will accept.
Vector Type Insert Size (thousands of bases)
Plasmids up to 15
Phage Lambda ($\lambda$) up to 25
Cosmids up to 45
Bacteriophage P1 70 to 100
P1 artificial chromosomes (PACs) 130 to 150
Bacterial artificial chromosomes (BACs) 120 to 300
Yeast artificial chromosomes (YACs) 250 to 2000
Click on the links to these vectors to learn more about them. We will continue this example by screening a phage lysate genomic library for a recombinant phage with a genomic sequence of interest.
E. Screening a Genomic Library; Titering Recombinant Phage Clones
A phage lysate is titered on a bacterial lawn to determine how many virus particles are present. A bacterial lawn is made by plating so many bacteria on the agar plate that they simply grow together rather than as separate colonies. In a typical titration, a lysate might be diluted 10-fold with a suitable medium and this dilution is further diluted 10-fold… and so on. Such serial 10X dilutions are then spread over bacterial (e.g., E. coli) lawns. What happens on such a culture plate?
Let’s say that when 10 μl of one of the dilutions are spread on the bacterial lawn, they infect 500 E. coli cells on the bacterial lawn. After a day or so, there will be small clearings in the lawn called plaques…, 500 of them in this example. These are 500 tiny clear spaces on the bacterial lawn created by the lysis of first one infected cell, and then progressively more and more cells neighboring the original infected cell. Each plaque is thus a clone of a single virus, and each virus particle in a plaque contains a copy of the same recombinant phage DNA molecule (below).
If you actually counted 500 plaques on the agar plate, then there must have been 500 virus particles in the 10 μl seeded onto the lawn. And, if this plate was the fourth dilution in a 10-fold serial dilution protocol, there must have been 2000 (4 X 500) phage particles in 10 μl of the original undiluted lysate.
F. Screening a Genomic Library; Probing the Genomic Library
In order to represent a complete genomic library, it is likely that many plates of such a dilution (~500 plaques per plate) will have to be created and then screened for a plaque containing a gene of interest. But, if only size-selected fragments were inserted into the phage vectors in the first place, the plaques represent only a partial genomic library, requiring screening fewer clones to find the sequence of interest. For either kind of library, the next step is to make replica filters of the plaques. Replica plating of plaques is similar to making a replica filter bacterial colonies. While much of the phage DNA in a plaque is encased in viral proteins, there will also be DNA on the plaque replicas that were never packaged into viral particles. The filters can be treated to denature the latter DNA and then directly hybridized to a probe with a known sequence. In the early days of cloning, probes for screening a genomic library were usually an already isolated and sequenced cDNA clone, either from the same species as the genomic library, or from a cDNA library of a related species. After soaking the filters in a radioactively labeled probe, X-Ray film is placed over the filter, exposed and developed. Black spots will form where the film lay over a plaque containing genomic DNA complementary to the radioactive probe. In the example illustrated below, a globin cDNA might have been used to probe the genomic library (globin genes were among the first to be cloned!).
G. Isolating a Gene for Further Study
Cloned genomic DNA fragments are much longer than any gene of interest, and always longer than any cDNA from a cDNA library. They are also embedded in a genome that is thousands of times as long as the gene itself, making the selection of an appropriate vector necessary. If the genome can be screened among a reasonable number of cloned phage (~100,000 plaques for instance), the one plaque producing a positive signal on the autoradiograph would be further studied.
This plaque should contain the gene of interest. The next step is to find the gene within a genomic clone that can be as much a 20kbp long. The traditional strategy is to purify the cloned DNA, subject it to restriction endonuclease digestion, and separate of the digest particles by agarose gel electrophoresis. Using Southern Blotting, the separated DNA fragments are denatured and blotted to a nylon filter. The filter is then probed with the same tagged probe used to find the positive clone (plaque). The smallest DNA fragment containing the gene of interest can itself be subcloned in a suitable vector, and grown to provide enough DNA for further study of the gene.
271 Screen a Genomic Library, Pick and Grow a Phage Clone | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/15%3A_DNA_Technologies/15.04%3A_Genomic_Libraries.txt |
The polymerase chain reaction (PCR) can amplify a region of DNA from any source, even from a single cell’s worth of DNA or from fragments of DNA obtained from a fossil. This amplification usually takes just a few hours, generating millions of copies of the desired target DNA sequence. The effect is to purify the DNA from surrounding sequences in a single reaction! Kary B. Mullis was awarded a Nobel Prize in 1993 for his development of PCR, which is now the basis of innumerable research studies of gene structure, function and evolution as well as applications in criminal forensics, medical diagnostics and other commercial uses. PCR is described in detail below.
A. PCR - the Basic Process
Typical PCR relies on knowing two bits of DNA sequence that will be used to design and synthesize short oligonucleotide sequences (oligomers) in the laboratory. The two oligomers are chosen to be complementary to sequences opposite strands of double-stranded DNA containing the gene to be studied. We say that the two oligomers face, or oppose each other. That just means that the 3’ end of one oligomer faces the 3’ end of the opposing oligomer. This way the two oligomers can serve as primers for the elongation replication of both strands of a double stranded target DNA sequence. Check out the link below for further explanation.
272 PCR: Design and Synthesize Opposing Oligonucleotide Primers
The first step in PCR is to add oligomer primers to the target DNA from which a gene (or other genomic sequence) is to be amplified. The mixture is then heated to denature the target DNA. The mixture is cooled to allow the primers to H-bond to complementary target DNA strands. Next, the four deoxynucleotide precursors to DNA (dATP, dCTP, dTTP and dGTP) are added along with a small amount of a DNA polymerase. New DNA strands will now lengthen from the oligonucleotide primers on the template DNAs. To make lots of the PCR product, this reaction cycle must be repeated many times. Therefore, after allowing elongation, the mixture is heated to denature (separate) all the DNA strands. When the mixture is again cooled, the oligomers again find complementary sequences with which to H-bond. Early versions of PCR originally relied on an E. coli DNA polymerase, which is inactivated by heating, and so had to be re-added to the PCR mixture for each elongation cycle. Just as with DNA sequencing, researchers very quickly switched to the heat-stable Taq polymerase, of Thermus aquaticus. The enzymes of T. aquaticus remain active at the very high temperatures at which these organisms live. Since heating does not destroy the Taq polymerase in vitro, PCR, like DNA sequencing reactions, could be automated with programmable thermocylers that raised and lowered temperature required by the PCR reactions. There was no longer a need to replenish a DNA polymerase once the reaction cycles were begun. Thermocyling in a typical PCR amplification is illustrated below for the first two PCR cycles, the second of which, produces the first strands of DNA that will actually be amplified exponentially.
You can see from the illustration that the second cycle of PCR has generated the two DNA strands that will be templates for doubling and re-doubling the desired product after each subsequent cycle. A typical PCR reaction might involve 30 PCR cycles, resulting in a nearly exponential amplification of the desired sequence.
273 PCR: The Amplification Process
Challenge:
Starting with a pair of complementary target DNA molecules (after the 3rd PCR cycle), how many double stranded PCR products should you theoretically have at the end of all 30 PCR cycles?
The amplified products of PCR amplification products are in such abundance that they can easily be seen under fluorescent illumination on an ethidium bromide-stained agarose gel (below).
In this gel, the first lane (on the left) contains a DNA ladder, a mixture of DNAs of known lengths that can be used to estimate the size of the PCR fragments in the 3 rd and 4th lanes (the gel lane next to the ladder is empty). The two bright bands in lanes 3 and 4 are PCR products generated with two different oligomer primer pairs. PCRamplified DNAs can be sequenced and used in many subsequent studies.
B. The Many Uses of PCR
PCR-amplified products can be labeled with radioactive or fluorescent tags to serve as hybridization probes for
• screening cDNA or genomic libraries and isolation of clones.
• determining migration position on a Southern blot.
• determining migration position on a northern blot (a fanciful name for RNAs that are separated by size on gels and blotted to filter).
• and more!
1. Quantitative PCR
We noted above that PCR has wide applications to research, medicine and other practical applications. A major advance was Quantitative PCR, applied to studies of differential gene expression and gene regulation. In Quantitative PCR, initial cDNAs are amplified to detect not only the presence, but also the relative amounts of specific transcripts being made in cells.
2. Forensics
Another application of PCR is in forensic science, to identify a person or organism by comparing its DNA to some standard, or control DNA. An example of one of these acrylamide gel DNA fingerprints is shown below.
Using this technology, it is now possible to detect genetic relationships between near and distant relatives (as well as to exclude such relationships), determine paternity, demonstrate evolutionary relationships between organisms, and on many occasions, solve recent and even ‘cold-case’ crimes. Click Sir Alec Jeffries to learn about the origins of DNA fingerprinting in real life …and on all those TV CSI programs! Check out here for a brief history of the birth of DNA fingerprinting, and to see how analysis of changes in gene activity that occur after death may even help ID criminals. For a video on DNA fingerprinting, click Alu and DNA fingerprinting. Alu is a highly repeated ~300bp DNA sequence found throughout the human genome. Alu sequences are short interspersed elements, or SINES, a retrotransposon we saw earlier. DNA fingerprinting is possible in part because each of us has a unique number and distribution of Alu SINEs in our genome. To read more about Alu sequences and human diversity, click Alu Sequences and Human Diversity.
Intriguing examples of the use of PCR for identification include establishing the identities of Egyptian mummies, the Russian Tsar deposed and killed during the Russian revolution (along with his family members), and the recently unearthed body of King Richard the 3rd of England. Variant PCR protocols and applications are manifold and often quite inventive! For a list, click Variations on Basic PCR.
274 The Power of PCR: Some Examples
3. Who are your Ancestors?
Tracing your ethnic, racial and regional ancestry is related to DNA fingerprinting, in that it relies on PCR amplification of genes and other DNA regions and comparison of these your sequences to distinguishing DNA markers in large sequence databases. The price of these services have come down, and as a result, their popularity has gone up in recent years. Typically, you provide spit or a salivary (buccal) swab to the service and they amplify and sequence the DNA in your samples. The analysis compares your DNA sequences to database sequences looking for patterns of ethnic and regional markers that you might share with the database(s). Based on these comparisons, you are provided with a (more…, or less) accurate map of your DNA-based ancestry. Folks who are spending around \$100.00 (less when on sale!) often ask just how accurate are these analyses, and what do they actually mean. For example, what does it mean if your DNA says you are 5% native American? In fact, different services can sometimes give you different results! You can get some answers and explanations DNA Ancestry Testing. | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/15%3A_DNA_Technologies/15.05%3A_The_Polymerase_Chain_Reaction_%28PCR%29.txt |
Traditionally, when cellular levels of a protein were known to change in response to a chemical effector, molecular studies focused on control of the transcription of its gene. These studies often revealed that the control of gene expression was at the level of transcription, turning a gene on or off through interactions of transcription factors with DNA. However, protein levels are also controlled post-transcriptionally, by regulating the rate of mRNA translation or degradation. Studies of transcriptional and posttranscriptional regulation mechanisms are seminal to our understanding of how the correct protein is made in the right amounts at the right time.
We may have suspected, but now know that control of gene expression and cellular responses can be more complex than increasing or decreasing the transcription of a single gene or translation of a single protein. Whole genome sequences and new techniques make possible the study of the expression of virtually all genes in a cell at the same time, a field of investigation called genomics. Genomic studies reveal networks of regulated genes that must be understood to more fully explain the developmental and physiological changes in an organism. When you can ‘see’ all of the RNAs being transcribed from active genes in a cell, you are looking at a cell’s transcriptome. By analogy to genomics, transcriptomics defines studies of ‘webs’ of interactive RNAs. Again, by analogy to genomics and transcriptomics, the broad study of active and inactive proteins in cells or tissues, how they are modified (processed) before use and how they interact is called proteomics. The technologies applied to proteomic studies include protein microarrays, immunochemical techniques and others uniquely suited to protein analysis (click Proteomics Techniques-Wikipedia for more information). Protein Microarrays are increasingly being used to identify protein-protein interactions, as well as the different states of proteins under different cellular conditions. Read even more about these exciting developments and their impact on basic and clinical research at Protein Microarrays from ncbi.
Finally think about this: creating a proteomic library analogous to a genomic library would seem a daunting prospect. But efforts are underway. Check out A stab at mapping the Human Proteome for original research leading to the sampling of a tissue-specific human proteome, and click Strategies for Approaching the Proteome for more general information. Let’s look at some uses of DNA microarrays. This technology involves ‘spotting’ DNA (e.g., cloned DNA from a genomic or cDNA library, PCR products, oligonucleotides…) on a glass slide, or chip. In the language of microarray analysis, the slides are the probes. Spotting a chip is a robotic process. Because the DNA spots are microscopic, a cellspecific transcriptome (cDNA library) can fit on a single chip. A small genome microarray might also fit on a single chip, while larger genomes might need several slides. A primary use of DNA microarrays is transcriptional profiling. A genomic microarray can probe a mixture of fluorescently tagged target cDNAs made from mRNAs, in order to identify many (if not all) of the genes expressed in the cells at a given moment (i.e., its transcriptome). cDNA microarray probes can also probe quantitative differences in gene expression in cells or tissues during normal differentiation or in response to chemical signals. They are also valuable for genotyping, (i.e. characterizing the genes in an organism). Microarrays are so sensitive that they can even distinguish between two genes or regions of DNA that differ by a single nucleotide. Click Single Nucleotide Polymorphisms, or SNPs to learn more. In the microarray below, each colored spot (red, yellow, green) is a different fluorescently tagged molecule hybridizing to target sequences on the microarray. In the fluorescence microscope, the spots fluoresce different colors in response to UV light.
With quantitative microarray methods, the brightness (intensity) of the signal from each probe can be measured. In this way, we can compare the relative amounts of cDNA (and thus, different RNAs) in the transcriptome of different tissues or resulting from different tissue treatments. A table of different applications of microarrays (adapted from Wikipedia) is shown on the next page.
Application of Technology Synopsis
Gene Expression Profiling In a transcription (mRNA or gene expression) profiling experiment the expression levels of thousands of genes are simultaneously monitored to study the effects of certain treatments, diseases, and developmental stages on gene expression.
Comparative genomic hybridization Assessing genome content in different cells or closely related organisms, where one organism’s genome is the probe for a target genome from a different species.
GeneID Small microarrays to check IDs of organisms in food and feed for genetically modified organisms (GMOs), mycoplasmas in cell culture, or pathogens for disease detection. These detection protocols often combine PCR and microarray technology.
CHIP; Chromatin immunoprecipitation DNA sequences bound to a particular protein can be isolated by immunoprecipitating the protein. The fragments can be hybridized to a microarray (such as a tiling array) allowing the determination of protein binding site occupancy throughout the genome.
DamID Analogously to ChIP, genomic regions bound by a protein of interest can be isolated and used to probe a microarray to determine binding site occupancy. Unlike ChIP, DamID does not require antibodies but makes use of adenine methylation near the protein's binding sites to selectively amplify those regions, introduced by expressing minute amounts of protein of interest fused to bacterial DNA adenine methyltransferase.
SNP detection Identifying single nucleotide polymorphism among alleles within or between populations. Some microarray applications make use of SNP detection, including Genotyping, forensic analysis, measuring predisposition to disease, identifying drug-candidates, evaluating germline mutations in individuals or somatic mutations in cancers, assessing loss of heterozygosity, or genetic linkage analysis.
Alternative splicing protection An exon junction array design uses probes specific to the expected or potential splice sites of predicted exons for a gene. It is of intermediate density, or coverage, to a typical gene expression array (with 1-3 probes per gene) and a genomic tiling array (with hundreds or thousands of probes per gene). It is used to assay the expression of alternative splice forms of a gene. Exon arrays have a different design, employing probes designed to detect each individual exon for known or predicted genes, and can be used for detecting different splicing isoforms
Tiling array Genome tiling arrays consist of overlapping probes designed to densely represent a genomic region of interest, sometimes as large as an entire human chromosome. The purpose is to empirically detect expression of transcripts or alternatively spliced forms which may not have been previously known or predicted.
The Power of Microarrays. https://youtu.be/88rzbpclscM
If you like world records, check out the salamander with the largest genome, 10X bigger than our own: The HUGE Axolotl Genome. What do they do with all that DNA? And can our current technologies figure it out? For the original report, click on the following link: here. | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/15%3A_DNA_Technologies/15.06%3A_Genomic_Approaches-_The_DNA_Microarray.txt |
• Genome - total cell’s DNA content, identical in every cell of an organism
• A cell’s total coding DNA (excluding non-coding DNA)
• <="" strong="">A cell’s metabolic landscape (i.e., metabolic status)
• A cell’s total DNA-modification/chromatin topography
• <="" strong="">The pattern of methylation of DNA in the genome
• A cell's profile of protein content
• <="" strong="">A cell's RNA transcript profile and steady state at any given moment
15.08: From Genetic Engineering and Genetic Modification
By enabling us to focus on how genes and their regulation have evolved, these genomic, transcriptomic and proteomic technologies have vastly increased our knowledge of how cells work at a molecular level. We continue to add to our knowledge of disease process and in at least a few cases, how we can treat disease. The use of technologies to genetically modify organisms is more controversial, despite the best of human intentions. Some genetically modified organisms (GMOs) aim to increase food productivity to better feed the world. The introduction ‘beneficial’ genes into some GMOs have made:
• drought-resistant crops to increase the range where major food crops can be grown.
• pest-resistant crops to reduce reliance on environmentally toxic chemical pesticides.
• herbicide-resistant crops that survive chemicals used to destroy harmful plants.
The quest for “improved” plant and animal varieties has been going on since before recorded history. Farmers have been cross-breeding cows, sheep, dogs, and crop varieties from corn to wheat, hoping to find faster growing, larger, hardier, (you name it) varieties. It is the manipulation of DNA (the essence of the genetic material itself) that is at the root of controversy. Controversy is reflected in opinions that GMO foods are potentially dangerous, and that their cultivation should be banned. However, the general consensus is that attempting to ban GMOs is too late! In fact, you are probably already partaking of some GMO foods without even knowing it. Perhaps the good news is that after many years of GMO crops already in our food stream, the emerging scientific consensus is that GMO foods are no more harmful than unmodified foods. The current debate is whether or not to label foods that are (or contain) GMO ingredients as genetically modified.
In an odd but perhaps amusing take on the discomfort some folks feel about GMOs, a startup company has genetically modified Petunias. When grown in water, their flowers are white, but when ‘watered’ with beer, they will produce pink flowers or purple flowers depending on how much beer they get (Check it out at Can Beautiful Flowers Change Face?). According to the company, they seek “to bring what it sees as the beauty of bioengineering to the general public” (and perhaps some profit as well?).
More recently, we have CRISPR and related tools that can precisely edit gene (in fact any DNA) sequences. And unlike the “quack medicines” of old, these tools have the real potential to cure disease, destroy disease-carrying vectors, cure cancer, improve crops and possibly alter the course of evolution. The speed with which one can accomplish such good (or evil) is truly awesome.
15.09: Key Words and Terms
2',3' dideoxy CTP chemotherapy genome regulatory networks
alternative splicing genome projects restriction endonucleases
automated DNA sequencing genomic library reticulocyte
autoradiography insert DNA reverse transcriptase
BACs and YACs library screening RNA probes
bacterial artificial chromosome vectors linkers RNAse
blunt ends Northern blot shotgun sequencing
cDNA oligo d(T) column single nucleotide polymorphisms
cDNA hairpin loop PCR SNPs
cDNA library PCR primers Southern blot
cDNA probes PCR steps sticky ends
chemiluminescence phage lambda vectors systematics
cosmid vectors plasmids Taq polymerase
di-deoxy chain termination poly(A) tail thermophilic bacteria
di-deoxy sequencing method polymerase chain reaction thermophilic DNA polymerases
DNA ligase primer Thermus aquaticus
DNA sequencing primer walking transcriptome
elution probe hybridization transformation
ethidium bromide proteome vectors
fluorescence recombinant vector Western blot
forensics recombination yeast artificial chromosome vectors
Genetic (DNA) fingerprint | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/15%3A_DNA_Technologies/15.07%3A_Ome-Sweet_Ome.txt |
• 16.1: Overview
The plasma membrane has the same phospholipid bilayer construction as all intracellular membranes. All membranes are a fluid mosaic of proteins attached to or embedded in the phospholipid bilayer. The different proteins and to some extent, different phospholipids, structurally and functionally differentiate one kind of cellular membrane from another. Integral (trans-membrane) proteins span the phospholipid lipid bilayer, with one hydrophobic domain and two hydrophilic domains.
• 16.2: Plasma Membrane Structure
In eukaryotic cells, the plasma membrane surrounds a cytoplasm filled with ribosomes and organelles. Organelles are structures that are themselves encased in membranes. Some organelles (nuclei, mitochondria, chloroplasts) are even surrounded by double membranes. All cellular membranes are composed of two layers of phospholipids embedded with proteins. All are selectively permeable (semi-permeable), allowing only certain substances to cross the membrane.
• 16.3: Membrane Proteins
Clearly, membrane proteins themselves have domains that keep membranes in or attached to the membrane, provide catalytic surfaces and allow interactions inside, across and outside of cells and organelles. Membranes anchor proteins in several ways. As noted, membrane proteins, like phospholipids, are amphipathic, with hydrophobic domains that non-covalently interact strongly with the fatty acid interior of membranes. Some integral membrane proteins span the entire membrane, with hydrophilic domai
• 16.4: How Membrane Proteins are Held in Membranes
The hydrophobic domain of integral membrane proteins consists of one or more alphahelical regions that interact with the hydrophobic interior of the membranes. Hydrophilic domains tend to have more tertiary structure with hydrophilic surfaces, and so face the aqueous cytosol and cell exterior. Two trans-membrane proteins are cartooned below.
• 16.5: A Diversity of Membrane Protein Functions
Transmembrane proteins perform most of the functions illustrated here. However, peripheral membrane proteins also play vital roles in membrane function. Remember that Cytochrome c in the electron transport system on the mitochondrial cristal membrane is a peripheral protein. Other peripheral membrane proteins may serve to regulate the transport or signaling activities of transmembrane protein complexes or may mediate connections between the membrane and cytoskeletal elements.
• 16.6: Glycoproteins
Membrane proteins are often covalently linked to oligosaccharides, which are branched glycoside-linked sugars (averaging around 15 sugar residues). As glycans, they are the sugars linked to glycoproteins. Glycoproteins are rare in the cytosol, but common on secreted and membrane proteins. Oligosaccharides are typically linked to proteins via the hydroxyl group on serine or threonine. Occasional linkages are to modified amino acids like hydroxylysine or hydroxyproline (O-glycosylation), and to th
• 16.7: Glycolipids
Glycolipids are phospholipids attached to oligosaccharides, and as noted, are part of the glycocalyx. Both are only found on the extracellular surface. Glycolipids are synthesized in much the same way as glycoproteins. Specific enzymes catalyze initial glycosylation of either phospholipids or polypeptides, followed by the addition of more sugars. Along with glycoproteins, glycolipids play roles in cell-cell recognition and the formation of tissues. The glycans on the surfaces of one cell will re
• 16.8: Glycoproteins and Human Health
We’ll close this chapter with a few examples of glycoproteins that play crucial roles in human physiology. Let’s look first at the major human blood groups. The major A, B, AB, O and Rh blood groups result from the presence or absence of glycoprotein antigens embedded in red blood cell membranes and the presence or absence in the blood, of antibodies against the antigens.
• 16.9: Key Words and Terms
Thumbnail: The cell membrane, also called the plasma membrane or plasmalemma, is a semipermeable lipid bilayer common to all living cells. It contains a variety of biological molecules, primarily proteins and lipids, which are involved in a vast array of cellular processes. It also serves as the attachment point for both the intracellular cytoskeleton and, if present, the cell wall. (Public Domain; LadyofHats via Wikipedia)
16: Membrane Structure
The plasma membrane has the same phospholipid bilayer construction as all intracellular membranes. All membranes are a fluid mosaic of proteins attached to or embedded in the phospholipid bilayer. The different proteins and to some extent, different phospholipids, structurally and functionally differentiate one kind of cellular membrane from another. Integral (trans-membrane) proteins span the phospholipid lipid bilayer, with one hydrophobic domain and two hydrophilic domains. In the case of the plasma membrane, the hydrophilic domains interact with the aqueous extracellular fluid on one side and the cytoplasm on the other, while the hydrophobic domain keeps the proteins anchored in the membrane. Once embedded in the fatty acid interior of a membrane, integral membrane proteins cannot escape! In contrast, peripheral membrane proteins bind to membrane surfaces, typically held in place by hydrophilic interactions with charged features of the membrane surface (phospholipid heads, hydrophilic surface domains of integral proteins). Integral membrane proteins are often glycoproteins whose sugars face the outside of the cell. Cells thus present a sugar coating, or glycocalyx, to the outside world. As cells form tissues and organs, they become bound to extracellular proteins and glycoproteins that they, or other cells, secrete to form an extracellular matrix. We will spend much of this chapter looking at characteristic structures and biological activities of plasma membrane proteins and their functions.
Learning Objectives
When you have mastered the information in this chapter, you should be able to:
1. distinguish components of the membrane that can move (diffuse) laterally in the membrane from those that can flip (switch) from the outer to the inner surface of the phospholipid bilayer
2. compare the fluid mosaic membrane to earlier membrane models and cite the evidence for and against each (as appropriate).
3. describe how cells might make their plasma membranes and suggest an experiment that would demonstrate your hypothesis.
4. distinguish between transmembrane and peripheral membrane proteins, and provide specific examples of each.
5. decide whether a newly discovered protein might be a membrane protein.
6. predict the effect of molecular and physical influences on membrane fluidity
7. suggest how organisms living in warm tropical waters have adapted to the higher temperatures. Likewise, fish living under the arctic ice.
8. explain how salmon are able to spend part of their lives in the ocean and another part swimming upstream in freshwater, without their cells shriveling or exploding
9. list the diverse functions of membrane proteins.
10. speculate on why only eukaryotic cells have evolved sugar coated cell surfaces.
11. compare and contrast the glycocalyx and extracellular matrix of cells. | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/16%3A_Membrane_Structure/16.01%3A_Overview.txt |
In eukaryotic cells, the plasma membrane surrounds a cytoplasm filled with ribosomes and organelles. Organelles are structures that are themselves encased in membranes. Some organelles (nuclei, mitochondria, chloroplasts) are even surrounded by double membranes. All cellular membranes are composed of two layers of phospholipids embedded with proteins. All are selectively permeable (semi-permeable), allowing only certain substances to cross the membrane. The unique functions of cellular membranes are due to their different phospholipid and protein compositions. Decades of research have revealed these functions (see earlier discussions of mitochondrial and chloroplast function for instance). Here we’ll describe general features of membranes, using the plasma membrane as our example.
A. The Phospholipid Bilayer
Gorter and Grendel predicted the bilayer membrane structure as early as 1925. They knew that red blood cells (erythrocytes) have no nucleus or other organelles, and thus have only a plasma membrane. They also knew that the major chemical component of these membranes were phospholipids. The space-filling molecular model below shows the basic structure of phospholipids, highlighting their hydrophilic (polar) heads and hydrophobic tails.
Molecules with hydrophilic and hydrophobic domains are amphipathic molecules. Gorter and Grendel had measured the surface area of red blood cells. They then did a ‘blood count’ and then disrupted a known number of red blood cells. They then measured the amount of phospholipids in the membrane extracts. From this, they calculated that there were enough lipid molecules per cell to wrap around each cell twice. From these observations, they predicted the phospholipid bilayer with fatty acids interacting within the bilayer. Curiously, Gorter and Grendel had made two calculation errors in determining the amount of phospholipid per cells. Nevertheless, their errors compensated each other so that, while not strictly speaking correct, their conclusion remained prophetic! Common membrane phospholipids are shown below.
Amphipathic molecules mixed with water spontaneously aggregate to ‘hide’ their hydrophobic regions from the water. In water, these formed actual structures called liposomes that sediment when centrifuged!
276 Membrane Lipids and the Phospholipid Bilayer
277 Experiments with and Uses of Liposomes
Liposome membrane structure is consistent with the predicted phospholipid bilayer, with the hydrophobic tails interacting with each other and the polar heads facing away from each other, forming a phospholipid bilayer. This led to a picture of membrane architecture based on phospholipid interactions. An iconic illustration of the phospholipid bilayer, with its hydrophobic fatty acid interior and hydrophilic external surfaces is drawn below.
Liposome membrane structure is consistent with the predicted phospholipid bilayer, with the hydrophobic tails interacting with each other and the polar heads facing away from each other, forming a phospholipid bilayer. This led to a picture of membrane architecture based on phospholipid interactions. An iconic illustration of the phospholipid bilayer, with its hydrophobic fatty acid interior and hydrophilic external surfaces is drawn below.
B. Models of Membrane Structure
In 1935, Davson and Danielli suggested that proteins might be bound to the polar heads of the phospholipids in the plasma membrane, creating a protein/lipid/protein sandwich. Decades later, J.D. Robertson observed membranes in the transmission electron microscope at high power, revealing that all cellular membranes had a trilamellar structure. The classic trilamellar appearance of a cellular membrane in the electron microscope is illustrated below
The trilamellar structure is consistent with the protein-coated hydrophilic surfaces of a phospholipid bilayer in Davson and Danielli’s protein-lipid-protein sandwich. Observing that all cellular membranes had this trilamellar structure, Robertson he further proposed his Unit Membrane model: all membranes consist of a clear phospholipid bilayer coated with electron-dense proteins.
The static view of the trilamellar models of membrane structure implied by the Davson-Danielli or Robertson models was replaced in 1972 by Singer and Nicolson’s Fluid Mosaic model (see The fluid mosaic model of membranes. Science 175:720- 731). They suggested that in addition to peripheral proteins that do bind to the surfaces of membranes, many integral membrane proteins actually span the membrane. Integral membrane proteins were imagined as a mosaic of protein ‘tiles’ embedded in a phospholipid medium. But unlike a mosaic of glazed tiles set in a firm, cement-like structure, the protein ‘tiles’ were predicted to be mobile (fluid) in a phospholipid sea. In this model, membrane proteins are anchored in membranes by one or more hydrophobic domains; their hydrophilic domains would face aqueous external and cytosolic environments. Thus, like phospholipids themselves, membrane proteins are amphipathic. We know that cells expose different surface structural (and functional) features to the aqueous environment on opposite sides of a membrane. Therefore, we also say that cellular membranes are asymmetric. A typical model of the plasma membrane of a cell is illustrated below.
In this model, peripheral proteins have a hydrophobic domain that does not span the membrane, but that anchors it to one side of the membrane. Other peripheral (or socalled “surface”) proteins are bound to the membrane by interactions with the polar phosphate groups of phospholipids, or with the polar domains of integral membrane proteins.
Because of their own aqueous hydrophilic domains, membrane proteins are a natural barrier to the free passage of charged molecules across the membrane. On the other hand, membrane proteins are responsible for the selective permeability of membranes, facilitating the movement of specific molecules in and out of cells. Membrane proteins also account for specific and selective interactions with their extracellular environment. These interactions include the adhesion of cells to each other, their attachment to surfaces, communication between cells (both direct and via hormones and neurons), etc. The ‘sugar coating’ of the extracellular surfaces of plasma membranes comes from oligosaccharides covalently linked to membrane proteins (as glycoproteins) or to phospholipids (as glycolipids). Carbohydrate components of glycosylated membrane proteins inform their function. Thus, glycoproteins enable specific interactions of cells with each other to form tissues. They also allow interaction with extracellular surfaces to which they must adhere. In addition, they figure prominently as part of receptors for many hormones and other chemical communication biomolecules. Protein domains exposed to the cytoplasm, while not glycosylated, often articulate to components of the cytoskeleton, giving cells their shape and allowing cells to change shape when necessary. Many membrane proteins have essential enzymatic features, as we will see. Given the crucial role of proteins and glycoproteins in membrane function, it should come as no surprise that proteins constitute an average of 40-50% of the mass of a membrane. In some cases, proteins are as much as 70% of membrane mass (think cristal membranes in mitochondria!).
278 Properties of Proteins Embedded in a Phospholipid Bilayer
279 Different Membrane Compositions
C. Evidence for Membrane Structure
Membrane asymmetry refers to the different membrane features facing opposite sides of the membrane. This was directly demonstrated by the scanning electron microscope technique of freeze-fracture. The technique involves freezing of isolated membranes in water and then chipping the ice. When the ice cracks, the encased membranes split along a line of least resistance… that turns out to be between the hydrophobic fatty acid opposing tails in the interior of the membrane. Scanning electron microscopy then reveals features of the interior and exterior membrane surfaces. Among the prominent features in a scanning micrograph of freeze-fractured plasma membranes are the pits and opposing mounds facing each other on opposite flaps of the membrane, as illustrated below.
Other features shown here are consistent with phospholipid membrane structure.
280 Freeze Fracture Electron Microscopy of Cell Membranes
Cytochemistry confirmed the asymmetry of the plasma membrane, showing that only the external surfaces of plasma membranes are sugar coated, Check the link below for more detailed descriptions of the experiments.
281 EM Cytochemical Demonstration of Membrane Asymmetry
Finally, the asymmetry of membranes was also demonstrated biochemically. In one experiment, whole cells treated with proteolytic enzymes, followed by extraction of the membranes and then isolation of membrane proteins. In a second experiment, plasma membranes were isolated from untreated cells first, and then treated with the enzymes. In a third experiment, proteins were extracted from plasma membranes isolated from untreated cells. Electrophoretic separation of the three protein extracts by size demonstrated that different components of integral membrane proteins were present in the two digest experiments, confirming the asymmetry of the plasma membrane. Again, for more details, check the link below.
282 Electrophoretic Demonstration of Membrane Asymmetry
The idea that membranes are fluid was also tested. In yet another elegant experiment, antibodies were made to mouse and human cell membrane proteins. Membranes were isolated and injected into a third animal (a rabbit most likely). The rabbit saw the membranes and their associated proteins as foreign and responded by making specific anti-membrane antibody molecules. The antibodies against each membrane source were isolated and separately tagged with different colored fluorescent labels so that they would glow a different color when subjected to ultraviolet light. After mouse and human cells were mixed under conditions that caused them to fuse, making human-mouse hybrid cells. When added to fused cells, the tagged antibodies bound to the cell surface proteins. After a short time, the different fluorescent antibodies were seen to mix under a fluorescence microscope under UV light. The fluorescent tags seemed to moving from their original location in the fused membranes. Clearly, proteins embedded in the membrane are not static, but are able to move laterally in the membrane, in effect floating and diffusing in a “sea of phospholipids”. The mouse antibodies as seen in the hybrid cell right after fusion are cartooned below.
283 Two Demonstrations of Membrane Fluidity: The Fluid Mosaic
D. Membrane Fluidity is Regulated
1. Chemical Factors Affecting Membrane Fluidity
As you might imagine, the fluidity of a membrane depends on its chemical composition and physical conditions surrounding the cell, for example the outside temperature. Factors that affect membrane fluidity are summarized below.
Just as heating a solution causes dissolved molecules and particulates to move faster, phospholipid and protein components of membranes are also more fluid at higher temperatures. If the fatty acids of the phospholipids have more unsaturated (C=C) carbon bonds, these hydrophobic tails will have more kinks, or bends. The kinks tend to push apart the phospholipid tails. With more space between the fatty acid tails, membrane components can move more freely. Thus, more polyunsaturated fatty acids in a membrane make it more fluid. On the other hand, cholesterol molecules tend to fill the space between fatty acids in the hydrophobic interior of the membrane. This reduces the lateral mobility of phospholipid and protein components in the membrane. By reducing fluidity, cholesterol reduces membrane permeability to some ions.
2. Functional Factors Affecting Membrane Fluidity
Evolution has adapted cell membranes to different and changing environments to maintain the fluidity necessary for proper cell function. Poikilothermic, or coldblooded organisms, from prokaryotes to fish and reptiles, do not regulate their body temperatures. Thus, when exposed to lower temperatures, poikilotherms respond by increasing the unsaturated fatty acid content of their cell membranes. At higher temperatures, they increase membrane saturated fatty acid content. Thus, the cell membranes of fish living under the arctic ice maintain fluidity by having high levels of both monounsaturated and polyunsaturated fatty acids. What about fish species that range across warmer and colder environments (or that live in climates with changing seasons). For these fish, membrane composition can change to adjust fluidity to environment.
The warm-blooded (homeothermic) mammals and birds maintain a more or less constant body temperature. As a result, their membrane composition is also relatively constant. But there is a paradox! Their cell membranes are very fluid, with a higher ratio of polyunsaturated fat to monounsaturated fats than say, reptiles. The apparent paradox is resolved however, when we understand that this greater fluidity supports the higher metabolic rate of the warm-blooded species compared to poikilotherms. Just compare the life styles of almost any mammal to a lazy floating alligator, or a snake basking in the shade of a rock!
284 Factors Influencing Membrane Fluidity
E. Making and Experimenting with Artificial Membranes
Membrane-like structures can form spontaneously. When phospholipids interact in an aqueous environment, they aggregate to exclude their hydrophobic fatty tails from water, forming micelles. Micelles are spherical phospholipid monolayer vesicles that self-assemble, a natural aggregation of the hydrophobic fatty acid domains of these amphipathic molecules.
A micelle is drawn below.
Micelles can further self-assemble into spherical phospholipid bilayers called liposomes (below).
When formed in the laboratory, these structures behave somewhat like cells, for example, forming a pellet at the bottom of a tube when centrifuged. Liposomes can be custom designed from different kinds of phospholipids and amphipathic proteins that become integral to the liposome membranes. When liposomes can be prepared in the presence of specific proteins or other molecules that can’t cross the membrane. The trapped molecules cannot get out of this synthetic ‘organelle’. Such were the studies that allowed the identification of the mitochondrial respiratory chain complexes. The ability to manipulate liposome content and membrane composition also make them candidates for the drug delivery to specific cells and tissues (google liposome for more information).
F. The Plasma Membrane is Segragated into Regions with Different Properties of Fluidity and Selective Permeability
As we will see shortly, fluidity does not result in an equal diffusion of all membrane components around the cell membrane surface. Instead, extracellular connections between cells as well as intracellular connections of the membrane to differentiated regions of the cytoskeleton, effectively compartmentalize the membrane into subregions. To understand this, imagine a sheet of epithelial like those in the cartoon below.
The sheet of cells exposes one surface with unique functions to the inside of the organ they line. It exposes the opposite surface, one with a quite different function, to the other side of the sheet. The lateral surfaces of the cells are yet another membrane compartment, one that functions to connect and communicate between the cells in the sheet. Components, i.e., membrane proteins illustrated with different symbolic shapes and colors, may remain fluid within a compartment. Of course, this macrodifferentiation of cell membranes to permit cell-cell and cell-environmental interactions makes intuitive sense.
The recent observation that cellular membranes are even more compartmentalized was perhaps less anticipated. In fact, membranes are further divided into microcompartments. Within these compartments, components are fluid but seldom move between compartments. Studies indicate that cytoskeletal elements create and maintain these micro-discontinuities. For example, integral membrane proteins are immobilized in membranes if they are attached to cytoskeletal fibers (e.g., actin) in the cytoplasm. Furthermore, when aggregates of these proteins line up due to similar interactions, they form kind of fence, inhibiting other membrane components from crossing. By analogy, this mechanism of micro-compartmentalization is called the Fences and Pickets model; proteins attached to the cytoskeleton serve as the pickets. The movement across the fences (i.e., from one membrane compartment to another) is infrequent. Extra kinetic energy is presumably needed for a molecule to ‘jump’ a fence between compartments. Hence, this kind of motion, or hop diffusion distinguishes it from the Brownian motion implied by the original fluid mosaic model.
285 Membrane Domains: Regional Differentiation of a Plasma Membrane | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/16%3A_Membrane_Structure/16.02%3A_Plasma_Membrane_Structure.txt |
Clearly, membrane proteins themselves have domains that keep membranes in or attached to the membrane, provide catalytic surfaces and allow interactions inside, across and outside of cells and organelles. Membranes anchor proteins in several ways. As noted, membrane proteins, like phospholipids, are amphipathic, with hydrophobic domains that non-covalently interact strongly with the fatty acid interior of membranes. Some integral membrane proteins span the entire membrane, with hydrophilic domains facing the cytosol or cell exterior. Peripheral proteins bind to a membrane surface through non-covalent interactions. Examples of integral and peripheral membrane proteins, glycoproteins and lipoproteins are illustrated below.
286 Domains of Membrane Proteins
16.04: How Membrane Proteins are Held in Membranes
The hydrophobic domain of integral membrane proteins consists of one or more alphahelical regions that interact with the hydrophobic interior of the membranes. Hydrophilic domains tend to have more tertiary structure with hydrophilic surfaces, and so face the aqueous cytosol and cell exterior. Two trans-membrane proteins are cartooned below.
The protein on the left crosses the membrane once, while the one on the right crosses the membrane three times. How a transmembrane protein inserts into the membrane during synthesis dictates the locations of its N- and C-terminus. Transmembrane proteins can in fact cross a membrane more than once, which also determines the location of its N- and C-termini. N-terminal end of a plasma membrane polypeptide always ends up exposed to the outside of the cell. The alpha helical domains that anchor proteins in membranes are mostly non-polar and hydrophobic themselves. As an example, consider the amino acids in the alpha-helical domain of the red blood cell protein glycophorin A, a membrane protein that prevents red blood cells from aggregating, or clumping in the circulation. One glycophorin A polypeptide with its hydrophobic trans-membrane alpha helix is cartooned below. Glycophorin A monomers pair to form dimers in the plasma membrane.
Proteins that span membranes multiple times may include amino acids with charged, polar side chains, provided that these side chains interact between helices so that they are shielded from the fatty acid environment in the membrane. Because of these hydrophilic interactions, such proteins can create pores for the transport of polar molecules and ions; we will see some of these proteins later. Integral membrane proteins that do not span the membrane also have a hydrophobic helical domain that anchors them in the membrane, while their hydrophilic domains typically interact with intracellular or extracellular molecules to e.g., hold cells in place give cells and tissues their structure, etc.
The very presence of the hydrophobic alpha-helical domains in trans-membrane proteins makes them difficult if not impossible to isolate from membranes in a biologically active form. By contrast, the peripheral polypeptide cytochrome c readily dissociates from the cristal membrane, making it easy to purify. For many years, an inability to purify other cristal membrane electron carriers in biologically active form limited our understanding of the structure and function of the mitochondrial electron transport system.
Hydrophobic alpha-helical domains are in fact, a hallmark of membrane-spanning proteins. It is even possible to determine the primary structure of a polypeptide encoded by a gene before the protein itself has been isolated. For example, knowing the DNA sequence of a gene, we can infer the amino acid sequence of the protein encoded by the gene. A hydrophobicity analysis of the inferred amino acid sequence can tell us if a protein is likely to be a membrane protein. Let’s look at a hydropathy (hydrophobicity) plot (below).
To see how an hydropathy plot can predict whether a protein is a membrane protein, check out the link below.
287 Hydropathy Predicts Hydrophobic Domains and Membrane Proteins | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/16%3A_Membrane_Structure/16.03%3A_Membrane_Proteins.txt |
Example Membrane Protein Functions
• receptors for hormones or neurotransmitters
• antibodies of the immune system that recognize foreign substances (antigens)
• cell-recognition molecules that bind cells together
• cell membrane structures that directly pass chemical information between cells
• anchoring cells to extracellular surfaces like connective tissue
• molecular transport (entry into or exit of substances from cells)
• enzymes that catalyze crucial reactions in cells.
Transmembrane proteins perform most of the functions illustrated here. However, peripheral membrane proteins also play vital roles in membrane function. Remember that Cytochrome c in the electron transport system on the mitochondrial cristal membrane is a peripheral protein. Other peripheral membrane proteins may serve to regulate the transport or signaling activities of transmembrane protein complexes or may mediate connections between the membrane and cytoskeletal elements. The peripheral membrane proteins by shown here do not penetrate membranes. They bind reversibly to the internal or external surfaces of the biological membrane with which they are associated. We will be looking more closely at what holds membrane proteins in place and how they perform their unique functions. Check out major membrane protein functions, actions and cellular locations below
Basic Function Specific Actions Examples
Facilitated Transport Regulate diffusion of substances across membranes along a concentration gradient Ca2+ & other ion channels, glucose transporters
Active Transport Use energy to move ions from low to high concentrations across membranes Mitochondrial protein pumps, the Na+/K+ ion pump in neurons
Signal Transduction For e.g., hormones that can't enter cells, these convey information from molecular signals to cytoplasm, leading to a cellular response Protein hormone and growth factor signaling, antibody/antigen interactions, cytokine mediation of inflammatory responses etc.
Cell-cell interactions Cell-cell recognition and binding to form tissues Formation of desmosomes gap junctions and tight junctions.
Anchors to cytoskeleton Link membrane proteins to cytoskeleton Give cells their shape, cell movement and response to molecular signals
Enzymatic Usually multifunctional proteins with enzymatic activities The F1 ATP synthase that uses proton gradient to make ATP; adenylyl cyclase that makes cAMP during signal transduction; note that some receptor proteins are linked to enzymatic domains in the cytoplasm
288 Diversity of Membrane Protein Structure and Function
289 Pore Proteins May Cross the Membrane Many Times
290 Red Blood Cell (Erythrocyte) Membrane Protein Functions
16.06: Glycoproteins
Membrane proteins are often covalently linked to oligosaccharides, which are branched glycoside-linked sugars (averaging around 15 sugar residues). As glycans, they are the sugars linked to glycoproteins. Glycoproteins are rare in the cytosol, but common on secreted and membrane proteins. Oligosaccharides are typically linked to proteins via the hydroxyl group on serine or threonine. Occasional linkages are to modified amino acids like hydroxylysine or hydroxyproline (O-glycosylation), and to the amide nitrogen on asparagine (N-glycosylation). The oligosaccharide domains of glycoproteins often play a major role in membrane protein function. For example, the glycoproteins, along with the polar domains of integral and peripheral proteins and glycolipids, are a major feature of the glycocalyx. A cell membrane and its glycocalyx are illustrated below.
Oligosaccharides begin their synthesis in the rough endoplasmic reticulum (RER), with the creation of a core glycoside. Partial glycans are enzymatically linked to compatible amino acids of a membrane protein. As these proteins travel through the Golgi vesicles of the endomembrane system, terminal glycosylation attaches more sugars to the core glycoside to complete glycoprotein synthesis. When vesicles budding from the transGolgi vesicles fuse with the plasma membrane, the sugars on the glycoproteins end up on the exterior cell surface. This is illustrated in the link below.
291 The Path to Sugar Coated Cells
16.07: Glycolipids
Glycolipids are phospholipids attached to oligosaccharides, and as noted, are part of the glycocalyx. Both are only found on the extracellular surface. Glycolipids are synthesized in much the same way as glycoproteins. Specific enzymes catalyze initial glycosylation of either phospholipids or polypeptides, followed by the addition of more sugars. Along with glycoproteins, glycolipids play roles in cell-cell recognition and the formation of tissues. The glycans on the surfaces of one cell will recognize and bind to carbohydrate receptors (lectins) on adjacent cells, leading to cell-cell attachment as well as intracellular responses in the interacting cells. Glycoproteins and glycolipids also mediate the interaction of cells with extracellular molecular signals and with chemicals of the extracellular matrix (ECM). The ECM includes components of connective tissue, basement membranes, in fact any surface to which cells attach.
292 The Extracellular Matrix | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/16%3A_Membrane_Structure/16.05%3A_A_Diversity_of_Membrane_Protein_Functions.txt |
We’ll close this chapter with a few examples of glycoproteins that play crucial roles in human physiology. Let’s look first at the major human blood groups. The major A, B, AB, O and Rh blood groups result from the presence or absence of glycoprotein antigens embedded in red blood cell membranes and the presence or absence in the blood, of antibodies against the antigens. Typically, exposure to antigens (foreign substances like bacteria, viruses, toxins…) generates immunoglobulins, the antibody molecules of our immune system; immunoglobulins are glycoproteins. The situation with blood groups is something of a paradox. The blood group antibodies already in the blood of a healthy person are not a response to foreign antigen invasion
You probably know that these blood groups must be compatible for a successful blood transfusion. A mismatch between donor and recipient can be devastating. The interaction of the red cell antigens of one blood group with antibodies in another blood group will cause the red cells to clump, restricting blood flow and ultimately killing the transfusion recipient. The table below summarizes why transfusions with mismatched A, B, AB, O blood groups must be avoided.
Group A Group B Group AB Group O
Cell-surface antigens
Antibodies inthe blood
None
Acceptable donor-recipient matches Group A or Group O donors Group B or Group O donors Universal Recipient (Group AB, A, B, O donors) Only Group O donors
Why red cells clump in mismatched blood Anti-A from Group B donor binds, aggregates recipient red cells; recipient Anti B binds, aggregated donor red cells Anti-B from Group A donor binds, aggregates recipient red cells; recipient Anti A binds, aggregates donor red cells Antibodies in Group O blood will bind any donor red cell antigens and cause the cells to clump
Another red blood cell antigen is the Rh factor. People have either it (Rh+ ) or not (Rh- ). In contrast, when an Rhrecipient receives blood from an Rh+ donor, the recipient’s immune system makes defensive anti-Rh antibodies in the usual way. This too can cause blood cell clumping with bad consequences. A word to the wise: it’s a good idea to know your own blood group!
Check the Red Cross website (here) or Wikipedia for more detail about blood groups.
The last example here involves the cell surface major histocompatibility complex (MHC) glycoproteins that distinguish self from non-self in body tissues and organs. Major organ Transplantation (liver, kidneys, heart) from donors into patients with failing organs has become, if not routine, then at least increasingly common. Before a transplant, MHC tissue typing determines donor and recipient compatibility, reducing the chances of the rejection of the transplanted organ. Since available donors are few, and good matches even fewer, patients wait on prioritized lists for a matched organ. Even when MHC typing is a match for a patient, the immune systems of transplant recipients are suppressed with hormones to reduce further the chance of rejection. Unlike the limited number of blood groups, many MHC proteins are analyzed to determine a match. Thus, it is not practical (or routinely necessary) to ‘know’ your MHC type!
In the next chapter, we look at membrane functions intrinsic to cellular existence itself.
16.09: Key Words and Terms
amphipathic molecules glycolipids preipheral membrane proteins
asparagine glycosylation phospholipid bilayer
cell membrane Golgi vesicles plasma membrane
cell-cell attachment Hyropathy plot poikilothermic organisms
cytoskeleton hydrophilic phosphate heads RER
Davson-Danielli membrane model hydrophobic fatty acid tails Rough endoplasmic reticulum
endomembrane system hydrophobicity plot saturated fatty acids
exocytosis hydroxyproline serine
extracellular matrix (ECM) hydroxylysine temperature effects on membranes
fluid mosiac integral membrane proteins threonine
freeze facture method membrane asymmetry transmembrane proteins
membrane evolution membrane proteins unsaturated fatty acids
glycan N-glycoslyation
glycocalyx O-glycoslyation | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/16%3A_Membrane_Structure/16.08%3A_Glycoproteins_and_Human_Health.txt |
• 17.1: Introduction
Small molecules like O2 or CO2 can cross cellular membranes unassisted; neither the hydrophilic surfaces nor the hydrophobic interior of the phospholipid bilayer are barriers to their transit. On the other hand, most molecules (even water!) need the help of membrane transport proteins to get in or out of cells and organelles.
• 17.2: Membrane Transport
Only a few small, relatively uncharged molecules can cross a membrane unassisted (i.e., by passive diffusion). Hydrophilic molecules that must enter or leave cells do so with help, i.e., by facilitated transport. Passive and facilitated transport release the free energy inherent in concentration gradients as molecules diffuse across a membrane.
• 17.3: Ligand and Voltage Gated Channels in Neurotransmission
When neurotransmitters bind to their receptors, ion channels in responding neuron or muscle cells open. The resulting influx of Na+ ions disrupts the resting potential of the target cell. The effect is only transient if the membrane potential remains negative. However, if enough Na+ ions enter the cell, the membrane becomes depolarized. If the cell experiences hyperpolarization, a localized reversal of normal membrane polarity (say from –70 mV to +65mV or more) will generate an action potential.
• 17.4: Endocytosis and Exocytosis
Endocytosis is a mechanism for internalizing large extracellular molecules (e.g., proteins), insoluble particles, or even microorganisms. The three main types of exocytosis are phagocytosis, pinocytosis and receptor-mediated endocytosis. Pinocytosis is non-specific. Phagocytosis targets large structures (e.g., bacteria, food particles…) and is not particularly specific. As its name suggests, receptor-mediated endocytosis is specific for substances recognized by a cell-surface receptor.
• 17.5: Directing the Traffic of Proteins in Cells
Each polypeptide protein translated by ribosomes from a sequence of bases in an mRNA has a specific functional location, either in the cytoplasm, on cellular membranes, inside organelles or in extracellular fluids. In this section we consider the movement and sorting of proteins in the endomembrane system as well as the transport of proteins into and out of organelles.
• 17.6: How Cells are Held Together and How they Communicate
Proteins and glycoproteins on cell surfaces play a major role in how cells interact with their surroundings and with other cells. Some of the proteins in the glycocalyx of adjacent cells interact to form cell-cell junctions, while others interact with extracellular proteins and carbohydrates to form the extracellular matrix (ECM). Still others are part of receptor systems that bind hormones and other signaling molecules at the cell surface, conveying information into the cell by signal moves.
• 17.7: 17.7 Signal Transduction
When hydrophobic chemical effector molecules such as steroid hormones reach a target cell they can cross the hydrophobic membrane and bind to an intracellular receptor to initiate a response. When large effector molecules (e.g., protein hormones) or highly polar hormones (e.g., adrenalin) reach a target cell, they can’t cross the cell membrane. Instead, they bind to transmembrane protein receptors on cell surfaces.
• 17.8: Key Words and Terms
17: Membrane Function
Small molecules like O2 or CO2 can cross cellular membranes unassisted; neither the hydrophilic surfaces nor the hydrophobic interior of the phospholipid bilayer are barriers to their transit. On the other hand, most molecules (even water!) need the help of membrane transport proteins to get in or out of cells and organelles. Transport proteins can act as gates that might be open or closed. When open, they permit diffusion of molecules into or out of cells along a concentration gradient so that their concentrations equalize across the membrane. Like the passive diffusion of small gasses, facilitated diffusion by membrane proteins does not require an input of energy. In contrast, some transport proteins are actually pumps, using chemical energy to move molecules across membranes against a concentration gradient. The result of this active transport is to concentrate solutes on one side of a membrane. For example, pumps that create sodium and potassium ion gradients are responsible for the excitability of cells. Recall that this is one of the fundamental properties of life: the ability of cells and organisms to respond to stimuli.
As you read this chapter, look for how allosteric change can regulate membrane function, where we consider how:
• membrane gates and pumps work
• membrane protein interactions allow cells to self-assemble into tissues and organs.
• cells direct protein traffic to the cytoplasm, into membrane themselves, into organelles, or out of the cell
• membrane proteins participate in direct communication between adjacent cells.
• membrane proteins are receptors for more long-distance communications
• membrane proteins are receptors for more long-distance communications, responding to neurotransmitters, hormones, and other external chemical signals.
Learning Objectives
1. Explain how/why one cell’s plasma membrane differs from that of another cell type.
2. Explain how/why the plasma membrane differs from other membranes with in the same cell.
3. Determine if a solute crosses a plasma membrane by passive or facilitated diffusion.
4. Explain how salmon can spend part of their lives in the ocean and part swimming upstream in freshwater to spawn, without their cells shriveling or bursting.
5. Explain how active transport stores chemical energy (recall electron transport).
6. Explain the role of active transport in maintaining/restoring a cell’s resting potential.
7. Compare and contrast different kinds of gated channels.
8. Describe the order of ion movements that generate an action potential.
9. Define and compare exocytosis, pinocytosis, phagocytosis and receptor-mediated endocytosis
10. Distinguish between signal molecules that enter cells to deliver their chemical message and those deliver their message only as far as the plasma membrane.
11. Trace an intracellular response to a steroid hormone to a likely cellular effect.
12. Trace a liver cell response to adrenalin from plasma membrane to glycogenolysis (glycogen breakdown).
13. Compare the signal transduction activities of different G-protein receptors leading to the first active kinase enzyme.
14. Explain how a liver cell can respond the same way to two different hormones (e.g., adrenalin and glucagon)…, and why this should be possible
15. Describe/explain how a phosphorylation cascade amplifies the cellular response to a small amount of an effector (signal) molecule.
16. Discuss the differences and interactions between the glycocalyx, basement membrane and extracellular matrix (ECM).
17. Explain ECM functions and identify components involved in those functions
18. Describe how the molecular structure of fibronectin supports its different functions.
19. Describe some structural relationships between cell surfaces and the cytoskeleton.
20. Compare and contrast the structures and functions of the different cell junctions.
21. Distinguish between the structures and functions of cadherins, clathrin, COPs, adaptin, selectins, SNAREs and CAMs.
22. State an hypothesis to explain why some cancer cells divide without forming a tumor | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/17%3A_Membrane_Function/17.01%3A_Introduction.txt |
The first control on the passage of molecules across membranes is the semi-permeable character of the membrane itself. Molecules move in and out of cells in one of three ways: passive diffusion, facilitated transport and active transport.
Only a few small, relatively uncharged molecules can cross a membrane unassisted (i.e., by passive diffusion). Hydrophilic molecules that must enter or leave cells do so with help, i.e., by facilitated transport. Passive and facilitated transport release the free energy inherent in concentration gradients as molecules diffuse across a membrane. In contrast, active transport consumes energy to create concentration gradients of specific solutes. The specificity of facilitated and active transport lies in integral membrane proteins that recognize and bind specific solutes for transport. As you may predict, allosteric regulation of these proteins controls the movement of their target molecules into or out of cells.
Despite its polarity, many believed that the small water molecules crossed membranes without help. Indeed, it does to a limited extent. However, others suspected that given its highly charged polar covalent bonds relative to its small size, water molecules require an assist to get across membranes efficiently. Let’s begin with a closer look at passive diffusion and facilitated diffusion, followed by osmosis (a special case of facilitated diffusion), and finally, at active transport.
A. Passive Diffusion
Passive diffusion is the movement of molecules over time by random motion (also called Brownian motion) from regions of higher concentration to regions of lower concentration. Significant passive diffusion across cellular membranes is limited to a few molecules, mostly gasses like O2, CO2, and N2, that can freely cross the hydrophobic phospholipid barrier. The rapid diffusion of gasses is essential for O2 and CO2 exchange between the alveolar capillaries and cells of the lungs during physiological respiration. O2 and CO2 exchange also occurs in mitochondria during cellular respiration. Diffusion across membranes does not require energy. In fact, diffusion releases energy - recall the movement of protons through the F1 ATPase proton gate that synthesizes ATP during mitochondrial oxidative phosphorylation.
The rate of diffusion of a molecule is dependent only on its own concentration. It is unaffected by the concentration of other molecules. Over time, random motion of solutes within and across compartments results in a dynamic equilibrium for each different solute over time. At equilibrium, solute molecules continue to diffuse across the membrane, but for each molecule moving across in one direction, another molecule of the same solute crosses in the other direction.
B. Facilitated Diffusion of Solutes and Ions
Like passive diffusion, facilitated diffusion is the spontaneous (downhill) passage of molecules or ions across membranes through specific transmembrane proteins. The kinetics of passive and facilitated diffusion reveals the differences between the two processes. To understand the latter, recall that the rate of enzyme catalysis is saturable. That is, as the concentration of substrate is increased, the rate of the catalyzed reaction approaches a maximum (Vmax), when all enzyme molecules in solution are bound to substrate molecules. The same saturation phenomenon applies to facilitated transport – the rate of solute movement across a membrane is directly proportional to the number of transport proteins in the membrane.
The kinetics of passive and facilitated diffusion are illustrated by the graph shown below
Perhaps you see another similarity between facilitated diffusion and enzyme catalysis in this graph! Relative rates of facilitated diffusion are typically rapid, compared to those of passive diffusion. This is because the allosteric changes that accompany facilitated transport are rapid, just as they are during enzyme catalysis. There are three kinds of facilitated transport of solutes (below).
The GLUT protein (glucose transporter) protein shown above (left) allows glucose uniport, the specific transport of a single substance in or out of cells. Kidney cells have glucose transporters that symport (couple) the simultaneous movement of glucose and sodium ions; SGLT (Sodium-GLucose Transporter) serves a similar function in small intestine cells, enabling absorption of dietary glucose and sodium. Antiport (above, right) allows the specific exchange of molecules across a membrane. In the example shown, ATP leaves the mitochondrial matrix, crossing the cristal membrane at the same time as ADP enters the matrix.
Whether by uniport, symport or antiport, each solute will independently cross a membrane down its concentration gradient, moving from higher concentration to where it is at a lower concentration. Recall that diffusion along a gradient releases free energy that depends on relative concentrations of the solutes.
Proteins mediating facilitated diffusion are of two kinds: carrier proteins and channel proteins. Carrier proteins allow solute transport. Ions, with their high charge-to-mass ratio, need help to cross the hydrophobic membrane barrier; this is the job of channel proteins that essentially serve as ion pores.
Like all transporter proteins, both carrier and channel proteins undergo allosteric change during transport. They are also typically subject to allosteric regulation, rather than being in a constant ‘open’ state. Examples of facilitated diffusion are considered in more detail below.
1. Carrier Proteins
When a carrier protein binds a solute that must cross the membrane, it undergoes an allosteric change (illustrated below). During transport, the carrier protein undergoes another change in shape. When the solute reaches the other side of the membrane, it no longer has a high affinity for the carrier protein. After release of the solute, a final allosteric change restores the original conformation of the transport protein. These sequential conformational changes are illustrated on the next page.
Any given carrier protein is specific for a single solute, or at most a single family of closely related solutes. We just saw the GLUT1 transporter carrier protein that allows glucose (but not fructose or ribose!) to cross cell membranes. Different specific carrier proteins facilitate the transport of amino acids and other charged solutes across cell membranes. Once again, molecules that indicate cell status (i.e., a need to import or export solute) are allosteric effectors that regulate carrier proteins. The regulation of glucose transport into cells by insulin is a perfect
example. One consequence of insulin released during a meal (or just in anticipation of a meal) is the stimulation of glucose transporters to take up glucose. An inability of those transporters to respond to insulin accounts in part for Type II (adult onset) diabetes.
Water gets across membranes by osmosis (we’ll look more closely at how osmosis affects cells in a moment). We noted that small amounts of water could cross the phospholipid bilayer unassisted. Water can also cross a membrane incidentally, when ions flow through their channel proteins. But most osmosis involves facilitated diffusion mediated by aquaporins. Some aquaporins only transport water. Others have evolved to co-facilitate the transport of glucose (see above), glycerol, urea, ammonia, carbon dioxide and even ions (protons) along with water. Like other carrier proteins, aquaporins are allosterically regulated to allow cells to meet their specific water balance requirements. So fundamental was the understanding of water balance that the discovery of aquaporins earned Peter Agre a Nobel Prize in Chemistry in 2003. Since Agre’s discovery (in 1992), several genetic diseases have been linked to aquaporin gene mutations.
Kidney cells are critically involved in vertebrate water balance and have many aquaporins in their membranes. In a rare form of diabetes, abnormal aquaporins cause the kidneys to excrete unusually large volumes of water. In another example, aquaporin gene mutations lead to the development of cataracts in both eyes. Since their initial discovery, aquaporins have been described in bacteria and plants. To learn more, click Aquaporins.
2. Ion Channels
Allosteric regulation of ion channel proteins controls ion homeostasis in blood and extracellular fluids within narrow limits. Often, multiple integral proteins contribute to the formation of an ion channel. When stimulated, channel proteins rearrange to open a pore allowing specific ion transport. Some ion channels, like the glucosesodium ion symport system noted above, mobilize the energy of diffusion of one solute (an ion in this case) to rapidly transport another solute through the same channel (acting like an ion channel and a carrier protein). Finally, ion channels are responsible for the excitability of cells, where Na+ , K+ and Ca++ channels collaborate in ion movements into and out of cells leading to neuronal or muscle cell responses (more shortly!)
293 Passive and Facilitated Diffusion
C. Osmosis
Osmosis, the diffusion of water across membranes from lower to higher solute concentrations, is an essential activity. It allows cells to use water to maintain cellular integrity or to adapt to changes in the solute composition in the extracellular environment. Osmosis across cellular membranes relies on the facilitated transport of water by aquaporins. The passive diffusion of water molecules, can be demonstrated with an artificial (e.g., dialysis) membrane. Water will cross such a membrane if solute concentrations are higher on one side of the membrane. Water crosses the membrane “trying” to equalize the solute concentrations on both sides of the membrane. In effect, water movement is from the side of a membrane where the free water molecule concentration is higher (i.e., where the concentration of solute is lower) to the side where the concentration of free water is lower (i.e., where the concentration of solute is higher).
1. Osmosis in Plant and Animal Cells
We could present this section in the context of free water concentrations, but we will do so in the more familiar terms of solute concentrations. Osmosis affects plant and animal cells according to the same principles, but with different effects. First, let us consider the effect of different experimental solute concentrations on animal cells, illustrated on the next page.
If the solute concentration inside and outside the cell is the same, there is no net movement into or out of the cells. The extracellular medium and cytosol are said to be isotonic to each other. When water diffuses into the cells from a low solute medium, the medium is said to by hypotonic to (less concentrated than) the cytosol. In this case, movement of water into a cell lowers the cytosol solute concentration. Animal cells swell and burst in a hypotonic solution. In hypertonic solutions (with a higher solute concentrations than the cytosol), animal cells shrivel up as water leaves the cell. From this brief description, you should conclude that water crosses from the hypotonic to the hypertonic side of a membrane.
As with animal cells, exposure of plant cells to hypotonic or hypertonic solutions causes the same directional water movements, but with some key differences due to their cell walls. In hypotonic solutions, water enters plant cells, moving into the cytosol and then into water vacuoles called tonoplasts. This results in higher osmotic pressure (water pressure) in the tonoplasts. The expanding tonoplast creates turgor pressure, compressing the cytosol against the cell wall. Rather than bursting, the cells and plant tissues stiffen and become turgid. Since water cannot enter plant cells indefinitely, water stops entering the cells when the osmotic pressure outside the cells and the turgor pressure inside the cells are at equilibrium. You encountered this phenomenon if you have ever over-watered houseplants. The stiffened leaves and stems become brittle and are easily snapped or broken. In hypertonic medium, plant cells (like animal cells) lose water, resulting in plasmolysis. This is the effect of shrinkage of the plasma membrane. However, the plasma membrane remains tightly attached to the plant cell wall at several points. You may have seen under-watered plants with floppy or droopy stems and leaves. These have become flaccid due to loss of water and thus the loss of turgor pressure needed to keep leaves and stems upright. The effects of different solutions on plant cells are illustrated below
Formally, osmotic or turgor pressure is defined as the force per unit area (i.e., pressure) required to prevent the passage of water across a semipermeable membrane from a hypotonic to a hypertonic solution
2. Osmosis in Plant Life
While individual plant cells respond to changes in solute concentrations, these changes are rapidly communicated to adjacent cells through plasmodesmata. These structures connect the plasma membranes of adjacent cells through their cell walls, allowing rapid, direct sharing of physical and chemical information.
A plasmodesma is illustrated below.
In this way, effects on osmotic pressure in a few cells created by changes in water availability are transmitted to adjacent cells, affecting turgor pressure in those cells and, ultimately, in plant tissues.
Finally, plant life depends on water! Recall that plant cells require a continual supply of water for use in photosynthesis, to provide hydrogen to reduce CO2 to glucose. Photosynthesis as well as the loss of excess water from plant tissues (especially leaves) by transpiration lowers cellular osmotic pressure. As water moves up from the roots to replace water used and lost by leaf cells, the osmotic pressure drops in the fine root hair cells (with their high surface area). This draws water into the cells and roots by osmosis. Thus, osmotic pressure is the main force driving water into plants and, defying gravity, moving it up from the roots to the rest of the plant
3. Osmosis in Animal Life
Changes in osmotic environment can stress or kill an organism. For example, freshwater organisms (protozoa or fish) placed in sea water will die. Likewise, saltwater fish placed in freshwater. But organisms can osmoregulate (control the osmotic pressure in their cells), at least to a point. Paramecium for example, expels fresh water to prevent bursting as it takes on water. This is accomplished by a contractile vacuole (shown below).
Water constantly enters these freshwater protists because the solute concentration in the cytosol is always higher than the freshwater water they live in. To cope with a constant uptake of water, their contractile vacuoles collect excess water and then contract to expel the water. At a high-energy cost, Paramecia constantly pump water out of the cell to maintain water balance (i.e., correct osmotic pressure). Another protist strategy for coping with change in environmental solute concentrations (salinity) is to pump salts (or suitable salt solute substitutes in or out of the cell, as needed (For some details, see Protist Osmoregulation Genes Acquired by Eukaryotes from Bacteria by Horizontal Gene Transfer).
Larger organisms like freshwater fish cope with their hypotonic environment by urinating a lot! At the other end of the spectrum, salt-water fish cope with the high solute concentration of solutes (salts) in their environment by excreting excess salt. Salmon spend time in seawater growing to maturity and later swim upstream in fresh water to spawn. You can imagine how salmon and similar organisms have to osmoregulate to adapt to their changing, very different environments. In this case, osmoregulation begins when hormonal changes respond to changes in living circumstance and dictate a compensatory response.
4. Summing Up
Osmosis is the movement of water across membranes to where solutes are at high concentration. At the same time, solutes that can diffuse across membranes move in or out of cells towards where they are at lower concentration, either passively, or by facilitated diffusion. We have evolved different facilitated transport proteins specific for different proteins. Finally, most water crosses membranes by facilitated diffusion through aquaporin proteins that serve as pores in cellular membranes.
294 Osmosis
D. Active Transport
Excitability (adaptation) is another of the defining properties of life. This property of all cells is based on chemical and electrical reactivity. Neurotransmitters released at a synapse cross the synaptic cleft from a “sending” neuron to a responding cell (another neuron or a muscle cell). The neurotransmitter binds to receptors on the responding cell resulting in a membrane depolarization, a rapid change in the electrical potential difference across the cell membrane. While responses to neurotransmitters occur in fractions of a second, all cells are responsive, albeit not always as fast as neurons or muscle cells. Changes in membrane polarity of any cell depend on unequal concentrations of ions inside and outside cells. Cells at rest typically have a higher [K+] in the cytosol and higher [Cl-] and [Na+] outside the cell (below).
These ionic differences across membranes are what enable such cells as neurons and muscle to respond to chemical and other (e.g., electrical) signals. Thus, cells have a resting potential, shown here with plus and minus signs on opposite sides of the membrane. The measured resting potential (difference in charge or potential difference) of most cells is typically between -50mv to -70mv. Disturbance of the resting potential (i.e., membrane depolarization), results from a flow of ions across membranes. Resting potentials sustained by ion gradients permit physiological response to chemical or other signals.
Resting potentials change when cells are excited, as well as by normal, but non-functional ion leakage. Whether incidental or intentional, the correct ion balance must be restored and maintained. This is accomplished by the active transport of ions across the membrane. This energetically unfavorable process requires an input of free energy, typically from ATP hydrolysis. The Na+/K+ pump is an active transport protein complex linked to ATPase activity. Next, we consider ion flow during cell excitation and how ion pumps work.
Let’s begin by looking at the allosteric changes that occur when the Na+ /K+ pump works to restore and maintain ion gradients (illustrated on the next page). In operation, the ATPase domain of the Na+ /K+ pump hydrolyzes ATP, leaving a phosphate attached to the pump and inducing the first of several allosteric changes in the pump proteins (No. 1, above). In its new conformation, the pump binds three Na+ ions, causing a second conformational change that in turn releases the Na+ ions into the extracellular fluid (No. 2). The release of Na+ ions outside the cell causes a third allosteric change (No. 3), after which two K+ ions from the extracellular fluid are able to bind to the pump protein. K+ binding causes the hydrolysis of the phosphate from the pump protein, returning the pump proteins to their original conformation (No. 4) and releasing the two K+ ions into the cytosol. The Na+ /K+ pump is ready for action again!
295 Potassium Leakage Helps to Maintain Cellular Resting Potentials
296 Active Transport by the Sodium/Potassium Pump
For his discovery of the ATPase-powered sodium/potassium pump and and his studies of how it works to maintain intracellular ion balance, Jens C. Skou earned a share of the Nobel Prize in Chemistry 1997. You can read more about Jens C. Skou at https://www.nobelprize.org/prizes/chemistry/1997/skou/auto-biography/ | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/17%3A_Membrane_Function/17.02%3A_Membrane_Transport.txt |
A. Measuring Ion Flow and Membrane Potential
When neurotransmitters bind to their receptors, ion channels in responding neuron or muscle cells open. The resulting influx of Na+ ions disrupts the resting potential of the target cell. The effect is only transient if the membrane potential remains negative. However, if enough Na+ ions enter the cell, the membrane becomes depolarized. If the cell experiences hyperpolarization, a localized reversal of normal membrane polarity (say from –70 mV to +65mV or more) will generate an action potential. This action potential will travel like a current along the neural or muscle cell membrane, eventually triggering a physiological response, e.g., the excitation of the next nerve cell in a neuronal pathway or contraction of the muscle cell. The patch-clamp device detects specific ion flow and any the resulting change in potential difference across the membrane. Principles of patch-clamp measurement are illustrated below.
In the example above, closing the switch on the power supply sends an electrical charge to the cell, opening up voltage-gated ion channel. In this case, a potassium sensor in the device detects the flow of K+ ions through the channel and out of the cell. At the same time, a volt meter registers the resulting change in membrane potential.
297 A Patch Clamp Device Can Record Membrane Potential and Ion Flow
298 Patch Clamp Measures Resting Potential and Depolarization
In addition to voltage-gated ion channels, the patch clamp device can measure ion flow through ligand-gated ion channels and mechanically-gated ion channels.
The former channels are receptor-ion gates that open when they bind an effector molecule. Mechanically-gated ion channels detect physical pressure or stress that result in a local membrane deformation, opening the channel.
299 Gated Ion Channels
300 Types of Gated Ion Channels-Illustrated
Finally, cells maintain a high intracellular concentration of K+ ions, causing K+ ions to slowly leak from the cell, a phenomenon detectable by a patch-clamp. The presence of negative ions (Clions, organic ions) inside a cell limits the leakage. This creates the electronegative interior of a cell relative to outside the cell, i.e., the resting potential across its plasma membrane. The patch-clamp technique has been used to correlate the flow of ions and changes in membrane potential when a neuron fires, causing an action potential in a responding cell.
Such a correlation is described on the next page. In the illustration, follow the opening and closing of ion channels and the flow of ions. An action potential (in fact any shift from resting potential) results from facilitated diffusion of specific ions into or out of the cell through gated ion channels (green, above) that must open and close in sequence. The behavior of two different voltage-gated ion channels are illustrated in the graph. Electrical stimulation opens Na+ channels. Na+ ions rush into the cell, reducing the membrane potential from the resting state to zero, or even making the cytoplasm more positive than the extracellular fluid. If the reversal in polarity is high enough, a voltagegated K+ opens and potassium ions rush into the cell, restoring the resting potential of the cell.
A cell can continue to respond to stimuli with action potentials for as long as there is sufficient Na+ outside the cell and K+ inside the cell. While active transport of Na+ and K+ is not required to re-establish the resting potential, it will eventually be necessary to restore the balance of the two ions in the cell. If a nerve or muscle cell fires several times (or even if it just leaks ions), the [K+] inside the cell and the [Na+] outside the cell would drop to a point where the cell cannot generate an action potential when stimulated. Ultimately, it is the role of ATP-dependent Na+/K+ pumps to restore the appropriate Na+:K + balance across the responding cell membrane. As we have seen, each cycle of pumping exchanges 3 Na+ ions from the intracellular space for 2 K+ ions from the extracellular space. The pump has two effects:
• It restores Na+ concentrations in the extracellular space relative to the cytoplasm.
• It restores K+ concentrations in the cytoplasm relative to the extracellular space.
301 Gated Ion Channels Open and Close in Order During an Action Potential
Together with the higher negative ion concentrations in the cytosol, the unequal exchange of Na+ for K+ ions maintains the resting potential of the cell over the long term and ensures that nerve and muscle cells remain excitable. Next, we will take a closer look at the role of both ligand-gated and voltage-gated ion channels in neurotransmission.
B. Ion Channels in Neurotransmission
Action potentials result in an orderly, sequential opening and closing of voltage- and ligand-gated channels along the neuronal axon. In the link below, you can see the sequential cycling of voltage-gated channels that propagates a localized action potential (membrane depolarization) along an axon towards a synapse.
302 Propogating an Action Potential Along an Axon
When a propagated depolarization reaches a synapse, gated ion channels either open or close in the neuron and the responding cell. The cooperation of voltage- and ligand-gated channels at a neuromuscular junction is illustrated below.
As you can see from the illustration, after a neuron fires, an electrical impulse (a moving region of hyperpolarization) travels down the axon to the nerve ending. At the nerve ending, the traveling charge difference (electrical potential) across the cell membrane stimulates a Ca++ -specific voltage-gated channel to open. Ca++ ions then flow into the cell because they are at higher concentrations in the synaptic cleft than in the cytoplasm.
The Ca2+ ions in the cell cause synaptic vesicles to fuse with the membrane at the nerve ending, releasing neurotransmitters into the synaptic cleft. Then, the neurotransmitters bind to a receptor on the responding cell plasma membrane. This receptor is a ligand-gated channel (also called a chemically-gated channel). Upon binding of the neurotransmitter ligand, the channel opens. The rapid diffusion of Na+ ions into the cell creates an action potential that leads to the cellular response, in this case, muscle contraction. We have already seen that K+ channels participate in restoring membrane potential after an action potential, and the role of the sodium/potassium pump in restoring the cellular Na+/K+ balance.
303 The Role of Gated Ion Channels at Neuromuscular Junction | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/17%3A_Membrane_Function/17.03%3A_Ligand_and_Voltage_Gated_Channels_in_Neurotransmission.txt |
Endocytosis is a mechanism for internalizing large extracellular molecules (e.g., proteins), insoluble particles, or even microorganisms. The three main types of exocytosis are phagocytosis, pinocytosis and receptor-mediated endocytosis. Pinocytosis is non-specific. Phagocytosis targets large structures (e.g., bacteria, food particles…) and is not particularly specific. As its name suggests, receptor-mediated endocytosis is specific for substances recognized by a cell-surface receptor. Exocytosis is typically the secretion of large molecules. These could be proteins and glycoproteins like digestive enzymes and many peptide/polypeptide hormones, each of which must exit the cell to either the extracellular fluid or circulation. Exocytotic pathways also deliver membrane proteins made in cells to the cell surface.
A. Endocytosis
Different forms of endocytosis are illustrated on the next page.
1. Phagocytosis (above left): phagocytes extend pseudopodia by membrane evagination. The pseudopodia of amoeba (and amoeboid cells generally) engulf particles of food that end up in digestive vesicles (phagosomes) inside the cytosol. Phagocytes are a class of white blood cells that are part of our immune system. They engulf foreign particles that must be eliminated from the body. A lysosome fuses with the phagosome, after which stored hydrolytic enzyme are activated. The result is the digestion of the engulfed particles. Phagocytosis begins upon contact between the outer cell surface and those particles. The main kinds of endocytosis are phagocytosis, pinocytosis and receptor-mediated endocytosis, shown below.
2. Pinocytosis (above center): pinocytosis is a non-specific, more or less constant pinching off of small vesicles that engulf extracellular fluid containing solutes; they are too small to include significant particulates.
3. Receptor-mediated endocytosis (above right): this kind of endocytosis relies on the affinity of receptors for specific extracellular substances. Upon binding their ligands, the receptors aggregate in differentiated regions of cell membrane called coated pits. The coated pits then invaginate and pinch off, forming a coated vesicle, thereby bringing their extracellular contents into the cell. After the coated vesicles deliver their contents to their cellular destinations, the vesicle membranes are recycled to the plasma membrane. Receptor-mediated endocytosis is perhaps the best understood mechanism for bringing larger substances into cells. The drawings below are taken from a series of electron micrographs that illustrates the invagination of coated pits to form clathrin-coated vesicles. The receptor and coat proteins are clearly visible as larger structures on the inner surfaces of the pits and on the outer surfaces of the clathrin-coated vesicles.
Watch fluorescently labeled proteins enter cells by receptor-mediated endocytosis live by following the bright spots in the video loop at Receptor-mediated endocytosis. Clathrin, a large protein, is the principal protein on the surface of the invaginated coated pit. Clathrin is linked to specific integral membrane proteins via adaptor protein 1 (AP1). AP1 recruits specific cargo proteins to bring into the cell when the coated pits invaginate. Some details of receptor-mediated endocytosis are illustrated below.
In the illustration, substances to be internalized have bound to their cell membrane receptors. The receptors then cluster to form a coated pit. Assisted by the protein dynamin (a GTPase), the coated pits invaginate. The final pinch-off of a coated vesicle requires GTP hydrolysis (not shown).
Once internalized, the coated vesicles lose their clathrin and associated adaptor protein coat. The uncoated vesicle fuses with an early endosome to form a sorting vesicle (i.e., late endosome). Sorting vesicles separate imported content from the receptors that are recycled to the membrane. In the vesicle that remains, now a lysosome, digestive enzymes catalyze hydrolysis of the vesicle contents. The digest products are then released for cellular use.
A well-known example of receptor-mediated endocytosis is the uptake of cholesterol bound to low density lipoprotein (LDL), a complex of phospholipid, protein and cholesterol illustrated below.
A single LDL complex carries as many as 15,000 molecules of cholesterol. LDL, sometimes called “bad cholesterol”, is not good for you at high levels. On the other hand, high-density lipoprotein (HDL) is “good cholesterol”. As one gets older, it is important to monitor one’s HDL/LDL ratio; the higher it is the better!
B. Exocytosis
Maintaining cell size or volume seems to be a built-in component of the machinery of receptor-mediated endocytosis that balances endocytosis with membrane recycling. However, exocytosis is also necessary to restore plasma membrane internalized by pinocytosis and phagocytosis, and for eliminating cellular waste products. Exocytosis is also the end-point of a complex process of packaging proteins destined for secretion or for insertion into the membrane themselves. The pathways of exocytosis and endocytosis share common features, as illustrated on the next page.
Note that the formation of both lysosomes and secretion vesicles begins in the rough endoplasmic reticulum, followed by passage and maturation through Golgi vesicles. While endocytotic vesicles and secretion vesicles form in ‘opposite directions’, they both share common structural features with the plasma membrane, from which they are derived and with which they fuse (respectively).
The table on the next page lists some representative proteins packaged for secretion or destined to live in cell membranes.
Hormones Immune System Proteins Neurotransmitters Other
Insulin IgG (immunoglobulin G, a class of circulating antibodies) acetylcholine EGF (Epidermal growth factor)
Growth Hormone IgM and other cell membrane antibodies NGF (neural growth factor)
FSH (follicle stimulating hormone) MHC (major histocompatability complex) proteins on cell surfaces dopamine, adrenaline, noradrenaline & other monoamines Fibrinogen (& other blood clotting factors)
Oxytocin serotonin Fibronectin (and other extracellular matrix proteins)
Prolactin some amino acids (glutamate, aspartate, glycine) Plant cell wall components
ACTH (adrenocorticotropic hormone) Trypsin, pepsin, et al. (digestive enzymes of the gut)
As we have seen, many secretory and membrane proteins are glycoproteins, to which sugars are covalently attached starting in the rough endoplasmic reticulum. As we have also seen, their glycosylation begins in the RER. Check the link below to see the process again.
291 The Path to Sugar Coated Cells
Individual cells often produce more than a few packaged proteins at the same time, requiring the sorting of each protein to its correct destination – extracellular fluids, lysosomes, peroxisomes and other ‘microbodies’, and of course, membranes themselves. Next we consider how cells target proteins to their different intracellular and extracellular destinations. | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/17%3A_Membrane_Function/17.04%3A_Endocytosis_and_Exocytosis.txt |
Each polypeptide protein translated by ribosomes from a sequence of bases in an mRNA has a specific functional location, either in the cytoplasm, on cellular membranes, inside organelles or in extracellular fluids. In this section we consider the movement and sorting of proteins in the endomembrane system as well as the transport of proteins into and out of organelles
A. Packaging Proteins in the RER
All protein synthesis begins in the same way, with the formation of an initiation complex and subsequent elongation cycles peptide bond formation and carboxylterminal amino acid addition. However, secretory proteins and those destined for lysosomes, peroxisomes or other microbodies, complete elongation directly into cisternae, or spaces enclosed by the rough endoplasmic reticulum (RER). It is possible to isolate and purify proteins secreted by cultured cells. A good model system for studying secretory protein synthesis turn out to be mouse myeloma cells.
Mouse myeloma cells were isolated and grown in culture, where they synthesize an IgG light chain, a polypeptide that is part of a mouse immunoglobulin molecule. Immunoglobulins are assembled from light and heavy chain polypeptides and secreted into the circulation. There they serve as circulating antibodies of the vertebrate immune system. Mouse myeloma cells are cancer cells that have lost the ability to make the heavy chain polypeptides. Instead, they secrete mostly the IgG light chain, making it easy to purify it from the cell culture medium. An early experiment revealed that secreted polypeptides made in an in vitro translation system are larger (longer) than the same polypeptides isolated from secretion fluids. This experiment is summarized on the next page.
In one part of the experiment described above, myeloma cells were grown in the presence of radioactive amino acids. The resulting radioactive IgG light chain polypeptides were isolated (follow the red arrows). mRNA separately extracted from another batch of the myeloma cells was added to a cell-free translation system containing radioactive amino acids. The radioactive polypeptide synthesized in vivo and in vitro were separated on electrophoretic gels and autoradiographed (follow the blue arrows, above).
From the autoradiograph, the mature, secreted polypeptides made in vivo had migrated faster on the gel than had those translated in vitro. The cell-free translation product was indeed, larger than the mature secreted polypeptide. To explain these results, Gunther Blobel and colleagues suggested the Signal Hypothesis, according to which secretory protein genes encode extra amino acids as a short amino-terminal signal peptide that directs a growing secretory polypeptide to the RER. To explain the smaller (i.e., shorter) length of the mature, secreted polypeptide, they further proposed that the signal peptide is only a temporary ‘traffic’ signal, removed by an RER-associated enzyme as the polypeptide crossed the RER membrane into the cisternal space.
304 Formulating the Signal Hypothesis: Early Experiments
In the test of the Signal Hypothesis (which won Blobel the 1999 Nobel Prize in Physiology or Medicine), isolated RER membranes were included with mouse myeloma cell mRNA in cell-free protein synthesis systems. Electrophoretic autoradiographs this time showed that the polypeptides made in vitro in the presence of RER were the same size as the mature, secreted polypeptides. The RER must therefore contain processing activity, i.e., a signal peptidase that removes the signal peptide! The steps of the signal hypothesis that emerged from the experiments of Blobel and his colleagues are illustrated below.
Recall that the synthesis of any protein starts with assembly of a translation initiation complex, followed by polypeptide elongation. During elongation, the growing polypeptide moves through and emerges from a channel, or groove in the large subunit. As the N-terminal signal sequence (i.e., the signal peptide) of a secretory polypeptide emerges from this groove, it interacts with the RER membrane. Beginning at the lower left of the illustration above, the steps of the process are:
1. An SRP (signal recognition particle) binds to the hydrophobic signal peptide.
2. Elongation stops until the SRP-ribosome complex finds the RER membrane.
3. The ribosome-SRP complex binds to an SRP receptor on the RER membrane.
4. The SRP detaches from the growing polypeptide chain, to be recycled.
5. Translation elongation resumes through a translocation channel; a signal peptidase in the RER membrane catalyzes co-translational hydrolysis of the signal peptide, which remains embedded in the RER membrane.
6. Elongation continues and the growing polypeptide begins to fold in the RER.
305 Testing the Signal Hypothesis
306 Details of the Signal Hypothesis
Step 2 above requires that the SRP find and bind to the signal peptide before the nascent polypeptide gets too long and starts to fold into a 3D (tertiary) conformation. It turns out the ribosome itself may keep the signal peptide available by destabilizing electrostatic interactions that would otherwise lead to folding and an undoubtedly incorrect conformation. For more on ribosome involvement in protein folding, check out the link at Protein Folding-Destabilizing One Protein Strand at a Time.
The secretory mechanism just described for eukaryotes has its counterpart in bacteria, which secrete proteins that assist in nutrient scavenging as well as cell wall synthesis. Partially elongated signal peptides guide mRNA-bound ribosomes to the cytoplasmic side of the plasma membrane, where the ribosomes bind and then pass elongating proteins through the plasma membrane into the space between the cell membrane and wall. As the protein exits the cell, a bacterial signal peptidase (SPase) cleaves the signal peptide. Apparently, the mechanism for the secretion of proteins evolved early and since been conserved. As we will see, this mechanism has been further coopted by eukaryotes for packaging proteins into some organelles and into membranes themselves. Some interesting speculations on the evolution of the protein packaging pathway are discussed in the link below.
307 Destinations of Protein Traffic and Evolution of Pathways
Early on, we discovered that antibiotics stop bacterial growth either by disrupting the cell wall or otherwise killing the cells outright. We now know that some antibiotics (e.g., arylomycins) disrupt plasma membrane SPase function, preventing proteins required in the space between the cell wall and membrane from ever making it out of the cell. Once used against Staphylococcus aurease, arylomycins are no longer effective because many strains have become resistant to these antibiotics (click Bacterial Signal Peptidase and Antibiotic Resistance to read about the mechanism of arylomycin resistance). As you may already know, S. aurease is now resistant to many antibiotics, and illness from untreatable infections has its own name, MRSA (Methicillin-Resistant Staph Aurease - dig on your own to see more about methicillin resistance). While named for methicillin resistance, MRSA now describes nearly untreatable S. aurease infections.
B. Synthesis of Membrane-Spanning (Integral) Proteins
N-terminal signal sequences also guide ribosomes translating integral membrane proteins to the RER. However, before such a protein can pass completely through the membrane, a stop-transfer sequence (a hydrophobic domain within the polypeptide chain) traps the protein in the fatty acid interior of the membrane. Multiple stoptransfer sequences account for transmembrane proteins that span a membrane more than once (below).
308 Integral Membrane Proteins Hae Stop Transfer Sequences
C. Moving and Sorting Packaged Proteins to Their Final Destination
Like proteins packaged in RER, those made in the cytoplasm go to different destinations before they become functional. Let’s look at the sorting mechanisms for proteins sequestered by the endomembrane system and those made in the cytoplasm.
1. Traffic on the Endomembrane Highway
We have already seen that, once packaged in the RER cisternae, proteins begin post-translational modification (by e.g., ‘core glycosylation’). Transport vesicles that bud off from the RER carry packaged and membrane proteins to the cis vesicles of the Golgi apparatus. There, vesicle fusion is mediated by the recognition of complementary integral membrane proteins embedded in the two membranes. Later, such packaged proteins are sorted to different organelles or to the plasma membrane. Sorting starts as proteins move from the cis to the trans face of the Golgi vesicles, where specific sorting proteins associate with different packaged proteins in the trans Golgi vesicles. The packaged proteins then sort to vesicles that bud off from trans Golgi stacks. These vesicles move to their final destinations, recognizing and fusing with appropriate membranes. Some events of protein trafficking are animated at Events in Protein Trafficking and summarized in the illustration on the next page.
James E. Rothman, Randy W. Schekman and Thomas C. Südhof won the 2013 Nobel Prize in Physiology or Medicine for their studies of the regulation of vesicle traffic (click 2013 Nobel Prize in Physiology or Medicine for more information). Let’s follow some proteins in and on RER membranes through the cell:
• Transition vesicles carrying their mix of packaged proteins bud off from the RER with the help of COPI and COPII coat proteins, and dissociate from the ribosomes originally attached to them. Transition vesicles however, remain associated with the COP proteins.
• These vesicles fuse with the cis Golgi vesicles, a process also mediated by COP proteins. COPI proteins detach during or after fusion, to be recycled back to the RER .
• Packaged proteins and membrane proteins are further processed as the pass through the Golgi vesicle stack, for example undergoing terminal glycosylation.
• At the trans face of the Golgi vesicles, cargo receptor proteins in the membranes to bind specific packaged proteins (now called cargo proteins). With the help of clathrin and other COP proteins, cargo protein-bound receptor proteins bud off from the trans Golgi stack. However this time, specific cargo proteins sort to separate vesicles with different cellular or extracellular destinations. These budding vesicles also acquire membrane V-SNARE (for vesicle-SNARE) proteins.
• When V-SNARE proteins on their vesicles bind to complementary T-SNARE (for target-SNARE) proteins on receiving membranes, the membranes fuse.
• Some vesicles follow this pathway, fusing with lysosomes or similar vesicles to stock them with appropriate enzymes and other protein content. Coat proteins come off the fusing vesicle and are recycled, while vesicle contents are transferred into the next vesicle.
• Vesicles containing secretory proteins typically fuse to form larger secretory vesicles. Secretory vesicles can be stored until the cells are signaled to release their contents from the cell. At that point, secretion vesicles fuse with the plasma membrane, releasing their contents to the extracellular fluid. Once again, coat proteins and clathrin dissociate from the secretory vesicle during fusion.
Other players have been left out of this discussion, notably those that hydrolyze nucleotide triphosphates to provide the energy for this protein trafficking. In addition, you might recognize other molecular players such as clathrin that play a role receptor-mediated endocytosis. Maybe that’s not a surprise! After all, endocytosis is, at least partly, molecular traffic in the opposite direction of vesicle formation and secretion.
2. Nuclear Protein Traffic
Almost all proteins are encoded in the nucleus and translated in the cytosol. These include most of those found in nucleus itself, as well as in mitochondria and chloroplasts (see the Endosymbiotic Hypothesis for a description of intraorganelle gene expression). Proteins synthesized in the cytosol destined for these organelles contain oligopeptide traffic signals that direct them to their appropriate destinations. We saw earlier that large molecules (mRNAs, tRNAs) and even whole particles (i.e., ribosomal subunits) cross the nuclear envelope through nuclear pores.
As for proteins headed for the nucleus, nuclear localization signals rich in positively charged amino acids (lysine, proline) enable binding to the negatively charged domain of a nuclear transport receptor protein in the cytosol. This process is illustrated below.
As the complex of the two proteins approach a nuclear pore, it interacts with nuclear pore fibrils, causing the pore to open. The two bound proteins then cross the double membrane of the nuclear envelope where they accumulate against a concentration gradient. This active transport comes from ATP hydrolysis as the nuclear proteins enter the nucleus.
3. Mitochondrial Protein Traffic
Recall that mitochondria contain their own genome and translational machinery. Thus, they transcribe RNAs and translating proteins of their own. However, genes in the nucleus encode many of the proteins found in mitochondria. Import of these proteins into mitochondria is illustrated below.
Unlike the co-translational packaging of proteins by the RER, mitochondrial protein transfer is post-translational. This means that mitochondrial proteins formed in the cytoplasm have already folded, assuming a tertiary structure. However, the folded protein exposes an N-terminal signal peptide on its surface that recognizes and binds to a receptor protein at the outer mitochondrial membrane. The receptor protein spans both the mitochondrial outer membrane (OM) and cristal membrane (CM).
The receptor protein delivers the protein to membrane contact proteins that also span both mitochondrial membranes. The membrane contact proteins acts as a channel, or pore, through which the mitochondrial protein will cross into the mitochondrial matrix.
But there is a problem: the folded protein cannot cross the membrane by itself! The entry of a completed mitochondrial protein in the cytoplasm requires a so-called chaperone protein, in this case the HSP70 (heat-shock 70) protein. HSP70 controls unfolding of the mitochondrial protein as it passes into the matrix. Upon removal of the signal peptide by a mitochondrial signal peptidase, another HSP70 molecule resident in the mitochondrion facilitates refolding of the protein into a biologically active shape. Recall that HSPs were initially discovered in heat
309 Protein Traffic to Nuclei and How They Communicate | textbooks/bio/Cell_and_Molecular_Biology/Book%3A_Basic_Cell_and_Molecular_Biology_(Bergtrom)/17%3A_Membrane_Function/17.05%3A_Directing_the_Traffic_of_Proteins_in_Cells.txt |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.