text
stringlengths 226
34.5k
|
|---|
Google App Engine Guestbook application gives error
Question: I upload the Google App Engine application which is at the url
developers.google.com/appengine/docs/python/memcache/usingmemcache#Memcache
When I run the application on Google App Engine Launcher, it runs but the
website shows: (First error is there us no Python "PIL" module but I am not
using image. Could you please suggest what is causing the error?
*** Running dev_appserver with the following flags:
--skip_sdk_update_check=yes --port=13080 --admin_port=8005
Python command: /usr/bin/python2.7
INFO 2014-01-17 20:43:22,217 devappserver2.py:660] Skipping SDK update check.
WARNING 2014-01-17 20:43:22,222 api_server.py:331] Could not initialize images API; you are likely missing the Python "PIL" module.
INFO 2014-01-17 20:43:22,226 api_server.py:138] Starting API server at: localhost:55385
INFO 2014-01-17 20:43:22,230 dispatcher.py:171] Starting module "default" running at: localhost:13080
INFO 2014-01-17 20:43:22,238 admin_server.py:117] Starting admin server at: localhost:8005
ERROR 2014-01-17 20:43:24,601 wsgi.py:262]
Traceback (most recent call last):
File "/Users/Desktop/GoogleAppEngineLauncher.app/Contents/Resources/GoogleAppEngine-default.bundle/Contents/Resources/google_appengine/google/appengine/runtime/wsgi.py", line 239, in Handle
handler = _config_handle.add_wsgi_middleware(self._LoadHandler())
File "/Users/Desktop/GoogleAppEngineLauncher.app/Contents/Resources/GoogleAppEngine-default.bundle/Contents/Resources/google_appengine/google/appengine/runtime/wsgi.py", line 301, in _LoadHandler
raise err
ImportError: <module 'guestbookw2' from '/Users/guestbookw2/guestbookw2.pyc'> has no attribute application
INFO 2014-01-17 20:43:24,607 module.py:617] default: "GET / HTTP/1.1" 500 -
ERROR 2014-01-17 20:43:24,727 wsgi.py:262]
Traceback (most recent call last):
File "/Users/Desktop/GoogleAppEngineLauncher.app/Contents/Resources/GoogleAppEngine-default.bundle/Contents/Resources/google_appengine/google/appengine/runtime/wsgi.py", line 239, in Handle
handler = _config_handle.add_wsgi_middleware(self._LoadHandler())
File "/Users/Desktop/GoogleAppEngineLauncher.app/Contents/Resources/GoogleAppEngine-default.bundle/Contents/Resources/google_appengine/google/appengine/runtime/wsgi.py", line 301, in _LoadHandler
raise err
ImportError: <module 'guestbookw12' from '/Users/guestbookw2/guestbookw2.pyc'> has no attribute application
INFO 2014-01-17 20:43:24,732 module.py:617] default: "GET /favicon.ico HTTP/1.1" 500 -
Answer: Make sure that you have the following files in the path that you are uploading
your application from:
1. **index.yaml** (auto-generated; you don't need to add or change anything in here at this point).
2. **favicon.ico** (in the correct format; should be 16x16 or 32x32 pixels if I remember correctly).
3. **main.py** (mapping all the paths in your web-site; example given below):
from webapp2 import WSGIApplication
from Server import MainRequestHandler
from Server import SomeRequestHandler
from Server import OtherRequestHandler
app = WSGIApplication([
('/' ,MainRequestHandler),
('/abc' ,SomeRequestHandler),
('/def' ,SomeRequestHandler),
('/xyz' ,OtherRequestHandler),
])
4. **app.yaml** (with the following contents; using `<...>` where you need to set a value):
application: <the app-id you chose when use signed in for GAE>
version: 1
runtime: python27
api_version: 1
threadsafe: yes
handlers:
- url: /favicon\.ico
static_files: favicon.ico
upload: favicon\.ico
- url: .*
script: main.app
libraries:
- name: webapp2
version: "2.5.1" // you might need to change this as well
**Note** :
if you wish to avoid handling 'favicon.ico' request, then you must remove the
reference in file 'app.yaml'.
**Supplemental** :
You will need to implement all the request handlers imported in 'main.py'.
In the example above, 'main.py' expects to find them in a Python module named
'Server'.
Each request handler must inherit `class RequestHandler`, imported from
`webapp2`.
**Supplemental #2** :
In order to solve the 'PIL' issue (had a similar problem if memory serves
correctly), simply install it.
From a Windows command line, enter: pip install pil.
|
Mutable objects in python and constants
Question: I have a class which contains data as attributes and which has a method to
return a tuple containing these attributes:
class myclass(object):
def __init__(self,a,b,c):
self.a = a
self.b = b
self.c = c
def tuple(self):
return (self.a, self.b, self.c)
I use this class essentially as a tuple where the items (attributes) can be
modified/read through their attribute name. Now I would like to create objects
of this class, which would be constants and have pre-defined attribute values,
which I could then assign to a variable/mutable object, thereby initializing
this variable object's attributes to match the constant object, while at the
same time retaining the ability to modify the attributes' values. For example
I would like to do this:
constant_object = myclass(1,2,3)
variable_object = constant_object
variable_object.a = 999
Now of course this doesn't work in python, so I am wondering what is the best
way to get this kind of functionality?
Answer:
import copy
class myclass(object):
def __init__(self,a,b,c):
self.a = a
self.b = b
self.c = c
def tuple(self):
return (self.a, self.b, self.c)
constant_object = myclass(1,2,3)
variable_object = copy.deepcopy(constant_object)
variable_object.a = 999
print constant_object.a
print variable_object.a
Output:
1
999
|
parsing MySQL database with python MySQLdb to extract hashtags
Question: I have tweets scraped in MySQL database and I manage to connect to it and
query for column that contains tweets' text. Now what I want to do is parse
this and extract hashtags into a csv file.
So far, I have this code that is working until the last loop:
import re
import MySQLdb
# connects to database
mydb = MySQLdb.connect(host='****',
user='****',
passwd='****',
db='****')
cursor = mydb.cursor()
# queries for column with tweets text
getdata = 'SELECT text FROM bitscrape'
cursor.execute(getdata)
results = cursor.fetchall()
for i in results:
hashtags = re.findall(r"#(\w+)", i)
print hashtags
I get the following error: TypeError: expected string or buffer. And the
problem is in line hashtags = re.findall(r"#(\w+)", i).
Any suggestions?
Thanks!
Answer: `cursor.fetchall()` returns a list of **tuples**. Take the first element from
each row and pass it to `findall()`:
for row in results:
hashtags = re.findall(r"#(\w+)", row[0])
Hope that helps.
|
Importing module from relative path
Question: I'm looking for some advice on a python issue I am having. I am a novice at
python. I believe that I am relying on my programming experience from other
languages to make this work and I have finally come to a stand-still. Here is
the scenario, I am importing a module that relies on another module.
My driver for the program, called test.py, starts out like this:
import sys
sys.path.append(r'C:\Program Files (x86)\Zorba XQuery Processor 2.9.1\share\zorba\uris\com\nuemeta\www\modules\DDEXpedite\bindings\Python\Code and Other Files')
import QueryDDEX
Then in the QueryDDEX.py file I have:
import sys,os
temp = os.getcwd()
os.chdir(os.path.dirname(os.path.realpath(__file__)))
sys.path.append(os.path.realpath("..\..\..\..\..\..\..\..\..\python"))
print sys.path
import zorba_api
os.chdir(temp)
In my head I was thinking (1)Save the current working directory, (2)Change the
current working directory to the directory of the QueryDDEX.py module, (3)
import the zorba_api module from a relative path because if I deploy this
module to other computers they may not have the same file structure as mine,
and (4) change the current working directory back to what it was initially.
Now, I have read that it is not okay to use relative paths and I have also
read that it is okay. I do not see another choice because I did not write the
zorba_api so I do not have too much control over it. Anyway, the output of the
program is this:
['C:\\Users\\Administrator\\Desktop', 'C:\\Python27\\Lib\\idlelib', 'C:\\Windows\\SYSTEM32\\python27.zip', 'C:\\Python27\\DLLs', 'C:\\Python27\\lib', 'C:\\Python27\\lib\\plat-win', 'C:\\Python27\\lib\\lib-tk', 'C:\\Python27', 'C:\\Python27\\lib\\site-packages', 'C:\\Program Files (x86)\\Zorba XQuery Processor 2.9.1\\share\\zorba\\uris\\com\\nuemeta\\www\\modules\\DDEXpedite\\bindings\\Python\\Code and Other Files', 'C:\\Program Files (x86)\\Zorba XQuery Processor 2.9.1\\share\\zorba\\python']
Traceback (most recent call last):
File "C:\Users\Administrator\Desktop\Test.py", line 4, in <module>
import QueryDDEX
File "C:\Program Files (x86)\Zorba XQuery Processor 2.9.1\share\zorba\uris\com\nuemeta\www\modules\DDEXpedite\bindings\Python\Code and Other Files\QueryDDEX.py", line 9, in <module>
import zorba_api
ImportError: No module named zorba_api
This is where things get tricky in my opinion, the zorba_api module is located
at
C:\\Program Files (x86)\\Zorba XQuery Processor 2.9.1\\share\\zorba\\python
and we can see by my debug statement that it IS in the python class path. So
why am I getting this error?
Answer: Check out this scenario. You have the file `alpha.py` at `C:\projects\test\`.
Then you also have a file called `beta.py` at `C:\projects\test\modules\` so
to import `beta` from `alpha` you should do:
import modules.beta
Or, not very good but useful, adding the `modules` directory to your
`sys.path`.
Then if you want to import modules from your `beta.py` file you will have to
take care that you're not at `C:\projects\test\modules\` directory, you're in
the `alpha.py` directory. So for example, if there's a third file called
`gamma.py` at `modules/`, if you want to import it from `beta.py` you should
use:
import modules.gamma
Because you are at the _importer file_ (`alpha.py`) path, not at the _imported
file_ (`beta.py`) path.
Hope it helps to solve your problem!
|
Pass a file as a parameter in two Python Scripts
Question: New Python'er has a question _"hand raised"_.
I have two Python Scripts and a XML file. "mysecondpython.py" needs to call
"myfirstpython.py" with a parameter of "data.xml" so that it can write
something in, which then returns a file.
From command-line, I should type `python mysecondpython.py` and it should be
viola! But I got no cigars. What is this new python'er doing wrong?
**myfirstpython.py**
import xml.etreeElementTree as et
def allmytrees(file):
dest_tree = et.parse(file)
dest_root = dest_tree.getroot()
def inserter():
dest_root.insert(0, "hello world")
def printer():
dest_tree.write('out.xml', xml_declaration=True, encoding='utf-8')
if __name__ == "__main__":
allmytrees(file)
inserter()
printer()
**mysecondpython.py**
import myfirstpython
def callingscripts(file)
callpython = myfirstpython(file)
if __name__ == "__main__":
file = "data.xml"
callingscripts(file)
**data.xml**
<root>
<nothing-here>123</nothing-here>
</root>
_I'm in tears._
Answer: When you import a file, it's `__name__` does not `== "__main__"`.
In fact, the statement `if __name__ == "__main__":` is specifically designed
to say "am I the program that is running, or am I being imported (in which
case don't do this stuff)"
You need to write a function in myfirstpython.py, and call it from
mysecondpython.py
|
Matplotlib + Ubuntu + GTK3 no plot shown
Question: I can see the GUI but not the plot. No errors, even the mouse coordinates are
okay, but no plot using
import matplotlib.pyplot as plt
plt.plot([1,2,3,4])
plt.ylabel('some numbers')
plt.show()
Then
$ python -c 'import matplotlib; import matplotlib.pyplot; print(matplotlib.backends.backend)'
GTK3Agg
I installed the following on Ubuntu 12.04:
sudo apt-get install python-gi
sudo apt-get install libgtk-3-devel
sudo pip install matplotlib
sudo pip install numpy
What could be the problem? Or how can I further debug this?
Answer: This is working on Ubuntu 14.04. All packages from apt:
#!/usr/bin/env python3
import gi
gi.require_version('Gtk', '3.0')
from gi.repository import Gtk
import matplotlib.pyplot as plt
plt.plot([1,2,3,4])
plt.ylabel('some numbers')
plt.show()
|
parsing JSON which contains "objects"
Question: I'm getting data from an application that returns what seems to be an JSON,
but with some "objects". For instance:
{"rgEvtData":[new VisData(0,0,1,0,1,0,0,0,0,-1),new VisData(0,1,1,1,1,0,0,0,0,-1),new VisData(0,2,1,2,1,0,0,0,0,-1),new VisData(0,3,2,0,1,0,0,0,0,-1),new VisData(0,4,2,1,1,0,0,0,0,-1),new VisData(0,5,2,2,1,0,0,0,0,-1),new VisData(0,6,2,3,1,0,0,0,0,-1),new VisData(0,7,3,0,1,0,0,0,0,-1),new VisData(0,8,3,1,1,0,0,0,0,-1)]}
any idea if I can parse it on python without dirty workarounds (ie, replace()
or regexp)?
Answer: No, you can't.
Even if python could parse it, what would it do with the `VisData`s?
I think your only option (except the stick approach mentioned), to translate
this string into valid JSON somehow. For example, replacing `new VisData(...)`
with `[...]`, or `{"class": "VisData", "args": [...]}` if you have multiple
classnames. But you said you don't want that.
**Update**
I have an example, I think it is what you need.
It handles custom classes in the format you provided. It would also handle
multiple classes and any number/type of constructor arguments.
import re
import json
# our python VisData class
class VisData(object):
def __init__(self, *args):
self.args = args
# object hook to convert our {"class":"VisData","args":[...]} dict to VisData insances
def object_hook(obj):
# if we recognize our object describer dict
if len(obj) == 2 and "class" in obj and "args" in obj:
# instantiate our classes by name
clazz = globals()[obj["class"]]
args = obj["args"]
return clazz(*args)
return obj
# input
input_string = '{"rgEvtData":[new VisData(0,0,1,0,1,0,0,0,0,-1),new VisData(0,1,1,1,1,0,0,0,0,-1)]}'
# make it json
json_string = re.sub(r'new (\w+)\(([^\)]*)\)', r'{"class":"\1","args":[\2]}', input_string)
# parse it with our object hook
data = json.loads(json_string, object_hook=object_hook)
# result
print(data) # -> {u'rgEvtData': [<__main__.VisData object at 0x1065d8210>, <__main__.VisData object at 0x1065d8250>]}
print(data["rgEvtData"][0]) # -> <__main__.VisData object at 0x1065d8210>
print(data["rgEvtData"][0].args) # -> (0, 0, 1, 0, 1, 0, 0, 0, 0, -1)
|
randomly choose from list using random.randint in python
Question: How to use `random.randint()` to select random names given in a list in
python.
I want to print 5 names from that list. Actually i know how to use
`random.randint()` for numbers. but i don't know how to select random names
from a given list.
we are not allowed to use `random.choice`.
help me please
Answer: This will not guarantee no repeats, since random.choice is better for that.
import random
names = ["A", "B", "C", "D", "E", "F", "G", "H", "I"]
print([names[random.randint(0, len(names)-1)] for i in range(5)])
|
Python: Get Twitter Trends in tweepy, and parse JSON
Question: _Ok, so please note this is my first post_
So, I am trying to use Python to get Twitter Trends, I am using python 2.7 and
Tweepy.
I would like something like this (which works):
#!/usr/bin/python
# -*- coding: utf-8 -*-
import tweepy
consumer_key = 'secret'
consumer_secret = 'secret'
access_token = 'secret'
access_token_secret = 'secret'
# OAuth process, using the keys and tokens
auth = tweepy.OAuthHandler(consumer_key, consumer_secret)
auth.set_access_token(access_token, access_token_secret)
api = tweepy.API(auth)
trends1 = api.trends_place(1)
print trends1
That gives a massive JSON string,
I would like to extract each trend name to a variable, in string format
`str(trendsname)` ideally.
Which would ideally have the names of trends like so: `trendsname =
str(trend1) + " " +str(trend2) + " "` and so on, for each of the trend names.
Please note I am only learning Python.
Answer: It looks like Tweepy deserializes the JSON for you. As such, `trends1` is just
an ordinary Python list. This being the case, you can simply do the following:
trends1 = api.trends_place(1) # from the end of your code
# trends1 is a list with only one element in it, which is a
# dict which we'll put in data.
data = trends1[0]
# grab the trends
trends = data['trends']
# grab the name from each trend
names = [trend['name'] for trend in trends]
# put all the names together with a ' ' separating them
trendsName = ' '.join(names)
print(trendsName)
Result:
#PolandNeedsWWATour #DownloadElyarFox #DünMürteciBugünHaşhaşi #GalatasaraylılıkNedir #KnowTheTruth Tameni Video Anisa Rahma Mikaeel Manado JDT
|
Calculating mean of sample in monte carlo simulation
Question: I did a Monte Carlo simulation of n samples. For each sample i, I need to
calculate the value Xi so probably, the results that I will obtain is:
> X = [X1, X2, ..., Xn]
(Here Xi can be a matrix or number).
Now I want to calculate the mean of theses samples that I call Xmean. So I
need to obtain something like this:
> Xmean = [X1, (X1+X2)/2, (X1+X2+X3)/3 ... , (X1+X2+...+Xn)/n]
In Python, I write a code:
for i in range(N):
for j in range(i+1):
Xmean(i) = Xmean(i) + X(j)
Xmean(i) = Xmean(i) / (i+1)
It works well but too slow, I would like to know if I can speed up this code?
And if you guys could suggest to me some interesting Python's library that
help for Monte Carlo simulation.
Thanks,
Answer:
import timeit, numpy
setup = '''
from __main__ import mc0, mc1, mc2
import random, numpy
random.seed(0)
n = 10**3
data = [random.randint(0, 2**32-1) for _ in range(n)]
np_data = numpy.array([float(x) for x in data])
'''
# your implementation
def mc0(data):
xmean = []
for i in range(len(data)):
xmean.append(0)
for j in range(i+1):
xmean[i] += data[j]
xmean[i] = xmean[i] / (i+1)
return xmean
# my implementation
def mc1(data):
xmean = []
for i, x in enumerate(data):
if i == 0:
new = x
else:
new = x/(i+1) + xmean[i-1] * (i/(i+1))
xmean.append(new)
return xmean
# Donbeo's numpy implementation
def mc2(data):
xmean = numpy.cumsum(data) / numpy.array(range(1, len(data)+1))
return xmean
number = 100
things = [('mc0', 'mc0(data)'),
('mc1', 'mc1(data)'),
('mc2', 'mc2(np_data)')]
for note, call in things:
print('{:20} {}'.format(note,
timeit.timeit(call, setup=setup, number=number)))
Result:
mc0 26.023956370918587
mc1 0.1423197092108488
mc2 0.13584513496654083
There's no point in redoing the sum over `x(1)..x(i)` at each loop iteration,
when you already have that information available in `xmean`. The numpy version
by Donbeo is marginally faster than the pure-Python version by me, both of
which are nearly 200 times faster (for these data, anyway) than the original
version.
|
Drawing tangent plot in Python (matplotlib)
Question: Today I decided to write simple program in Python, just to practice before
exam. Firstly, I wanted to draw sin and cos plot, which wasn't so hard. But
then, I decided to challenge myself and draw tangent plot.
import pylab as p
x= p.arange(-1.0,1.0,0.1)
y= (p.sin(2*p.pi*x)) / (p.cos(2*p.pi*x))
p.plot(x,y,'g-',lw=1)
p.show()
It returns... ugh... this:
As you can see, it looks more like ECK plot than tangent plot. Does anyone
knows what's wrong?
Answer: If you increase the number of points in `x`,
import pylab as p
import numpy as np
x = p.linspace(-1.0, 1.0, 1000)
y = (p.sin(2 * p.pi * x)) / (p.cos(2 * p.pi * x))
p.plot(x, y, 'g-', lw=1)
p.show()
you get something like this: 
Notice how large the `y-range` is getting. Matplotlib is not able to show you
much of the small values in the tangent curve because the range is so large.
The plot can be improved by ignoring the extremely large values near the
asymptotes. Using [Paul's
workaround](http://stackoverflow.com/a/2542065/190597) to handle asymptotes,
import pylab as p
import numpy as np
x = p.linspace(-1.0, 1.0, 1000)
y = (p.sin(2 * p.pi * x)) / (p.cos(2 * p.pi * x))
tol = 10
y[y > tol] = np.nan
y[y < -tol] = np.nan
p.plot(x, y, 'g-', lw=1)
p.show()
you get
|
Python-social, Django-nonrel, and GAE fighting over files, python-tk
Question: I'm trying to host a Django app on Google App Engine, so I'm using [Django
nonrel](https://github.com/django-nonrel/django) and following [these
instructions](http://www.allbuttonspressed.com/projects/djangoappengine). Now,
trying to get [Python social auth](https://github.com/omab/python-social-auth)
working on it, I'm running into two problems.
First, when working with code very similar to the [example Django
config](https://github.com/omab/python-social-
auth/tree/master/examples/django_example/example) from Python social, trying
to load a url from a running server, I get this:
Traceback (most recent call last):
File "/home/pablo/scripts/google_appengine/google/appengine/tools/dev_appserver.py", line 2989, in _HandleRequest
self._Dispatch(dispatcher, self.rfile, outfile, env_dict)
File "/home/pablo/scripts/google_appengine/google/appengine/tools/dev_appserver.py", line 2832, in _Dispatch
request_file = open(request_file_name, 'wb')
File "/home/pablo/scripts/google_appengine/google/appengine/dev_appserver_import_hook.py", line 605, in __init__
raise IOError('invalid mode: %s' % mode)
IOError: invalid mode: wb
Somewhere, the app is trying to create local files, which App Engine doesn't
allow, but I'm confused because this is coming _from App Engine's code_. Does
anyone know where this might be coming from?
Secondly, when I try to access root on the server, I get the following error:
... [many lines elided]
File "/home/pablo/scripts/google_appengine/google/appengine/tools/dev_appserver_import_hook.py", line 692, in Decorate
return func(self, *args, **kwargs)
File "/home/pablo/scripts/google_appengine/google/appengine/tools/dev_appserver_import_hook.py", line 1642, in FindAndLoadModule
description)
File "/home/pablo/scripts/google_appengine/google/appengine/tools/dev_appserver_import_hook.py", line 692, in Decorate
return func(self, *args, **kwargs)
File "/home/pablo/scripts/google_appengine/google/appengine/tools/dev_appserver_import_hook.py", line 1589, in LoadModuleRestricted
description)
File "/usr/lib/python2.7/lib-tk/Tkinter.py", line 42, in <module>
raise ImportError, str(msg) + ', please install the python-tk package'
ImportError: No module named _tkinter, please install the python-tk package
Somewhere, Django is trying to use `python-tk` for `Tkinter`, but as I
understand it, python-tk is a GUI library. How did it get here, and how can I
get rid of any code that needs it?
For reference, here's the function getting called for the domain I'm trying in
`urls.py` when accessing the running server (and getting these errors):
def home(request):
"""Home view, displays login mechanism"""
if request.user.is_authenticated():
return redirect('done')
return render_to_response('home.html', {
'plus_id': getattr(settings, 'SOCIAL_AUTH_GOOGLE_PLUS_KEY', None)
}, RequestContext(request))
Any help would be appreciated -- I'm pretty new to Django and Python, and I'd
love to move forward from this :D
Answer: Python on Google App Engine is behaving a bit different, as you already
realised with the local files. Another thing that needs a special treatment is
the 3rd party libraries that in order to make them available, they should be
[handled properly](http://stackoverflow.com/a/14851686/8418).
In many cases, even if you're going to include these libraries into your GAE
app, they might be using something that is not supported on the production so
the whole thing is not going to work.
|
Validating SAML signature in python
Question: I need to implement authentication in python from a 3rd party by using SAML2.
I have looked into [pysaml2](https://pypi.python.org/pypi/pysaml2/1.1.0) and
found that to be quite confusing, and decided to give
[M2Crypto](https://pypi.python.org/pypi/M2Crypto) a chance after I found [this
question](http://stackoverflow.com/questions/9704919/saml-signature-
verification-using-python-m2crypto) by
[Ennael](http://stackoverflow.com/users/518959/ennael).
The SAML token I receive [can be found here](http://pastebin.com/vehrUdkB). I
have already extracted all the information I need from the `Assertion` tag
(the user's SSN, IP and the SAML tokens expiration window) but I can't get the
`verify_signature` function from Ennael (and the [revised
code](http://stackoverflow.com/questions/9704919/saml-signature-verification-
using-python-m2crypto/17372895#17372895) from [Ezra
Nugroho](http://stackoverflow.com/users/2464942/ezra-nugroho)) to return True.
I have also tried to change `verify_EVP.reset_context(md='sha1')` to
`verify_EVP.reset_context(md='sha256')` but that didn't work either.
I think my mistake must be in the signed_info part. What do I pass to
`verify_signature` for that part? Do I have to preprocess it in any way? I
have been looking into the Transform tag but don't know where too look next.
Any help will be greatly appreciated. If someone needs the XML before the
obfuscation to test and help me just PM me.
**EDIT** This is my code (very similar to the things i linked to. The main
function is at the bottom):
def verify_signature(signed_info, cert, signature):
from M2Crypto import EVP, RSA, X509, m2
x509 = X509.load_cert_string(base64.decodestring(cert), X509.FORMAT_DER)
pubkey = x509.get_pubkey().get_rsa()
verify_EVP = EVP.PKey()
verify_EVP.assign_rsa(pubkey)
verify_EVP.reset_context(md='sha1')
verify_EVP.verify_init()
verify_EVP.verify_update(signed_info)
return verify_EVP.verify_final(signature.decode('base64'))
def decode_response(resp):
return base64.b64decode(resp)
def get_xmldoc(xmlstring):
return XML(xmlstring)
def get_signature(doc):
return doc.find('{http://www.w3.org/2000/09/xmldsig#}Signature')
def get_signed_info(signature):
signed_info = signature.find(
'{http://www.w3.org/2000/09/xmldsig#}SignedInfo')
signed_info_str = tostring(signed_info)
# return parse(StringIO(signed_info_str))
return signed_info_str
def get_cert(signature):
ns = '{http://www.w3.org/2000/09/xmldsig#}'
keyinfo = signature.find('{}KeyInfo'.format(ns))
keydata = keyinfo.find('{}X509Data'.format(ns))
certelem = keydata.find('{}X509Certificate'.format(ns))
return certelem.text
def get_signature_value(signature):
return signature.find(
'{http://www.w3.org/2000/09/xmldsig#}SignatureValue').text
def parse_saml(saml):
dec_resp = decode_response(saml)
xml = get_xmldoc(dec_resp)
signature = get_signature(xml)
signed_info = get_signed_info(signature)
cert = get_cert(signature)
signature_value = get_signature_value(signature)
is_valid = verify_signature(signed_info, cert, signature_value)
**UPDATE** : Is it possible I need some more information from the 3rd party
authentication provider? Do I need a private key for any of this?
Answer: I faced the same problem, and had to develop a module for it:
<https://github.com/kislyuk/signxml>. I chose to rely only on PyCrypto and
pyOpenSSL, since M2Crypto is less popular and not well-maintained, which is a
hazard from both compatibility (e.g. PyPy) and security perspectives. I also
use lxml for the canonicalization (c14n). From the signxml docs:
from signxml import xmldsig
cert = open("example.pem").read()
key = open("example.key").read()
root = ElementTree.fromstring(data)
xmldsig(root).verify()
|
How to remove trailing `\r` in shell?
Question: I have a file that looks like this:
1 0.1951 0.1766 0.1943 0.1488
0.1594 0.2486 0.2044 0.2013 0.1859
0.1559 0.1761 0.1666 0.1737 0.1595
0.1940 1 0.2398 0.1894 0.1532
0.1749 0.2397 1 0.1654 0.1622
0.1940 0.1895 0.1659 1 0.1384
0.1489 0.1547 0.1648 0.1390 1
0.1840 0.2472 0.2256 0.2281 0.1878
Somehow it's created in windows so it has this irritating `\r` character at
the end. But I am running my shell line in linux.
In python I could have read the file and do a `line.strip('\r')` while looping
through the lines in the file. But i have to use shell to run a loop and
somehow the '\r' keep appearing.
Is there any way to remove it while in the `while` loop? I am trying to do a
loop for this script in shell:
<https://github.com/alvations/meanie/blob/master/amgm.py>:
# -*- coding: utf-8 -*-
import math, operator
def arithmetic_mean(x): # x is a list of values.
""" Returns the arithmetic mean given a list of values. """
return sum(x)/len(x)
def geometric_mean(x): # x is a list of values
""" Returns the geometric mean given a list of values. """
return math.pow(reduce(operator.mul, x, 1), 1/float(len(x)))
def arigeo_mean(x, threshold = 1e-10): # x is a list of values
arith = arithmetic_mean(x)
geo = geometric_mean(x)
while math.fabs(arith - geo) > threshold:
[arith,geo] = [(arith + geo) / 2.0, math.sqrt(arith * geo)]
return arith
def main(means):
print means
means = map(float,means)
print "arithmetic mean = ", arithmetic_mean(means)
print "geometric mean = ", geometric_mean(means)
print "arithmetic-geometric mean = ", arigeo_mean(means)
if __name__ == '__main__':
import sys
if len(sys.argv) < 2:
sys.stderr.write('Usage: python %s mean1 mean2 mean3 ... \n' % sys.argv[0])
sys.exit(1)
so I tried the following shell line to iterate through my textfile:
alvas@ubi:~/git/meanie$ while read line; do python amgm.py $line; done < out.tab
and got these errors:
['1', '0.1951', '0.1766', '0.1943', '0.1488', '\r']
Traceback (most recent call last):
File "amgm.py", line 32, in <module>
main(sys.argv[1:])
File "amgm.py", line 22, in main
means = map(float,means)
ValueError: could not convert string to float:
['0.1594', '0.2486', '0.2044', '0.2013', '0.1859', '\r']
Traceback (most recent call last):
File "amgm.py", line 32, in <module>
main(sys.argv[1:])
File "amgm.py", line 22, in main
means = map(float,means)
ValueError: could not convert string to float:
['0.1559', '0.1761', '0.1666', '0.1737', '0.1595', '\r']
Traceback (most recent call last):
File "amgm.py", line 32, in <module>
main(sys.argv[1:])
File "amgm.py", line 22, in main
means = map(float,means)
ValueError: could not convert string to float:
['0.1940', '1', '0.2398', '0.1894', '0.1532', '\r']
Traceback (most recent call last):
File "amgm.py", line 32, in <module>
main(sys.argv[1:])
File "amgm.py", line 22, in main
means = map(float,means)
ValueError: could not convert string to float:
['0.1749', '0.2397', '1', '0.1654', '0.1622', '\r']
Traceback (most recent call last):
File "amgm.py", line 32, in <module>
main(sys.argv[1:])
File "amgm.py", line 22, in main
means = map(float,means)
ValueError: could not convert string to float:
['0.1940', '0.1895', '0.1659', '1', '0.1384', '\r']
Traceback (most recent call last):
File "amgm.py", line 32, in <module>
main(sys.argv[1:])
File "amgm.py", line 22, in main
means = map(float,means)
ValueError: could not convert string to float:
['0.1489', '0.1547', '0.1648', '0.1390', '1', '\r']
Traceback (most recent call last):
File "amgm.py", line 32, in <module>
main(sys.argv[1:])
File "amgm.py", line 22, in main
means = map(float,means)
ValueError: could not convert string to float:
['0.1840', '0.2472', '0.2256', '0.2281', '0.1878', '\r']
Traceback (most recent call last):
File "amgm.py", line 32, in <module>
main(sys.argv[1:])
File "amgm.py", line 22, in main
means = map(float,means)
ValueError: could not convert string to float:
Note: I'm NOT allowed to change the python script though =(
Answer: You should be able to strip any trailing whitespace from the line before
passing it to your python program.
Consider one of the suggestions
[here](http://stackoverflow.com/questions/369758/how-to-trim-whitespace-from-
bash-variable).
If you're running bash, the second answer doesn't involve invoking an
additional program, if you're not, you may look at the the sed option if your
shell doesn't support parameter expansion.
Another option would be to use the `dos2unix` (or similar) utility that
converts the windows line ending (`\r\n`) to the unix line ending (`\n`).
Alternatively, you could get crazy and _always_ trim off the last character
irrespective of what it was with a bash parameter expansion like the one
described [here](http://www.cyberciti.biz/faq/bash-remove-last-character-from-
string-line-word/). But I would consider this the least-favorable option.
|
How to generate HTML color diff from git using python
Question: So I figured out creating HTML git diff i can embed in email but don't know
why is it all being spit in one line ?
here is how I did it!!
import sys
import subprocess
import os
from ansi2html.converter import Ansi2HTMLConverter
ansiText = os.path.expanduser('~/Desktop/colorDiff')
pr = subprocess.Popen( "git diff HEAD^ HEAD --color > "+ansiText , cwd = os.getcwd() , shell = True, stdout = subprocess.PIPE, stderr = subprocess.PIPE )
(out, error) = pr.communicate()
conv = Ansi2HTMLConverter()
ansi = ''
with open(ansiText, 'r+') as fh:
fh.readline()
for line in fh:
ansi += ''.join(line.split())
html = conv.convert(ansi)
with open("%s.html" % ansiText, 'w+') as wf:
wf.write(html)
os.remove(ansiText)
print str(error).capitalize()
maybe its too late to be awake...
Answer: figured out myself
import sys
import subprocess
import os
from ansi2html.converter import Ansi2HTMLConverter
ansiText = os.path.expanduser('~/Desktop/colorDiff')
proc = subprocess.Popen('git diff HEAD^ HEAD --color', shell=True, stdout=subprocess.PIPE, stderr = subprocess.PIPE )
diffData = proc.stdout.read()
conv = Ansi2HTMLConverter()
html = conv.convert(diffData)
with open("%s.html" % ansiText, 'w') as wf:
wf.write(html)
|
Calculate the greatest distance between any two strings in a group, using Python
Question: My question is how to calculate greatest distance between any two strings that
correspond to a certain group. Each line in my file starts with a 'group
number' followed by a long string. I want to know, for each group, what the
greatest distance between any two strings in a group, for each group. Below is
the kind of file I'm working with (the strings have been shortened). Notice
the groups aren't necessarily in order, and some of my groups only have one
string associated with them, so I would want to just skip over them (Group '3'
in the below example):
0 GCAGACGGGUGAGUAACGCGUGGGAACGUACCAUUUGCUACGGAAUAACUCAGG
0 GCAGACGGGUGAGUAACGCGUGGGAACGUACCAUUUGCUACGGAAUAACUCAGG
1 CGAACGGGUGAGUAACACGUGGGCAAUCUGCCCUGCACUCUGGGACAAGCCCUG
1 CGAACGGGUGAGUAACACGUGGGCAAUCUGCCCUGCACUCUGGGACAAGCCCUG
1 CGAACGGGUGAGUAACACGUGGGCAAUCUGCCCUGCACUCUGGGACAAGCCCUG
2 GCCCUUCGGGGUACUCGAGUGGCGAACGGGUGAGUAACACGUGGGUGAUCUGCC
2 GCCCUUCGGGGUACUCGAGUGGCGAACGGGUGAGUAACACGUGGGUGAUCUGCC
2 GCCCUUCGGGGUACUCGAGUGGCGAACGGGUGAGUAACACGUGGGUGAUCUGCC
0 GCAGACGGGUGAGUAACGCGUGGGAACGUACCAUUUGCUACGGAAUAACUCAGG
0 GCAGACGGGUGAGUAACGCGUGGGAACGUACCAUUUGCUACGGAAUAACUCAGG
3 GCAGACGGGUGAGUAACAAAAAGGAACGUACCAUUUGCUACGGAAUAACUCAGG
I want to create something that will create an output that looks something
like this:
Group0 = 0
Group1 = 1.2
Group2 = 2.1
Average = 1.1
This output would be giving me the group number and then the greatest
difference for that group. And also the overall average of the greatest
difference between all groups (again skipping over the groups with only one
string associated with them):
My real file has about 5000 groups, and the strings I'm comparing are ~400
characters long.
I think I could start solving this by looking at this
[Question](http://stackoverflow.com/questions/3106994/algorithm-to-calculate-
percent-difference-betweem-two-blobs-of-text), but I'm not sure how to only
calculate percent differences for strings in the same group, avoid groups with
only one string, and calculate the overall average percent difference for all
the groups. Any help would be greatly appreciated, thank you very much for any
ideas!
EDIT: Here are a few truncated lines from the file I'm working with. The
'group' numbers range from 0 to ~ 6000. The string of letters is actually 426
characters long. The file format is [number][a whitespace][string of
letters][end of line character]
`7 UGGCGAACGGGUGAGUAAC
35 GUGGGGAUUAGUGGCGAAC
50 AAACGAGAUGUAGCAAUAC
82 GGAGAGAGCUUGCUCUCUU
479 UCAGGAGCUUGCUCCUGU
46 CGAGGAGCUUGCUCCUUU
24 AACUGGGUCUAAUACCUU`
Answer: You could also try to use
[difflib](http://docs.python.org/2/library/difflib.html)'s SequenceMatcher
from the standard library:
>>> import difflib
>>> from itertools import groupby, combinations
>>> def find_max_ratio(lines):
lines = [row.split() for row in lines] # the file should already break at each line break
lines = [(int(row[0]), row[1]) for row in lines]
lines = groupby(sorted(lines), lambda x: x[0]) # combine strings into their respective groups, sorting them first on int of first element
group_max = dict()
for group in lines:
strings = list(group[1]) # need to convert group[1] from iterator into list
if len(strings) > 1: # if the number of strings is 1, then there is nothing to compare the string with in its group
similarity = 1
for line1, line2 in combinations(strings, 2):
s = difflib.SequenceMatcher(None, line1[1], line2[1]) # need to compare second element in each list and exclude the first element (which is the group number)
similarity = s.ratio() if s.ratio() < similarity else similarity
group_max[line1[0]] = 1 - similarity # gives difference ratio
return group_max
>>> t = open('test.txt')
>>> print find_max_ratio(t) # it appears that your examples don't have any differences
{'1': 0, '0': 0, '2': 0}
You can then calculate the average as follows:
>>> max_ratios = find_max_ratio(t)
>>> average = sum(max_ratios.values())/float(len(max_ratios))
>>> average
0.0 # there are no differences in your test data above
**EDIT: Writing to a file**
>>> output = sorted(max_ratios.items(), key=lambda x: x[1], reverse=True) # sorting by descending ratios
>>> with open('test2.txt', 'w') as f: # a new file name
>>> f.write('\n'.join([group + ': ' + str(ratio) for group, ratio in output])
+ '\n\nAverage: ' + str(average))
**EDIT 2: Adding minimum difference**
You can add the minimum difference into your result (here in the form of a
tuple `(<max_difference>, <min_difference>)` like this:
def find_maxmin_ratios(lines):
lines = [row.split() for row in lines] # the file should already break at each line break
lines = [(int(row[0]), row[1]) for row in lines]
lines = groupby(sorted(lines), lambda x: x[0]) # combine strings into their respective groups, sorting them first on int of first element
group_minmax = dict()
for index, group in lines:
strings = list(group) # need to convert group[1] from iterator into list
if len(strings) > 1: # if the number of strings is 1, then there is nothing to compare the string with in its group
max_similarity = 1
min_similarity = 0
for line1, line2 in combinations(strings, 2):
s = difflib.SequenceMatcher(None, line1[1], line2[1]) # need to compare second element in each list and exclude the first element (which is the group number)
max_similarity = s.ratio() if s.ratio() < max_similarity else max_similarity
min_similarity = s.ratio() if s.ratio() > min_similarity else min_similarity
group_minmax[index] = (1 - max_similarity, 1 - min_similarity) # gives max difference ratio and then min difference ratio
return group_minmax
Then you can find the respective averages like this:
>>> t = open('test.txt')
>>> maxmin_ratios = find_maxmin_ratios(t)
>>> maxmin_ratios
{'1': (0, 0.0), '0': (0, 0.0), '2': (0, 0.0)} # again, no differences in your test data
>>> average_max = sum([maxmin[0] for maxmin in maxmin_ratios.values()])/float(len(maxmin_ratios))
>>> average_min = sum([maxmin[1] for maxmin in maxmin_ratios.values()])/float(len(maxmin_ratios))
>>> average_max, average_min
(0.0, 0.0) # no differences in your test data
**Edit 3: Optimization Concerns**
Finally, in light of your last comment, I'm not sure if you will be able to
optimize this function too much in its present form. If your computer can't
handle it, you may need to process smaller chunks of text and then compile the
results at the end. `difflib` doesn't require huge amounts of memory, but it
DOES do a LOT of work. Your performance SHOULD be a lot better than mine
(depending on your machine) because every line of mine was random. If your
lines are more similar than dissimilar, you should do a lot better. Here are
the results of cProfile on my machine for the following scenario (3.172 hours
total):
text2.txt
- 9700 lines of text
- each line begins with one random number (1 to 10)
- each line has 400 random characters that follow the random number # if your data is not random, you should do CONSIDERABLY better than this
Note that the majority of the cumtime (the total time for a given function and
all functions below it) was spent in difflib, which is outside of your control
with the present function. In fact, the rest of the function takes very little
time at all.
4581938093 function calls in 11422.852 seconds
Ordered by: tottime # the total time spent in a given function, excluding time spent in subfunctions
ncalls tottime percall cumtime percall filename:lineno(function)
81770876 8579.568 0 9919.636 0 difflib.py:350(find_longest_match)
-724102230 1268.238 0 1268.238 0 {method 'get' of 'dict' objects}
4700900 874.878 0 1143.419 0 difflib.py:306(__chain_b)
9401960 160.366 0 10183.511 0.001 difflib.py:460(get_matching_blocks)
2060343126 141.242 0 141.242 0 {method 'append' of 'list' objects}
1889761800 110.013 0 110.013 0 {method 'setdefault' of 'dict' objects}
81770876 32.433 0 55.41 0 <string>:8(__new__)
130877001 32.061 0 32.061 0 {built-in method __new__ of type object at 0x1E228030}
81770876 29.773 0 29.773 0 {method 'pop' of 'list' objects}
1 23.259 23.259 11422.852 11422.852 <pyshell#50>:1(find_maxmin_ratios)
49106125 21.45 0 33.218 0 <string>:12(_make)
9401960 20.539 0 10239.234 0.001 difflib.py:636(ratio)
335752019 17.719 0 17.719 0 {len}
9401960 17.607 0 30.829 0 {_functools.reduce}
4700900 16.778 0 49.996 0 {map}
230344786 16.42 0 16.42 0 {method __contains__' of 'set' objects}
191093877 14.962 0 14.962 0 {method 'add' of 'set' objects}
98214517 13.222 0 13.222 0 difflib.py:658(<lambda>)
4700900 6.428 0 6.428 0 {method 'sort' of 'list' objects}
4700900 5.794 0 5.794 0 {method 'items' of 'dict' objects}
4700900 5.339 0 1148.758 0 difflib.py:261(set_seq2)
4700900 4.333 0 1160.351 0 difflib.py:154(__init__)
4700900 3.83 0 1156.018 0 difflib.py:223(set_seqs)
4700900 3.43 0 3.43 0 difflib.py:235(set_seq1)
9401960 3.162 0 3.162 0 difflib.py:41(_calculate_ratio)
9700 0.003 0 0.003 0 {method 'strip' of 'str' objects}
1 0.003 0.003 0.003 0.003 {sorted}
9700 0.001 0 0.001 0 <pyshell#50>:3(<lambda>)
1 0 0 11422.852 11422.852 <string>:1(<module>)
1 0 0 0 0 {method 'disable' of '_lsprof.Profiler' objects}
If your machine can handle it, I would just run this function and be prepared
to wait two or three hours. A LOT is happening here in order to compare these
strings character-by-character.
|
Python - step through list -TypeError: 'int' object is not iterable
Question: Trying to learn python, I am trying to do:
list0=['A','B'];
list1=['C','D'];
z=0
while z < 2:
for q in list(z):
print q
z += 1
I would like it to print
A
B
C
D
but i get the following error:
Traceback (most recent call last):
File "main.py", line 6, in
for q in list(z):
TypeError: 'int' object is not iterable
Is this possible in python? I know I have done this or something similar in
other languages.
Answer: 1. You can gather both the lists as another list and then you can index it like this
list0=['A','B'] # We don't need semicolons
list1=['C','D']
lists=[list0, list1] # Create a list of lists
z=0
while z < 2:
for q in lists[z]: # We access list's index with [], not with ()
print q
z += 1
**Output**
A
B
C
D
2. The same effect can be achieved like this
for current_list in [list0, list1]:
for current_item in current_list:
print current_item
3. There is a builtin python module, which comes with a [`itertools.chain`](http://docs.python.org/2/library/itertools.html#itertools.chain) method, which can be used like this
import itertools
for current_item in itertools.chain(list0, list1):
print current_item
|
Error while installing Fabric on OSX using recommended pip. Xcode is latest version
Question: I just tried to install Fabric on my Mac, and I was thrown this error after
using `pip install fabric`
Installing collected packages: fabric, paramiko, pycrypto, ecdsa
Cleaning up...
Exception:
Traceback (most recent call last):
File "/Library/Python/2.7/site-packages/pip-1.5-py2.7.egg/pip/basecommand.py", line 122, in main
status = self.run(options, args)
File "/Library/Python/2.7/site-packages/pip-1.5-py2.7.egg/pip/commands/install.py", line 275, in run
requirement_set.install(install_options, global_options, root=options.root_path)
File "/Library/Python/2.7/site-packages/pip-1.5-py2.7.egg/pip/req.py", line 1371, in install
requirement.install(install_options, global_options, *args, **kwargs)
File "/Library/Python/2.7/site-packages/pip-1.5-py2.7.egg/pip/req.py", line 655, in install
self.move_wheel_files(self.source_dir, root=root)
File "/Library/Python/2.7/site-packages/pip-1.5-py2.7.egg/pip/req.py", line 885, in move_wheel_files
pycompile=self.pycompile,
File "/Library/Python/2.7/site-packages/pip-1.5-py2.7.egg/pip/wheel.py", line 209, in move_wheel_files
clobber(source, lib_dir, True)
File "/Library/Python/2.7/site-packages/pip-1.5-py2.7.egg/pip/wheel.py", line 196, in clobber
os.makedirs(destsubdir)
File "/System/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/os.py", line 157, in makedirs
mkdir(name, mode)
OSError: [Errno 13] Permission denied: '/Library/Python/2.7/site-packages/fabfile'
Storing debug log for failure in /Users/michaelsnowden/Library/Logs/pip.log
Here is the entire [debug log](https://gist.github.com/doctordoder/8501645)
What does this mean, and why am I getting this error?
Answer: For a system wide pip install you need to do a sudo:
sudo pip install fabric
Since the system wide packages are available globally, they are written
outside paths that have write permission for a normal user. In that case you
need to do a sudo other permission to write to those folders would be denied
to you.
When installed globally, you can invoke the Python interpreter anywhere in
your system and `import fabric` would be available to you. Also, it would be
available to any user of your system.
|
Flask - run function every hour
Question: I have a Flask web hosting with no access to `cron` command. How can I execute
some Python function every hour?
Answer: You could make use of [`APScheduler`](http://pythonhosted.org/APScheduler/) in
your Flask application and run your jobs via its interface:
import atexit
from apscheduler.scheduler import Scheduler
from flask import Flask
app = Flask(__name__)
cron = Scheduler(daemon=True)
# Explicitly kick off the background thread
cron.start()
@cron.interval_schedule(hours=1)
def job_function():
# Do your work here
# Shutdown your cron thread if the web process is stopped
atexit.register(lambda: cron.shutdown(wait=False))
if __name__ == '__main__':
app.run()
|
Python. Is it possible to print without using the print function?
Question: I wondered whether it is possible to print (for example a string) in python
without the print command. This can be done by a command or by some trick.
For example, in C there are printf and puts.
Can someone show me a way to print or to deny this possibility?
**EDIT**
I know about sys.stdout.write(). I also read the documentation. I just wanted
to know whether there is another way to print, and without using import. I
didn't find such a way, and could not find whether there is another way for
printing.
Answer:
sys.stdout.write("hello world\n")
|
Left factoring using Python
Question: Is there any predefined function in Python to identify the common prefixes on
the right side of a production rule?
For example, I need to turn this sort of data structure:
['abc', 'ab', 'd', 'dc']
into a dictionary of prefix-to-corresponding suffixes pairs. So my output for
this example should look something like this:
{'ab': set(['c', '']), 'd': set(['c', ''])} # ab is a common prefix and d is a common prefix
In more general terms, I need to convert this sort of input:
S -> abc|ab|d|dc
into this sort of output:
S -> abA|dA # prefixes ab and d followed by A
A -> c|NULL # where A is either c or an equivalent of None
I want to use this output to perform left factoring of a grammar.
Answer: Another solution, let me know if that works:
from itertools import takewhile,izip
def groupby(ls):
d = {}
ls = [ y[0] for y in x ]
initial = list(set(ls))
for y in initial:
for i in x:
if i.startswith(y):
if y not in d:
d[y] = []
d[y].append(i)
return d
def prefix(x):
return len(set(x)) == 1
x=['abc','ab','d','dc']
for k, l in groupby(x).iteritems():
r = [l[0] for l in takewhile(prefix ,izip(*l))]
print ''.join(r)
Output:
ab
d
|
reading data from stackoverflow rest api
Question: Playing around with the raspberry pi and python. so bear with me :)
When trying to decode the response data from the stackoverflow api I keep on
receiving the error `utf-8 codec can't decode byte 0x8b in position 1: invalid
start byte`
Here is the entire code that I have hacked up at the moment
import http.client
import json
import zlib
c = http.client.HTTPConnection('api.stackoverflow.com')
c.request('GET', '/1.1/questions?answers=true&page=1&pagesize=5&tagged=sql')
r = c.getresponse()
compressedData = r.read()
uncompressedData= zlib.decompress(compressedData, 15+32)
data = str(compressedData, 'utf-8')
print(data)
But the response data is encoded in utf-8 format? Not quite sure why this is
happening...
Answer: Your code looks fine but...
data = str(compressedData, 'utf-8')
you're trying to decode the _compressed_ data. Try decoding the uncompressed
data :-)
|
Virtualenv doesn't install pip
Question: I have installed `python3` via homebrew, updated `pip` & `setuptools`,
installed `virtualenv` via `pip`. Now I'm trying to create a virtual env.
Unfortunately, I can't get it to add pip to the virtualenv. Basically:
$ ls -lha venv/bin/
total 80
drwxr-xr-x 9 foghin staff 306B Jan 19 17:16 .
drwxr-xr-x 6 foghin staff 204B Jan 19 17:16 ..
-rw-r--r-- 1 foghin staff 2.2K Jan 19 17:16 activate
-rw-r--r-- 1 foghin staff 1.2K Jan 19 17:16 activate.csh
-rw-r--r-- 1 foghin staff 2.4K Jan 19 17:16 activate.fish
-rw-r--r-- 1 foghin staff 1.1K Jan 19 17:16 activate_this.py
lrwxr-xr-x 1 foghin staff 7B Jan 19 17:16 python -> python3
-rwxr-xr-x 1 foghin staff 13K Jan 19 17:16 python3
lrwxr-xr-x 1 foghin staff 7B Jan 19 17:16 python3.3 -> python3
AFAIK `pip` is supposed to be there as well. Creating the virtual env with
high verbosity yields this:
Installing setuptools, pip...
Running command /Users/foghin/code/tastekid/venv/bin/python3 -c "import sys, pip; pip...ll\"] + sys.argv[1:])" setuptools pip
Ignoring indexes: https://pypi.python.org/simple/
Requirement already satisfied (use --upgrade to upgrade): setuptools in /usr/local/lib/python3.3/site-packages
Requirement already satisfied (use --upgrade to upgrade): pip in /usr/local/lib/python3.3/site-packages
Cleaning up...
...Installing setuptools, pip...done.
This means that all the packages I install while the virtual env is activated
go to my global site packages (`/usr/local/lib/python3.3/site-packages`), but
they are not picked up by the sandboxed python.
How can I get `virtualenv` to properly install pip in my local environment?
**Update:** virtualenv version is 1.11.
Answer: As of this writing, Homebrew installs Python 3.3.3 (`$ brew info python3`).
And as of Python 3.3, Python's standard library now includes its own virtual
environment implementation, and does not require the virtualenv package. See
the [`venv` module documentation](http://docs.python.org/3/library/venv.html).
With the Homebrew Python 3 package, the command-line tool is named
`pyvenv-3.3`.
I believe using this implementation should resolve the issues you're
encountering.
|
Python - alternating lists
Question: I have two lists in python:
l = [1,1,1,1,1,1]
b = ['-', 2, 2, 2, '-', 2]
In the end, I'd like to have a list like this:
result = [1, 1, 2, 1, 2, 1, 2, 1, 1, 2]
Algorithm: If there is a '-' in b, do nothing, else append element from b
after element in l at same index (Second 2 from b should go after second 1 in
l). How can I do this?
for idx, i2 in enumerate(b):
if i2 != '-' and count == 1:
l.insert(prev+2,i2)
prev = prev+2
print "in if1"
print l
print prev
elif i2 != '-' and count == 0:
l.insert(idx+1,i2)
prev = idx+2
count = 1
print "in if2"
print l
print prev
Answer:
l, b = [1,1,1,1,1,1], ['-', 2, 2, 2, '-', 2]
print [item for items in zip(l, b) for item in items if item != '-']
**Output**
[1, 1, 2, 1, 2, 1, 2, 1, 1, 2]
If the number of elements in either of the lists is not going to be equal to
the other, you can use
[`itertools.izip_longest`](http://docs.python.org/2/library/itertools.html#itertools.izip_longest)
like this
l, b = [1,1,1,1,1,1], ['-', 2, 2, 2, '-', 2, 2, 2]
from itertools import izip_longest
print [e for items in izip_longest(l,b) for e in items if e != None and e != '-']
**Output**
[1, 1, 2, 1, 2, 1, 2, 1, 1, 2, 2, 2]
|
Python alternative to fscanf C code
Question: I have some C code that works well:
#include<stdio.h>
#include<stdlib.h>
int main()
{
FILE *fp;
struct emp
{
char name[40];
int age;
float bs;
};
struct emp e;
fp=fopen("EMPLOYEE.DAT","r");
if(fp==NULL)
{
puts("Cannot open file";
exit(1);
}
while(fscanf(f,"%s %d %f",&e.name,&e.age,&e.bs)!=EOF)
printf("%s %d %f\n",e.name,e.age,e.bs);
fclose(fp);
return 0;
}
data inside `EMPLOYEE.DAT`:
Sunil 34 1250.50
Sameer 21 1300.50
rahul 34 1400.50
I'm having trouble translating this code to Python:
while(fscanf(f,"%s %d %f",&e.name,&e.age,&e.bs)!=EOF)
printf("%s %d %f\n",e.name,e.age,e.bs);
Is there any way to implement that in Python? Furthermore, what are Pythonic
alternatives of `exit()` & `EOF`?
Answer: Something like:
with open("EMPLOYEE.DAT") as f: # open the file for reading
for line in f: # iterate over each line
name, age, bs = line.split() # split it by whitespace
age = int(age) # convert age from string to int
bs = float(bs) # convert bs from string to float
print(name, age, bs)
If you want to store the data in a structure, you can use the builtin `dict`
type (hash map)
person = {'name': name, 'age': age, 'bs': bs}
person['name'] # access data
Or you could define your own class:
class Employee(object):
def __init__(self, name, age, bs):
self.name = name
self.age = age
self.bs = bs
e = Employee(name, age, bs) # create an instance
e.name # access data
**EDIT**
Here's a version that handles the error if the file does not exist. And
returns an `exit` code.
import sys
try:
with open("EMPLOYEE.DAT") as f:
for line in f:
name, age, bs = line.split()
age = int(age)
bs = float(bs)
print(name, age, bs)
except IOError:
print("Cannot open file")
sys.exit(1)
|
Examples given in the Python BeautifulSoup 4 Documentation
Question: I am learning the BeautifulSoup 4 Documentation, and want to exercise the
examples given.
I am trying the examples however it’s not successful. An example below.
Seems I am not putting it in a right way, and problem lies in the ‘url’. Could
some kindness showing me the right way to put them? Thanks.
from bs4 import BeautifulSoup
import re
import urllib2
url = '<a class="sister" href="http://example.com/elsie" id="link1">Elsie</a>'
page = urllib2.urlopen(url)
soup = BeautifulSoup(page.read())
Learning = soup.find_all("a", class_="sister")
print Learning
Answer: `'<a class="sister" href="http://example.com/elsie" id="link1">Elsie</a>'` is
not an url.
The code contains html; You don't need to use `urllib2.urlopen`.
from bs4 import BeautifulSoup
page = '<a class="sister" href="http://example.com/elsie" id="link1">Elsie</a>'
soup = BeautifulSoup(page)
Learning = soup.find_all("a", class_="sister")
print Learning
|
Bottle Displays Old Template?
Question: I made a first draft of a template, called `batch.tpl`. I have updated it,
however, the old template still displays. I have shut off the controller
script and turned it back on multiple times. I have removed everything from
the template except for the following:
`cat views/batch.tpl`
<HTML>
<HEAD>
<TITLE> Batch Manager </TITLE>
</HEAD>
<BODY>
THIS ISN'T DISPLAYING IN BROWSER
</BODY>
</HTML>
Yet that will not show, just the old template.
Here is my controller:
`cat brew_bottle.py`
from bottle import route, run, template, debug, post, request
import MySQLdb
import pymongo
from datetime import datetime, timedelta
import datetime
@route('/batch')
def batch():
con = MySQLdb.connect('localhost', 'root', 'pi', 'brew')
cursor = con.cursor()
batch_sql = "SELECT name, material, start_date, active, end_begin_date, end_end_date, min_temp, max_temp FROM batch WHERE active='Y'"
cursor.execute(batch_sql)
batches = cursor.fetchall()
return template('batch', batches=batches)
#...
debug(True)
run(host='0.0.0.0', port='8080', reloader=True)
However, when I go to `http://<hostname>:8080/batch`, I see the old template
that I had wrote:
I am sure I am missing something easy. What is it?
I created a new directory and moved everything to it. Then when I start the
python script, I am able to see the correct page. But the python script in the
old directory displays the old template?
Answer: According to the [Bottle
docs](http://bottlepy.org/docs/dev/tutorial.html#auto-reloading), auto
reloading (`reloading`) is only triggered by changes to module files.
> Changes in template files will not trigger a reload. Please use debug mode
> to deactivate template caching.
Turn on [Bottle's debug
mode](http://bottlepy.org/docs/dev/tutorial.html#debug-mode) this way:
bottle.debug(True)
> Here is an incomplete list of things that change in debug mode:
>
> The default error page shows a traceback. Templates are not cached. Plugins
> are applied immediately. Just make sure not to use the debug mode on a
> production server.
* * *
N.B., I see that someone already asked you whether restarting the server
caused the updated template to appear, and that you indicated that it did not.
That's highly suspicious. In any case, try fixing the problem above and see
whether that solves your problem. Good luck!
|
Writing and reading variables in a file in Python
Question: I am new to the Python language and I am scratching my head on how to make my
code create a file where it can define variables and then later read the
variables so they are useable in my code. How would I do this?
Thanks, Chandler.
Answer: [You can use the pickle module to accomplish
this.](http://docs.python.org/2/library/pickle.html#example)
import pickle
Here's some sample data:
key_value_mapping = dict(tuple=(), string='', list=[], int=0, set=set())
Provide a path that you want the file to exist at, e.g.:
file_location= '/temp/foobar'
We need to open a file to write (w) as a binary (b) file (see the `'wb'` flags
being passed to the open function). These two lines demonstrate how to do
this:
with open(file_location, 'wb') as file:
pickle.dump(key_value_mapping, file)
Finally, we need to open the file to read (r) it as a binary (b) file, and
retrieve the data:
with open(file_location, 'rb') as file:
data = pickle.load(file)
print(data)
{'tuple': (), 'set': set(), 'int': 0, 'list': [], 'string': ''}
|
Python dicerolling program skipping the roll
Question: I have been trying to create a program that will simulate a dice roll, with
the option to choose between a 4, 6, or 12 sided die. At the moment the
problem I am having is that the program skips the rolling entirely no matter
what option I choose and immediately asks me if I want to roll again. Im using
Portable Python 3.2.1.1 to create the code. This is what I have so far:
#!/usr/bin/env python
import random
def fourdie():
min = 1
max = 4
print (random.randint(min, max));
return;
def sixdie():
min = 1
max = 6
print (random.randint(min, max));
return;
def twelvedie():
min = 1
max = 12
print (random.randint(min, max));
return;
roll = "yes"
y = 1
while roll == "yes" or roll == "y":
x = raw_input("What die do you want to roll? 4, 6 or 12?");
if x == 4:
print (fourdie());
elif x == 6:
print (sixdie());
elif x == 12:
print (twelvedie());
else:
print = "Sorry, I dont appear to have that dice type";
roll = raw_input("Do you want to roll again?");
Any help would be appreciated. Thank you for your time!
Answer: `input` function returns a string.
You can convert this string to int and then compare it to 4, 6, or 12:
x = int(input("What die do you want to roll? 4, 6 or 12?"))
if x == 4:
// whatever
elif x == 6:
// whatever
Or you can compare `x` directly to a string:
x = input("... whatever ...")
if x == "4":
// whatever
elif x == "6":
// whatever
And one other thing: there is no need to end lines with the semicolon in
python. Makes Guido van Rossum happy.
|
Sending string via socket (python)
Question: I have two scripts, Server.py and Client.py. I have two objectives in mind:
1. To be able to send data again and again to server from client.
2. To be able to send data from Server to client.
here is my Server.py :
import socket
serversocket = socket.socket(socket.AF_INET, socket.SOCK_STREAM)
host = "192.168.1.3"
port = 8000
print (host)
print (port)
serversocket.bind((host, port))
serversocket.listen(5)
print ('server started and listening')
while 1:
(clientsocket, address) = serversocket.accept()
print ("connection found!")
data = clientsocket.recv(1024).decode()
print (data)
r='REceieve'
clientsocket.send(r.encode())
and here is my client :
#! /usr/bin/python3
import socket
s = socket.socket(socket.AF_INET, socket.SOCK_STREAM)
host ="192.168.1.3"
port =8000
s.connect((host,port))
def ts(str):
s.send('e'.encode())
data = ''
data = s.recv(1024).decode()
print (data)
while 2:
r = input('enter')
ts(s)
s.close ()
The function works for the first time ('e' goes to the server and I get return
message back), but how do I make it happen over and over again (something like
a chat application) ? The problem starts after the first time. The messages
don't go after the first time. what am I doing wrong? I am new with python, so
please be a little elaborate, and if you can, please give the source code of
the whole thing.
Answer:
import socket
from threading import *
serversocket = socket.socket(socket.AF_INET, socket.SOCK_STREAM)
host = "192.168.1.3"
port = 8000
print (host)
print (port)
serversocket.bind((host, port))
class client(Thread):
def __init__(self, socket, address):
Thread.__init__(self)
self.sock = socket
self.addr = address
self.start()
def run(self):
while 1:
print('Client sent:', self.sock.recv(1024).decode())
self.sock.send(b'Oi you sent something to me')
serversocket.listen(5)
print ('server started and listening')
while 1:
clientsocket, address = serversocket.accept()
client(clientsocket, address)
This is a very VERY simple design for how you could solve it. First of all,
you need to either accept the client (server side) before going into your
`while 1` loop because in every loop you accept a new client, or you do as i
describe, you toss the client into a separate thread which you handle on his
own from now on.
|
LoginUser API access from Python
Question: Is there a way to call the following method from Python?
<http://msdn.microsoft.com/en-
us/library/windows/desktop/aa378184(v=vs.85).aspx>
Any help would be greatly appreciated.
Answer: You may use [ctypes](http://docs.python.org/2/library/ctypes.html). This
example seems to work (Python 2.7):
from ctypes import *
from ctypes.wintypes import HANDLE
# Example use of WinAPI
windll.user32.MessageBoxW(None, u"Example", u"Example", 0)
x = HANDLE()
print windll.advapi32.LogonUserW(u"Tupteq", None, u"passwd", 4, 0, pointer(x))
print windll.kernel32.GetLastError()
print x
In my case `GetLastError()` returned `1326` in case of bad password and `1327`
when password was correct.
You may need to adjust values of `dwLogonType` and `dwLogonProvider`.
|
Wrap derived template class with Boost::python
Question: I have a derived class from a template class :
template<typename X, typename Y>
class BaseFunction
{
static void export_BaseFunction()
{
?????
};
};
class Function : public BaseFunction<pair<double, double>, double>
{
Function() : BaseFunction<pair<double, double>, double>() {};
static void export_Function()
{
BaseFunction::export_BaseFunction();
boost::python::class_<Function, boost::python::bases<BaseFunction<pair<double, double>, double>>, boost::shared_ptr<Function>>("Function");
}
};
So Boost::Python asks me to create a class wrapper for BaseFunction but I
don't find any information to write a template class, only template
function... Have I to define a class wrapper for each base class ? Have I to
define a class wrapper for each type used into my template class ?
Thank you for your helpful answers
Answer: The `RuntimeError` occurs because a requirement for the
[`class_`](http://www.boost.org/doc/libs/1_55_0/libs/python/doc/v2/class.html#class_-
spec)'s `Bases` template parameter is not being met:
> A specialization of `bases<...>` which specifies previously-exposed C++ base
> classes of `T`
With previously-exposed being
[explained](http://www.boost.org/doc/libs/1_55_0/libs/python/doc/v2/class.html#footnote_1)
as:
namespace python = boost::python;
python::class_<Base>("Base");
python::class_<Derived, python::bases<Base> >("Derived");
To resolve the `RuntimeError`, either:
* Omit the `bases` information if the exposed API does not need to perform upcasting or downcasting with `Function` and `BaseFunction<...>`. For example, if none of the C++ functions exposed to Python have a parameter type of `BaseFunction<...>` or return a `Function` object as a `BaseFunction<...>&`, then Boost.Python does not need to know about type relationship.
* Otherwise, the base class needs to be exposed and `Function` needs to expose the relationship:
namespace python = boost::python;
typedef BaseFunction<pair<double, double>, double> function_base_type;
python::class_<function_base_type>("Base");
python::class_<Function, python::bases<function_base_type> >("Function");
When registering the specific type instance of `BaseFunction`, the string
identifier needs to be unique.
* * *
Below is a complete example that has `Function` expose `BaseFunction`. The
`export_BaseFunction()` function will check if it has already been registered
to prevent warning about duplicated conversions, and will use C++ type
information name to disambiguate between different template instantiations of
`BaseFunction`.
#include <utility> // std::pair
#include <typeinfo> // typeid
#include <boost/python.hpp>
template<typename X, typename Y>
class BaseFunction
{
public:
static void export_BaseFunction()
{
// If type is already registered, then return early.
namespace python = boost::python;
bool is_registered = (0 != python::converter::registry::query(
python::type_id<BaseFunction>())->to_python_target_type());
if (is_registered) return;
// Otherwise, register the type as an internal type.
std::string type_name = std::string("_") + typeid(BaseFunction).name();
python::class_<BaseFunction>(type_name.c_str(), python::no_init);
};
};
class Function
: public BaseFunction<std::pair<double, double>, double>
{
private:
typedef BaseFunction<std::pair<double, double>, double> parent_type;
public:
static void export_Function()
{
// Explicitly register parent.
parent_type::export_BaseFunction();
// Expose this type and its relationship with parent.
boost::python::class_<Function, boost::python::bases<parent_type>,
boost::shared_ptr<Function> >("Function");
}
};
/// @brief Example function to demonstrate upcasting.
void spam(BaseFunction<std::pair<double, double>, double>&) {}
BOOST_PYTHON_MODULE(example)
{
Function::export_Function();
boost::python::def("spam", &spam);
}
Interactive usage:
>>> import example
>>> f = example.Function()
>>> f
<example.Function object at 0xb7ec5464>
>>> example.spam(f)
|
Using 'exec' function to run script in the interpreter shell
Question: I try to run a script in Python3 by exec() function.
I'm studying Python with the book 'Learning Python', O'Reilly 5th Edition. In
the "CHAPTER 2 How Python Runs Programs" there is a method to like this:
>>> exec(open('script1.py').read())
This is my file script1.py
# A first script in python.
import sys
print(sys.platform)
print(2 **100)
x = 'Spam!'
print(x * 8)
input()
The expectec output is:
win32
1267650600228229401496703205376
Spam!Spam!Spam!Spam!Spam!Spam!Spam!Spam!
In the work I only can use WinXP :-(
But the real output in Python3 is:
>>> exec(open('script1.py').read())
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
File "<string>", line 1
# A first script in python.
^
SyntaxError: invalid character in identifier
>>>
And the output in Python2 is:
>>> exec(open('script1.py').read())
win32
1267650600228229401496703205376
Spam!Spam!Spam!Spam!Spam!Spam!Spam!Spam!
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
File "<string>", line 7, in <module>
File "<string>", line 0
^
SyntaxError: unexpected EOF while parsing
>>>
I don't understand why that isn't working like the book says.
Answer: The problem is in your editor, that adds an ''incorrect symbol'' (actually,
the symbol is correct per se) at the beginning of the file. Please check it.
If you want to check this conjecture, please do
print open('script1.py').read(1)
in the python repl.
It is probably BOM in the file (thanks @devnull).
If it is so, you can open the file with encondig `utf-8-sig`:
open('script1.py', encoding='utf-8-sig')
More on that you can read here:
* [Reading Unicode file data with BOM chars in Python](http://stackoverflow.com/questions/13590749/reading-unicode-file-data-with-bom-chars-in-python)
What is BOM (Byte Order Mark), you can find here:
* <http://en.wikipedia.org/wiki/Byte_order_mark>
And of course, you must avoid BOMs in your scripts in the future. Please check
settings of your editor, and make sure it doesn't create BOMs when saving
scripts.
|
Is there a way to implement **kwargs behavior when calling a Python script from the command line
Question: Say I have a function as follows:
def foo(**kwargs):
print kwargs
And then call the function like this, I get this handy little dict of all
`kwargs`.
>>> foo(a = 5, b = 7)
{'a': 5, 'b': 7}
I want to do this directly to scripts I call from command line. So entering
this:
python script.py a = 5 b = 7
Would create a similar dict to the example above. Can this be done?
**Here's what I have so far:**
import sys
kwargs_raw = sys.argv[1:]
kwargs = {key:val for key, val in zip(kwargs_raw[::3], kwargs_raw[1::3])}
print kwargs
And here's what this produces:
Y:\...\Python>python test.py a = 5 b = 7
{'a': '5', 'b': '7'}
So you may be wondering why this isn't good enough
1. Its very structured, and thus, won't work if `a` or `b` are anything other that strings, ints, or floats.
2. I have no way of determining if the user intended to have 5 be an int, string, or float
I've seen `ast.literal_eval()` around here before, but I couldn't figure out
how to get that to work. Both my attempts failed:
>>> ast.literal_eval("a = 5")
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
File "Y:\admin\Anaconda\lib\ast.py", line 49, in literal_eval
node_or_string = parse(node_or_string, mode='eval')
File "Y:\admin\Anaconda\lib\ast.py", line 37, in parse
return compile(source, filename, mode, PyCF_ONLY_AST)
File "<unknown>", line 1
a = 5
and
>>> ast.literal_eval("{a:5,b:7}")
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
File "Y:\admin\Anaconda\lib\ast.py", line 80, in literal_eval
return _convert(node_or_string)
File "Y:\admin\Anaconda\lib\ast.py", line 63, in _convert
in zip(node.keys, node.values))
File "Y:\admin\Anaconda\lib\ast.py", line 62, in <genexpr>
return dict((_convert(k), _convert(v)) for k, v
File "Y:\admin\Anaconda\lib\ast.py", line 79, in _convert
raise ValueError('malformed string')
ValueError: malformed string
If it matters, I'm using Python 2.7.6 32-bit on Windows 7 64-bit. Thanks in
advance
Answer: It seems what you're _really_ looking for is a way to parse command-line
arguments. Take a look at the `argparse` module:
<http://docs.python.org/2/library/argparse.html#module-argparse>
Alternately, if you really want to give your arguments in dictionary-ish form,
just use the `json` module:
import json, sys
# Run your program as:
# python my_prog.py "{'foo': 1, 'bar': 2}"
# (the quotes are important)
data = json.loads(sys.argv[1])
|
Django NoReverseMatch
Question: I'm making a simple login app in django 1.6 (and python 2.7) and I get an
error at the beggining that is not letting me continue.
This is the site's url.py
from django.conf.urls import patterns, include, url
from django.contrib import admin
import login
admin.autodiscover()
urlpatterns = patterns('',
url(r'^$', include('login.urls', namespace='login')),
url(r'^admin/', include(admin.site.urls)),
)
And this is login/urls.py:
from django.conf.urls import patterns, url
from login import views
urlpatterns = patterns('',
url(r'^$', views.index, name='index'),
url(r'^auth/', views.auth, name='auth'),
)
This is login/views,py
from django.shortcuts import render
from django.contrib.auth import authenticate
def auth(request):
user = authenticate(username=request.POST['username'], password=request.POST['password'])
if user is not None:
# the password verified for the user
if user.is_active:
msg = "User is valid, active and authenticated"
else:
msg = "The password is valid, but the account has been disabled!"
else:
# the authentication system was unable to verify the username and password
msg = "The username and password were incorrect."
return render(request, 'login/authenticate.html', {'MESSAGE': msg})
def index(request):
return render(request, 'login/login_form.html')
I have a form that has this as action:
{% url 'login:auth' %}
And that's where the problem is, when I try to load the page, I get:
Reverse for 'auth' with arguments '()' and keyword arguments '{}' not found. 1 pattern(s) tried: [u'$auth/']
But if I set the url pattern to
url(r'', views.auth, name='auth')
it works fine, only it sets the action as '/'.
I've been looking all around for an answer and I don't understand why it
doesn't work.
I tried changing the login url pattern to url(r'^login/$',
include('login.urls', namespace='login')), and it didn't change anything.
Answer: The problem is in the way you include the auth URLs in the main one. Because
you use both ^ and $, only the empty string matches. Drop the $.
|
Passing values to array indexes in Python
Question: Is there any way to assign values to keys in array in Python?
Example in PHP:
$inputArr = array(
'vertex'=>values[0],
'visited'=>values[1],
'letter' => $values[2]
)
This is the way i tried to do in Python:
file_name = input('Enter a file name: ')
f = open(file_name, 'r')
data = f.readlines() //Read the lines
for line in data:
values = line.split(' ') Split line following the spaces
inputArr = array(
'vertex'=>values[0], //Pass each value to a key in that array
'visited'=>values[1],
'letter' => $values[2]
)
print (inputArr)
Answer: You want to use
[`dict`s](http://docs.python.org/2/library/stdtypes.html#dict):
array = {
'vertex': values[0],
'visited': values[1],
'letter': values[2],
}
# access via array['vertex']
Note however that this does **not** preserve the order. Iterating over the
dictionary can produce an arbitrary order. There is an
[`OrderedDict`](http://docs.python.org/2/library/collections.html#collections.OrderedDict)
class in recent versions of python, however keep in mind that it takes more
than twice as much memory as a plain `dict`.
If your array is fixed, and only has those 3 elements, it might be better to
use a
[`namedtuple`](http://docs.python.org/2/library/collections.html#collections.namedtuple):
from collections import namedtuple
NamedSeq = namedtuple('NamedSeq', ('vertex', 'visited', 'letter'))
array = NamedSeq(values[0], values[1], values[2])
#or
array = NamedSeq(vertex=values[0], letter=values[2], visited=values[1])
This preserves the order and you can access `vertex` via `array.vertex` etc.
Or you can access the data using `array[0]` for the value of `vertex`,
`array[1]` for the `visited` etc.
Note that however that `namedtuple`s are _immutable_ , i.e. you cannot modify
them.
|
UWSGI timer and cron decorators running duplicate jobs
Question: I have been trying to make the uwsgi python spooler work properly for quite
some time. I have a setup in which I run a django application with two worker
processes. I have tried setting a cron spooler (and a timer spooler) to run a
task every ten minutes, but no matter what configuration of settings I've
tried, it always seems to register the signal multiple times, and running the
task multiple times.
This is how I run uwsgi:
#!/bin/bash
sudo uwsgi --emperor /etc/uwsgi/vassals --uid http --gid http --enable-threads --pidfile=/tmp/uwsgi.pid --daemonize=/var/log/uwsgi/uwsgi.log
This is my uwsgi vassal config in /etc/uwsgi/vassals/django.ini:
[uwsgi]
chdir = /home/user/django
module = django.wsgi
master = true
processes = 2
socket = /tmp/uwsgi-django.sock
vacuum = true
pidfile = /tmp/uwsgi-django.pid
daemonize = /home/user/django/log.log
env = DJANGO_SETTINGS_MODULE=django.settings
#lazy-apps = false
#lazy = false
spooler = %(chdir)/tasks
#spooler-processes = 1
#import = django-app/spooler.py
#spooler-import = django-app/spooler.py
shared-import = django-app/spooler.py
(I have changed some of the path names for privacy reasons). The lines that
are commented out are various attempts at making it not duplicate my signals,
but every time it seems to register the signal twice, and sometimes even
thrice (presumably in both the workers and the single spooler process).
[uwsgi-signal] signum 0 registered (wid: 0 modifier1: 0 target: default, any worker)
[uwsgi-signal] signum 1 registered (wid: 1 modifier1: 0 target: default, any worker)
[uwsgi-signal] signum 1 registered (wid: 2 modifier1: 0 target: default, any worker)
Does anyone know why this is happening, and how to properly prevent it?
This is the spooler.py file:
@cron(-10, -1, -1, -1, -1)
def periodicUpdate(signal):
print "Running cron job..."
_getStats()
also tried
@timer(600)
def periodicUpdate(signal):
print "Running cron job..."
_getStats()
I also tried adding `target='spooler'` to the timer/cron-decorator, but it did
not seem to many any difference.
Answer: Are you sure you do not have other signals registered in django.wsgi,
settings.py or other django-related file ? --shared-import will only load
things one time (in the master).
Btw i do not get what you are trying to accomplish. This is not how the
spooler is supposed to work, and even if you want to use it as a signal
handler target you have to specify it when you register signals (with
target='spooler' in the decorator)
|
Cython with python 3.3
Question: I have been using python 3.3
This is an old problem as I searched, and this is what I did:
helloworld.pyx
print("Hello world!")
Then, in ipython, I did:
import pyximport; pyximport.install()
import helloworld
It says:
> ImportError: Building module helloworld failed: ["ValueError: ['path']\n"]
The same problem did not happen with python 2.7
I googled this:
<https://github.com/cython/cython/wiki/64BitCythonExtensionsOnWindows> and
realized that I have to install Windows SDK for Windows 7 and .NET Framework
4. As it comes with the VC++2010 Redistributables, I did not install the
redistributables alone again. I thought I had everything ready, but the import
error still remains.
Could anyone please help me solve it?
Thank you!
-Shawn
Answer: I was having the same issue and the same environment (win7 64bit, python-3.3.3
64bit).
I have
1. installed the Windows 7 SDK as described on the wiki [cython wiki](https://github.com/cython/cython/wiki/64BitCythonExtensionsOnWindows) as you did,
2. applied the patch (`msvccompiler9_33.diff`) from this [python bug](http://bugs.python.org/issue7511),
3. fixed the above patch by defining a missing variable as described [here](http://bugs.python.org/msg196929)
4. Installed MS Visual C++ Express 2010 (seems to be required)
5. Updated the Windows 7 SDK to include the "Windows Headers and Libraries", "Tools" and of course the "Visual C++ Compilers" the MSVC++2010 redistributable.
And now I can compile and import the `helloworld.py` just fine.
|
Why can't node handle this regex but python can?
Question: I have a large text file that I am extracting URLs from. If I run:
import re
with open ('file.in', 'r') as fh:
for match in re.findall(r'http://matchthis\.com', fh.read()):
print match
it runs in a second or so user time and gets the URLs I was wanting, but if I
run either of these:
var regex = /http:\/\/matchthis\.com/g;
fs.readFile('file.in', 'ascii', function(err, data) {
while(match = regex.exec(data))
console.log(match);
});
OR
fs.readFile('file.in', 'ascii', function(err, data) {
var matches = data.match(/http:\/\/matchthis\.com/g);
for (var i = 0; i < matches.length; ++i) {
console.log(matches[i]);
}
});
I get:
FATAL ERROR: CALL_AND_RETRY_0 Allocation failed - process out of memory
What is happening with the `node.js` regex engine? Is there any way I can
modify things such that they work in `node`?
**EDIT:** The error appears to be `fs` centric as this also produces the
error:
fs.readFile('file.in', 'ascii', function(err, data) {
});
`file.in` is around 800MB.
Answer: You should process the file line by line using the streaming file interface.
Something like this:
var fs = require('fs');
var byline = require('byline');
var input = fs.createReadStream('tmp.txt');
var lines = input.pipe(byline.createStream());
lines.on('readable', function(){
var line = lines.read().toString('ascii');
var matches = line.match(/http:\/\/matchthis\.com/g);
for (var i = 0; i < matches.length; ++i) {
console.log(matches[i]);
}
});
In this example, I'm using the `byline` module to split the stream into lines
so that you won't miss matches by getting partial chunks of lines per
`.read()` call.
To elaborate more, what you were doing is allocating ~800MB of RAM as a Buffer
(outside of V8's heap) and then converting that to an ASCII string (and thus
transferring it into V8's heap), which will take at least 800MB and likely
more depending on V8's internal optimizations. I believe V8 stores strings as
UCS2 or UTF16, which means each character will be 2 bytes (given ASCII input)
so your string would really be about 1600MB.
Node's max allocated heap space is 1.4GB, so by trying to create such a large
string, you cause V8 to throw an exception.
Python does not have this problem because it does not have a maximum heap size
and will chew through all of your RAM. As others have pointed out, you should
also avoid `fh.read()` in Python since that will copy all the file data into
RAM as a string instead of streaming it line by line with an iterator.
|
Unable to import PIL.Image for qrcode
Question: I run into this weird error, I need to use `qrcode` with `pillow`, so I did
`pip install pillow qrcode` (after initiating the virtual environment). Then,
the following thing happens
>>> from PIL import Image
>>> Image
<module 'PIL.Image' from '/vagrant/env/local/lib/python2.7/site-packages/PIL/Image.pyc'>
>>> import qrcode;
>>> qrcode.make("1").show()
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
File "/vagrant/env/local/lib/python2.7/site-packages/qrcode/main.py", line 8, in make
return qr.make_image()
File "/vagrant/env/local/lib/python2.7/site-packages/qrcode/main.py", line 186, in make_image
from qrcode.image.pil import PilImage
File "/vagrant/env/local/lib/python2.7/site-packages/qrcode/image/pil.py", line 5, in <module>
import Image
ImportError: No module named Image
`from PIL import Image` works but `qrcode` doesn't work. Not sure what is
going on
Answer: install PIL on Ubuntu: <http://askubuntu.com/questions/156484/how-do-i-
install-python-imaging-library-pil>
header for your program, code:
##some magic for 3rd party packages
import site
site.main()
##headers
from PIL import Image
##programm
#here your program!!!
\-- Your friend!!!
|
Django + Boto + Python 3
Question: How can I store my Django uploaded files on S3 using Python 3 on EC2 Amazon
Linux? If I can't, how can I share uploaded files between 2 EC2 instances if
I'm using ELB?
I tried to use the django-storages-py3 + boto#py3kport but it doesn't work,
when I'm trying to upload files I get an exception: `string expected bytes
given`
UPDATE:
This is how I'm using the django-storages-py3 + boto#py3kport
from django.core.files.storage import default_storage
fd = default_storage.open('%s/%s' % ('uploadstg', str(filename)), 'wb')
for chunk in file.chunks():
fd.write(chunk)
fd.close()
fd - S3BotoStorageFile: uploadstg/a6d2532d-34c9-4793-9d43-e9a3e475fc6f.png
file - InMemoryUploadedFile: 1.png (image/png)
**Traceback**
Environment:
Request Method: POST
Request URL: http://---/items/Tpp/create/
Django Version: 1.6.1
Python Version: 3.3.3
Installed Applications:
('django.contrib.admin',
'haystack',
'django.contrib.auth',
'django.contrib.contenttypes',
'django.contrib.sessions',
'django.contrib.messages',
'django.contrib.staticfiles',
'django.contrib.sites',
'modeltranslation',
'south',
'core',
'storages',
'appl')
Installed Middleware:
('django.contrib.sessions.middleware.SessionMiddleware',
'django.middleware.common.CommonMiddleware',
'django.middleware.csrf.CsrfViewMiddleware',
'django.contrib.auth.middleware.AuthenticationMiddleware',
'django.contrib.messages.middleware.MessageMiddleware',
'django.middleware.clickjacking.XFrameOptionsMiddleware',
'tpp.SiteUrlMiddleWare.SiteUrlMiddleWare')
Traceback:
File "/usr/local/bin/test/lib/python3.3/site-packages/django/core/handlers/base.py" in get_response
114. response = wrapped_callback(request, *callback_args, **callback_kwargs)
File "/var/www/html/tpp/tppcenter/views.py" in get_item_form
95. com = form.save(request.user)
File "/var/www/html/tpp/tppcenter/forms.py" in save
212. self._save_file(self.fields[title].initial, title, path_to_images)
File "/var/www/html/tpp/tppcenter/forms.py" in _save_file
239. fd.write(chunk)
File "/usr/local/bin/test/lib/python3.3/site-packages/django_storages-1.1.8-py3.3.egg/storages/backends/s3boto.py" in write
161. return super(S3BotoStorageFile, self).write(*args, **kwargs)
Exception Type: TypeError at /items/Tpp/create/
Exception Value: string argument expected, got 'bytes'
Upload using Django admin:
Environment:
Request Method: POST
Request URL: http://----/admin/core/user/1/
Django Version: 1.6.1
Python Version: 3.3.3
Installed Applications:
('django.contrib.admin',
'haystack',
'django.contrib.auth',
'django.contrib.contenttypes',
'django.contrib.sessions',
'django.contrib.messages',
'django.contrib.staticfiles',
'django.contrib.sites',
'modeltranslation',
'south',
'core',
'storages',
'appl')
Installed Middleware:
('django.contrib.sessions.middleware.SessionMiddleware',
'django.middleware.common.CommonMiddleware',
'django.middleware.csrf.CsrfViewMiddleware',
'django.contrib.auth.middleware.AuthenticationMiddleware',
'django.contrib.messages.middleware.MessageMiddleware',
'django.middleware.clickjacking.XFrameOptionsMiddleware',
'tpp.SiteUrlMiddleWare.SiteUrlMiddleWare')
Traceback:
File "/usr/local/bin/test/lib/python3.3/site-packages/django/core/handlers/base.py" in get_response
114. response = wrapped_callback(request, *callback_args, **callback_kwargs)
File "/usr/local/bin/test/lib/python3.3/site-packages/django/contrib/admin/options.py" in wrapper
432. return self.admin_site.admin_view(view)(*args, **kwargs)
File "/usr/local/bin/test/lib/python3.3/site-packages/django/utils/decorators.py" in _wrapped_view
99. response = view_func(request, *args, **kwargs)
File "/usr/local/bin/test/lib/python3.3/site-packages/django/views/decorators/cache.py" in _wrapped_view_func
52. response = view_func(request, *args, **kwargs)
File "/usr/local/bin/test/lib/python3.3/site-packages/django/contrib/admin/sites.py" in inner
198. return view(request, *args, **kwargs)
File "/usr/local/bin/test/lib/python3.3/site-packages/django/utils/decorators.py" in _wrapper
29. return bound_func(*args, **kwargs)
File "/usr/local/bin/test/lib/python3.3/site-packages/django/utils/decorators.py" in _wrapped_view
99. response = view_func(request, *args, **kwargs)
File "/usr/local/bin/test/lib/python3.3/site-packages/django/utils/decorators.py" in bound_func
25. return func(self, *args2, **kwargs2)
File "/usr/local/bin/test/lib/python3.3/site-packages/django/db/transaction.py" in inner
339. return func(*args, **kwargs)
File "/usr/local/bin/test/lib/python3.3/site-packages/django/contrib/admin/options.py" in change_view
1230. self.save_model(request, new_object, form, True)
File "/usr/local/bin/test/lib/python3.3/site-packages/django/contrib/admin/options.py" in save_model
860. obj.save()
File "/usr/local/bin/test/lib/python3.3/site-packages/django/db/models/base.py" in save
545. force_update=force_update, update_fields=update_fields)
File "/usr/local/bin/test/lib/python3.3/site-packages/django/db/models/base.py" in save_base
573. updated = self._save_table(raw, cls, force_insert, force_update, using, update_fields)
File "/usr/local/bin/test/lib/python3.3/site-packages/django/db/models/base.py" in _save_table
632. for f in non_pks]
File "/usr/local/bin/test/lib/python3.3/site-packages/django/db/models/base.py" in <listcomp>
632. for f in non_pks]
File "/usr/local/bin/test/lib/python3.3/site-packages/django/db/models/fields/files.py" in pre_save
252. file.save(file.name, file, save=False)
File "/usr/local/bin/test/lib/python3.3/site-packages/django/db/models/fields/files.py" in save
86. self.name = self.storage.save(name, content)
File "/usr/local/bin/test/lib/python3.3/site-packages/django/core/files/storage.py" in save
49. name = self._save(name, content)
File "/usr/local/bin/test/lib/python3.3/site-packages/django_storages-1.1.8-py3.3.egg/storages/backends/s3boto.py" in _save
392. self._save_content(key, content, headers=headers)
File "/usr/local/bin/test/lib/python3.3/site-packages/django_storages-1.1.8-py3.3.egg/storages/backends/s3boto.py" in _save_content
403. rewind=True, **kwargs)
File "/usr/local/bin/test/src/boto/build/lib/boto/s3/key.py" in set_contents_from_file
1241. chunked_transfer=chunked_transfer, size=size)
File "/usr/local/bin/test/src/boto/build/lib/boto/s3/key.py" in send_file
726. chunked_transfer=chunked_transfer, size=size)
File "/usr/local/bin/test/src/boto/build/lib/boto/s3/key.py" in _send_file_internal
893. if self.base64md5:
File "/usr/local/bin/test/src/boto/build/lib/boto/s3/key.py" in _get_base64md5
177. return binascii.b2a_base64(self.local_hashes['md5']).rstrip('\n')
Exception Type: TypeError at /admin/core/user/1/
Exception Value: Type str doesn't support the buffer API
Answer: tinys3 - Quick and minimal S3 uploads for Python <https://github.com/smore-
inc/tinys3>
|
How to get the field value and assign to the variable in python
Question: I am using **openerp 6**.My `form` contains one `text box` and I need to get
that value and assign it to a variable so to perform calculations and to
return a result to store in a new `textbox`...
Answer: I have give .py file here. This will calculate square of the number
from osv import osv
from osv import fields
class test_base(osv.osv):
_name='test.base'
_columns={
'first':fields.integer('Enter Number here'),
'result':fields.integer('Display calclation result'),
}
def first_change(self, cr, uid, ids,first,context=None):
r=first*first
return {'value':{'result':r}}
test_base()
xml file is given here
<?xml version="1.0" encoding="utf-8"?>
<openerp>
<data>
<record model="ir.ui.view" id="test_base_form">
<field name="name">test.base.form</field>
<field name="model">test.base</field>
<field name="type">form</field>
<field name="arch" type="xml">
<form string="best Base">
<field name="first" on_change="first_change(first)"/>
<field name="result"/>
</form>
</field>
</record>
<record model="ir.ui.view" id="test_base_tree">
<field name="name">test.base.tree</field>
<field name="model">test.base</field>
<field name="type">tree</field>
<field name="arch" type="xml">
<tree string="Test Base">
<field name="first"/>
<field name="result"/>
</tree>
</field>
</record>
<record model="ir.actions.act_window" id="action_test_seq">
<field name="name">Test Base</field>
<field name="res_model">test.base</field>
<field name="view_type">form</field>
<field name="view_mode">form,tree</field>
</record>
<menuitem id="menu_test_base_main" name="Test Base">
</menuitem>
<menuitem id="menu_test_base_sub" parent="menu_test_base_main" name="Square number" action="action_test_seq">
</menuitem>
</data>
</openerp>
|
shapely and geos break in distance method
Question: I'm having problems using the distance method in shapely (I suspect
incompatibility with the geos package).
The following code:
from shapely.geometry import Point
print Point(0,0).distance(Point(1,1))
creates the following error:
python: GeometryComponentFilter.cpp:34: virtual void geos::geom::GeometryComponentFilter::filter_ro(const geos::geom::Geometry*): Assertion `0' failed.
Aborted (core dumped)
I’m running CentOS 6, python 2.6, geos 3.4.2 (although it creates a link from
libgeos_c to 1.8.2)
Googling it yielded a few old posts which didn't really help me.
Thanks, Raz
Answer: This looks like a GEOS bug ([#535](http://trac.osgeo.org/geos/ticket/535)). As
a work around, try fetching a development snapshot [that appears to solve this
issue](http://trac.osgeo.org/geos/changeset/3960):
svn co http://svn.osgeo.org/geos/trunk@3960 geos-svn
cd geos-svn
./autogen.sh
./configure
make
make check
If the last command throws any similar errors, consider contributing feedback
to the bug report. But if all is good, then it should be good for shapely. As
root:
make install
ldconfig
|
Python- How to check if program gets aborted by user while running?
Question: If I am running a python program on linux terminal and i abort it manually by
pressing ctrl+c, how can i make my program do something when this event
occurs.
something like:
if sys.exit():
print "you chose to end the program"
Answer: Well, you can use `KeyBoardInterrupt`, using a try-except block:
try:
# some code here
except KeyboardInterrupt:
print "You exited
Try the following in your command line:
import time
try:
while True:
time.sleep(1)
print "Hello"
except KeyboardInterrupt:
print "No more Hellos"
|
Struggling to append a relative path to my sys.path
Question: So there are a lot of pretty similar questions but none of the answers seems
to satisfy what I'm looking for.
Essentially I am running a python script using an absolute directory in the
command line.
Within this file itself, I want to import a module/file,I currently use an
absolute path to do this (`sys.path.append(/....)`.
But I would like to use a relative path, relative to the script itself.
All I seem to be able to do is append a path relative to my present working
directory.
How do I do this?
Answer: **Example 1**
main script: /some/path/foo/foo.py
module to import: /some/path/foo/bar/sub/dir/mymodule.py
Add in `foo.py`
import sys, os
sys.path.append(os.path.join(sys.path[0],'bar','sub','dir'))
from mymodule import MyModule
* * *
**Example 2**
main script: /some/path/work/foo/foo.py
module to import: /some/path/work/bar/mymodule.py
Add in `foo.py`
import sys, os
sys.path.append(os.path.join(os.path.dirname(sys.path[0]),'bar'))
from mymodule import MyModule
* * *
**These two above examples should cover all use cases**
* These two above examples apply to both Python versions 2 and 3
* `sys.path[0]` is `/some/path/foo` in the two examples
* `os.path.join('a','b','c')` is more portable than `'a/b/c'`
* `os.path.dirname(mydir)` is more portable than `os.path.join(mydir,'..')`
See also documentation about importing modules:
* in [Python 2](https://docs.python.org/2/tutorial/modules.html)
* in [Python 3](https://docs.python.org/3/tutorial/modules.html)
|
subprocess.Popen("ssh host@remote cmd") failed
Question: I'm new to python subprocess. When I want to use python
subprocess.Popen.communicate to accomplish interact passwd with shell cmd "net
ads join -U administrator", it's output didn't redirect into PIPE, but in
stdout.My code is under:
import subprocess
import os
import sys
passwd = b'123456'
cmd = "net ads join -U administrator"
s1 = ("%s\n" % str(passwd)).encode('utf-8')
p1 = subprocess.Popen(cmd1,shell=True,stdin=subprocess.PIPE,stdout=subprocess.PIPE,
stderr=subprocess.PIPE,close_fds=True)
out,err = p1.communicate(s1)
print(out)
When I run the test, communicate didn't work, the output still in the stdout.
$ python ads.py
Enter administrator's password:
When I change the cmd to "ssh root@ip ls /", I also met with the problem.
I tried pdb, but the problem seems not here. Any advise to deal with this
problem? Thank You
Answer: Here is a snippet class for SSH and run command remotely, that I used in one
of my scripts, please let me know if that works, Here I am using python
standard [PTY Module](http://docs.python.org/2/library/pty.html) for pseudo
terminal.
import pty
import os
import re
class BaseError(Exception):
pass
class SSHError(BaseError):
pass
class Ssh:
"""SSH on the box"""
def __init__(self, ip, passwd, user, port):
self.ip = ip
self.passwd = passwd
self.user = user
self.port = port
def run_cmd(self, c):
(pid, f) = pty.fork()
if pid == 0:
os.execlp(
"ssh", "ssh", '-o ConnectTimeout=10',
'-o StrictHostKeyChecking=no',
'-o UserKnownHostsFile=/dev/null', '-q',
'-p %d' % self.port,
self.user + '@' + self.ip, c)
else:
return (pid, f)
def run_scp(self, src, dst):
(pid, f) = pty.fork()
if pid == 0:
os.execlp(
"scp", "scp", '-o StrictHostKeyChecking=no',
'-o UserKnownHostsFile=/dev/null', '-q',
'-P %d' % self.port, "-r", src,
self.user + '@' + self.ip + ':' + dst)
else:
return (pid, f)
def read(self, f):
x = ""
try:
x = os.read(f, 2024)
except Exception:
pass
return x
def sshOutputs(self, pid, f):
output = ""
readOutLoud = self.read(f)
m = re.search("authenticity of host", readOutLoud)
if m:
os.write(f, 'yes\n')
while True:
readOutLoud = self.read(f)
m = re.search("Permanently added", readOutLoud)
if m:
break
readOutLoud = self.read(f)
m = re.search("assword:", readOutLoud)
if m:
os.write(f, self.passwd + '\n')
tmp = self.read(f)
tmp += self.read(f)
m = re.search("Permission denied", tmp)
if m:
raise SSHError("Invalid passwd")
p = re.search("[pP]assword", tmp)
if p:
raise SSHError("Invalid passwd")
# passwd was accepted
readOutLoud = tmp
while readOutLoud and len(readOutLoud) > 0:
output += readOutLoud
readOutLoud = self.read(f)
os.waitpid(pid, 0)
os.close(f)
return output
def exe_ssh_cmd(self, c):
(pid, f) = self.run_cmd(c)
return self.sshOutputs(pid, f)
def exe_scp_cmd(self, src, dst):
(pid, f) = self.run_scp(src, dst)
return self.sshOutputs(pid, f)
|
Splitting string and removing whitespace Python
Question: I would like to split a String by comma `','` and remove whitespace from the
beginning and end of each split.
For example, if I have the string:
`"QVOD, Baidu Player"`
I would like to split and strip to:
`['QVOD', 'Baidu Player']`
Is there an elegant way of doing this? Possibly using a list comprehension?
Answer: Python has a spectacular function called `split` that will keep you from
having to use a regex or something similar. You can split your string by just
calling `my_string.split(delimiter)`
After that python has a `strip` function which will remove all whitespace from
the beginning and end of a string.
[item.strip() for item in my_string.split(',')]
Benchmarks for the two methods are below:
>>> import timeit
>>> timeit.timeit('map(str.strip, "QVOD, Baidu Player".split(","))', number=100000)
0.3525350093841553
>>> timeit.timeit('map(stripper, "QVOD, Baidu Player".split(","))','stripper=str.strip', number=100000)
0.31575989723205566
>>> timeit.timeit("[item.strip() for item in 'QVOD, Baidu Player'.split(',')]", number=100000)
0.246596097946167
So the list comp is about 33% faster than the map.
Probably also worth noting that as far as being "pythonic" goes, Guido himself
votes for the LC. <http://www.artima.com/weblogs/viewpost.jsp?thread=98196>
|
Changing Microsoft Query in Excel with Python (pywin32) or VBA
Question: I need to create reports for the financial year of the individual sales of
each customer (around 500) from 1-Apr 2014 to 31-Mar 2015. Last year when I
did this I went in to each report from the previous year and simply changed
the date in the query so it brought through that financial year. However, our
customer base has grown even further and now it looks like I'll spend hours
doing this unless I find out a way to change the query in the background.
I can go through each worksheet in the folder containing these reports and
open each file for editing:
import os, pythoncom
from win32com.client import Dispatch
for path, subdirs, files in os.walk("location\of\folder"):
# Open each workbook
for filename in files:
xl = Dispatch("Excel.Application")
wb = xl.Workbooks.Add(path+"\\"+filename)
ws = wb.Worksheets(1)
# Method to alter the query here!!!!
# Would even be open to doing this with VBA and just calling a macro to run
# change the query if that's possible?!
wb.Close()
xl.Quit()
pythoncom.CoUninitialize()
Any help would be greatly appreciated, as it's likely to save me hours upon
hours of monotonous work.
Many thanks!
I have just tried the following method for trying to change the SQL using VBA.
Sub change_date()
Sheets(1).Select
ActiveSheet.QueryTables(1).CommandText = Replace(ActiveSheet.QueryTables(1).CommandText, "WHERE (Customers.InvoiceDate>={ts '2013-04-01 00:00:00'} And Customers.InvoiceDate<={ts '2014-03-31 00:00:00'})", "WHERE (Customers.InvoiceDate>={ts '2014-04-01 00:00:00'} And Customers.InvoiceDate<={ts '2015-03-31 00:00:00'})")
End Sub
But I am getting a Runtime (9) error: Subscript Out of Range.
Any help would be appreciated.
Answer: I've figured it out for all who are concerned.
Sub change_date()
Dim sh As Worksheet, LO As ListObject, QT As QueryTable
Set sh = ActiveSheet
Set QT = sh.ListObjects.Item(1).QueryTable
With QT
.CommandType = xlCmdSql
.CommandText = Replace(QT.CommandText, "WHERE (Customers.InvoiceDate>={ts '2013-04-01 00:00:00'} And Customers.InvoiceDate<={ts '2014-03-31 00:00:00'})", "WHERE (Customers.InvoiceDate>={ts '2014-04-01 00:00:00'} And Customers.InvoiceDate<={ts '2015-03-31 00:00:00'})")
.Refresh
End With
End Sub
|
python list generation/saving bug
Question: I am trying to make program that prints all the possible combinations for `a`
to `zzz`. I tried to add a save state feature, and it works fine but there is
this bug.
Let's say I interrupted the program when it printed something like `e`. When I
execute the program again, it works fine until `z` but after `z` instead of
printing `aa` it prints `ba` and continues from `ba`. This happens right after
it prints `zz` too. it prints `baa` instead of `aaa`. How can I fix this?
Here is what I did so far:
import pickle,os,time
alphabet="abcdefghijklmnopqrstuvwxyz"
try:
if os.path.isfile("save.pickle")==True:
with open("save.pickle","rb") as f:
tryn=pickle.load(f)
for i in range(3):
a=[x for x in alphabet]
for j in range(i):
a=[x+i for x in alphabet for i in a]
b=a[tryn:]
for k in b:
print(k)
time.sleep(0.01)
tryn+=1
else:
tryn=0
for i in range(3):
a=[x for x in alphabet]
for j in range(i):
a=[x+i for x in alphabet for i in a]
for k in a:
print(k)
tryn+=1
time.sleep(0.01)
except KeyboardInterrupt:
with open("save.pickle","wb") as f:
pickle.dump(tryn,f)
Answer: If you're using python2, or python3 as the tag suggests, this exists in the
standard library already. See itertools, [product
py2](http://docs.python.org/2/library/itertools.html#itertools.product), and
[product
py3](http://docs.python.org/3/library/itertools.html#itertools.product), for a
simple way to solve this problem.
|
Make python process stop/wait/sleep for 0.2 seconds [Works]
Question: Title says it all, is it possible to make python sleep for less than a second?
WORKS:
import time
print ("foo")
time.sleep(0.2) #talking about the value of the time
print ("bar")
If not, then is there any other way? Thanks Using python 3.2.2 EDIT: Thanks
guys, I'm pretty sure I have tried the above code before and it didn't work.
Oh well... sorry for your waste if time. It worked now and I upgraded to 3.3
Answer: Based on the
[`time.sleep()`](http://docs.python.org/3/library/time.html#time.sleep)
documentation:
> The actual suspension time **may be less than** that requested because any
> caught signal will terminate the sleep() following execution of that
> signal’s catching routine. Also, the suspension time **may be longer than**
> requested by an arbitrary amount because of the scheduling of other activity
> in the system.
So it works but there are no guarantees.
|
python scientific notation with forced leading zero
Question: I want to have Python2.7 print out floating point numbers in scientific
notation, forced to start with 0. For instance, assume
a=1234567890e12
print '{:22.16E}'.format(a)
1.2345678900000000E+21
However, I want a print output that looks like:
0.1234567890000000E+22
Notice that the exponent is raised by one since the desired output is forced
to a leading zero. How can I achieve this? Thanks.
Answer: The fortranformat package will do what you are looking for.
import fortranformat as ff
a=1234567890e12
lineformat = ff.FortranRecordWriter('(1E26.16)')
lineformat.write([a])
Output:
' 0.1234567890000000E+22'
|
Making Python 2.7 code run with Python 2.6
Question: I have this simply python function that can extract a zip file (platform
independent)
def unzip(source, target):
with zipfile.ZipFile(source , "r") as z:
z.extractall(target)
print "Extracted : " + source + " to: " + target
This runs fine with Python 2.7 but fails with Python 2.6:
AttributeError: ZipFile instance has no attribute '__exit__':
I found this suggestions that an upgrade is required 2.6 -> 2.7
<https://bugs.launchpad.net/horizon/+bug/955994>
But is it possible to port the above code to work with Python 2.6 and still
keep it cross platform?
Answer: What about:
import contextlib
def unzip(source, target):
with contextlib.closing(zipfile.ZipFile(source , "r")) as z:
z.extractall(target)
print "Extracted : " + source + " to: " + target
`contextlib.closing` does exactly what the missing `__exit__` method on the
`ZipFile` would be supposed to do. Namely, call the `close` method
|
adding lines to a file in it doesnt exist in python
Question: so what i am doing is first reading the /var/log/secure file for ipaddresses
that i want to block and saving that list to a file. then i am trying read
that file and determine if the address is outside of the US, and if it is,
then i want to block the address in the iptables.
i also want to predetermine if that address has already been added to the
iptables before i write to it:
#!/usr/bin/env python
import GeoIP
import os
os.system("cat /var/log/secure | grep 'Failed password for invalid user' | grep -oE '((1?[0-9][0-9]?|2[0-4][0-9]|25[0-5])\.){3}(1?[0-9][0-9]?|2[0-4][0-9]|25[0-5])' >> /home/user/ipaddresses.txt")
iptables_file = open('/etc/sysconfig/iptables', 'r')
loglist = iptables_file.readlines()
iptables_file.close()
found = False
gi = GeoIP.new(GeoIP.GEOIP_MEMORY_CACHE)
for line in file("/home/user/ipaddresses.txt", "r"):
line = line[:-1] # strip the last from the line
#print line, "-", gi.country_code_by_addr(line)
if str(gi.country_code_by_addr(line)) != "US":
for ip in loglist:
if str(line) in line:
print str(line) + " found in iptables, skipping ip address"
break
else:
print "adding " + str(line) + " to iptables"
#os.system("iptables -A INPUT -s " + str(line) + " -j DROP")
#os.system("service iptables save")
obviously i dont want to write to my iptables until i know that its working so
thats why i have it commented out. what am i doing wrong? this is the error:
grep: write error
cat: write error: Broken pipe
Answer: The second grep command:
grep -oE '((1?[0-9]...[0-5])' /var/log/secure
has /var/log/secure as an argument. That should not be there. It is reading
the file and not reading standard input, and that is causing the error.
|
how to turn a sorted list into tab delimited values in Python?
Question: I have a sorted list that looks like this [('100','abc'),('99','bca')]. I want
to turn this into something like this into a text file.
abc 100<br>
bca 99
I have tried this
import csv
writer = csv.writer(f, delimiter = '\t')
writer.writerows(d)
but this gives me the output as:
100 abc<br>
99 bca
Answer: Using the [csv module](http://docs.python.org/2/library/csv.html), this is
pretty straight-forward:
import csv
data = [('100','abc'),('99','bca')]
# Use 'w' for other OS's than Windows
with open('my_data.csv', 'wb') as ofile:
writer = csv.writer(ofile, delimiter='\t')
for row in data:
writer.writerow(list(reversed(row)))
**`my_data.csv`:**
abc 100
bca 99
|
Does nitrous.io support the endpoint library?
Question: Developing a python project on the platform and attempting [appengine
endpoints](https://developers.google.com/appengine/docs/python/endpoints/getstarted/backend/write_api).
`import endpoints` throws `google.appengine.api.yaml_errors.EventError: the
library "endpoints" is not supported`. The full stack trace is below.
Traceback (most recent call last):
File "/home/action/.google_appengine/dev_appserver.py", line 182, in <module>
_run_file(__file__, globals())
File "/home/action/.google_appengine/dev_appserver.py", line 178, in _run_file
execfile(script_path, globals_)
File "/home/action/.google_appengine/google/appengine/tools/devappserver2/devappserver2.py", line 695, in <module>
main()
File "/home/action/.google_appengine/google/appengine/tools/devappserver2/devappserver2.py", line 688, in main
dev_server.start(options)
File "/home/action/.google_appengine/google/appengine/tools/devappserver2/devappserver2.py", line 525, in start
options.yaml_files)
File "/home/action/.google_appengine/google/appengine/tools/devappserver2/application_configuration.py", line 556, in __init__
server_configuration = ServerConfiguration(yaml_path)
File "/home/action/.google_appengine/google/appengine/tools/devappserver2/application_configuration.py", line 82, in __init__
self._yaml_path)
File "/home/action/.google_appengine/google/appengine/tools/devappserver2/application_configuration.py", line 272, in _parse_configuration
return appinfo_includes.ParseAndReturnIncludePaths(f)
File "/home/action/.google_appengine/google/appengine/api/appinfo_includes.py", line 63, in ParseAndReturnIncludePaths
appyaml = appinfo.LoadSingleAppInfo(appinfo_file)
File "/home/action/.google_appengine/google/appengine/api/appinfo.py", line 1715, in LoadSingleAppInfo
listener.Parse(app_info)
File "/home/action/.google_appengine/google/appengine/api/yaml_listener.py", line 226, in Parse
self._HandleEvents(self._GenerateEventParameters(stream, loader_class))
File "/home/action/.google_appengine/google/appengine/api/yaml_listener.py", line 177, in _HandleEvents
raise yaml_errors.EventError(e, event_object)
google.appengine.api.yaml_errors.EventError: the library "endpoints" is not supported
in "./app.yaml", line 21, column 1
Answer: 1. Start with a non-python project.
2. Download appengine for Linux python:
` curl -O
http://googleappengine.googlecode.com/files/google_appengine_1.8.9.zip `
3. Unzip and export directory in `~/.bash_profile`:
` export PATH="$HOME/google_appengine:$PATH" `
4. Build endpoint python app [as described](https://developers.google.com/appengine/docs/python/endpoints/getstarted/backend/write_api) and run `dev_appserver.py`.
5. You can't view the Google APIs Explorer when launched from Nitrous.io, unless you [port forward](http://help.nitrous.io/nitrous-desktop/), but you can still use as a developing endpoint.
|
Installing LightBlue (BlueTooth) for Python
Question: I'm trying to import lightblue for Python. I have a brand new Mac (so 10.9 I
believe), I have Xcode installed, and I am running...
Python 2.7.6 :: Anaconda 1.8.0 (x86_64)
I downloaded lightblue-0.4.tar.gz to my desktop and then ran
$ python setup.py install
and I keep getting this message:
xcode-select: error: tool 'xcodebuild' requires Xcode, but active developer
directory '/Library/Developer/CommandLineTools' is a command line tools
instance
and when I try to import lightblue in python I get this error message:
---------------------------------------------------------------------------
ImportError Traceback (most recent call last)
<ipython-input-1-7fea8c968f08> in <module>()
----> 1 import lightblue
.
.
.
/Users/home/anaconda/lib/python2.7/site-packages/lightblue/_LightAquaBlue.py in <module>()
30 if not os.path.isdir(_FRAMEWORK_PATH):
31 raise ImportError("Cannot load LightAquaBlue framework, not found at" + \
---> 32 _FRAMEWORK_PATH)
33
34 try:
ImportError: Cannot load LightAquaBlue framework, not found
at/Library/Frameworks/LightAquaBlue.framework
Any ideas?
Thanks,
John
Answer: The Xcode Command Line Tools are not automatically installed when you install
Xcode.
If you already have the latest version of Xcode, the Command Line Tools can be
obtained from Apple as a seperate package that can be downloaded and
installed.
You can install Xcode Command Line Tools at the command line (via
Terminal.app) like so:
/usr/bin/sudo /usr/bin/xcode-select --install
A new window will appear to request permission and manage the download.
|
Count how many matrices have full rank for all submatrices
Question: I would like to count how many m by n matrices whose elements are 1 or -1 have
the property that all its `floor(m/2)+1 by n` submatrices have full rank. My
current method is naive and slow and is in the following python/numpy code. It
simply iterates over all matrices and tests all the submatrices.
import numpy as np
import itertools
from scipy.misc import comb
m = 8
n = 4
rowstochoose = int(np.floor(m/2)+1)
maxnumber = comb(m, rowstochoose, exact = True)
matrix_g=(np.array(x).reshape(m,n) for x in itertools.product([-1,1], repeat = m*n))
nofound = 0
for A in matrix_g:
count = 0
for rows in itertools.combinations(range(m), int(rowstochoose)):
if (np.linalg.matrix_rank(A[list(rows)]) == int(min(n,rowstochoose))):
count+=1
else:
break
if (count == maxnumber):
nofound+=1
print nofound, 2**(m*n)
Is there a better/faster way to do this? I would like to do this calculation
for n and m up to 20 but any significant improvements would be great.
**Context.** I am interested in getting some exact solutions for
<http://math.stackexchange.com/questions/640780/probability-that-every-vector-
is-not-orthogonal-to-half-of-the-others> .
* * *
As a data point to compare implementations. `n,m = 4,4` should output 26880 .
`n,m=5,5` is too slow for me to run. For `n =` 2 and `m = 2,3,4,5,6` the
outputs should be `8, 0, 96, 0, 1280`.
* * *
**Current status Feb 2, 2014:**
* The answer of leewangzhong is fast but is not correct for m > n . leewangzhong is considering how to fix it.
* The answer of Hooked does not run for m > n .
Answer: (Now a partial solution for n = m//2+1, and the requested code.)
Let k := m//2+1
This is somewhat equivalent to asking, "How many collections of m
n-dimensional vectors of {-1,1} have no linearly dependent sets of size
min(k,n)?"
For those matrices, we know or can assume:
* The first entry of every vector is 1 (if not, multiply the whole by -1). This reduces the count by a factor of 2**m.
* All vectors in the list are distinct (if not, any submatrix with two identical vectors has non-full rank). This eliminates a lot. There are choose(2**m,n) matrices of distinct vectors.
* The list of vectors are sorted lexicographically (rank isn't affected by permutations). So we're really thinking about sets of vectors instead of lists. This reduces the count by a factor of m! (because we require distinctness).
With this, we have a solution for n=4, m=8. There are only eight different
vectors with the property that the first entry is positive. There is only one
combination (sorted list) of 8 distinct vectors from 8 distinct vectors.
array([[ 1, 1, 1, 1],
[ 1, 1, 1, -1],
[ 1, 1, -1, 1],
[ 1, 1, -1, -1],
[ 1, -1, 1, 1],
[ 1, -1, 1, -1],
[ 1, -1, -1, 1],
[ 1, -1, -1, -1]], dtype=int8)
100 size-4 combinations from this list have rank 3. So there are 0 matrices
with the property.
* * *
For a more general solution:
Note that there are `2**(n-1)` vectors with first coordinate -1, and
`choose(2**(n-1),m)` matrices to inspect. For n=8 and m=8, there are 128
vectors, and 1.4297027e+12 matrices. It might help to answer, "For i=1,...,k,
how many combinations have rank i?"
Alternatively, "What kind of matrices (with the above assumptions) have less
than full rank?" ~~And I think the answer is exactly,~~ A sufficient condition
is, "Two columns are multiples of each other". ~~I have a feeling that this is
true, and I tested this for all 4x4, 5x5, and 6x6 matrices.~~(Must've screwed
up the tests) Since the first column was chosen to be homogeneous, and since
all homogeneous vectors are multiples of each other, any submatrix of size k
with a homogeneous column other than the first column will have rank less than
k.
This is not a necessary condition, though. The following matrix is singular
(first plus fourth is equal to third plus second).
array([[ 1, 1, 1, 1, 1],
[ 1, 1, 1, 1, -1],
[ 1, 1, -1, -1, 1],
[ 1, 1, -1, -1, -1],
[ 1, -1, 1, -1, 1]], dtype=int8)
Since there are only two possible values (-1 and 1), all mxn matrices where
`m>2, k := m//2+1, n = k` and with first column -1 have a majority member in
each column (i.e. at least k members are the same). So for n=k, the answer is
0.
* * *
For n<=8, here's code to generate the vectors.
from numpy import unpackbits, arange, uint8, int8
#all distinct n-length vectors from -1,1 with first entry -1
def nvectors(n):
if n > 8:
raise ValueError #is that the right error?
return -1 + 2 * (
#explode binary numbers to arrays of 8 zeroes and ones
unpackbits(arange(2**(n-1),dtype=uint8)) #unpackbits only takes uint
.reshape((-1,8)) #unpackbits flattens, so we need to shape it to 8 bits
[:,-n:] #only take the last n bytes
.view(int8) #need signed
)
Matrix generator:
#generate all length-m matrices that are combinations of distinct n-vectors
def matrix_g(n,m):
return (array(mat) for mat in combinations(nvectors(n),m))
The following is a function to check that all submatrices of length maxrank
have full rank. It stops if any have less than maxrank, instead of checking
all combinations.
rankof = np.linalg.matrix_rank
#all submatrices of at least half size have maxrank
#(we only need to check the maxrank-sized matrices)
def halfrank(matrix,maxrank):
return all(rankof(submatr) == maxrank for submatr in combinations(matrix,maxrank))
Generate all matrices that have all half-matrices with full rank def
nicematrices(m,n): maxrank = min(m//2+1,n) return (matr for matr in
matrix_g(n,m) if halfrank(matr,maxrank))
Putting it all together:
import numpy as np
from numpy import unpackbits, arange, uint8, int8, array
from itertools import combinations
#all distinct n-length vectors from -1,1 with first entry -1
def nvectors(n):
if n > 8:
raise ValueError #is that the right error?
if n==0:
return array([])
return -1 + 2 * (
#explode binary numbers to arrays of 8 zeroes and ones
unpackbits(arange(2**(n-1),dtype=uint8)) #unpackbits only takes uint
.reshape((-1,8)) #unpackbits flattens, so we need to shape it to 8 bits
[:,-n:] #only take the last n bytes
.view(int8) #need signed
)
#generate all length-m matrices that are combinations of distinct n-vectors
def matrix_g(n,m):
return (array(mat) for mat in combinations(nvectors(n),m))
rankof = np.linalg.matrix_rank
#all submatrices of at least half size have maxrank
#(we only need to check the maxrank-sized matrices)
def halfrank(matrix,maxrank):
return all(rankof(submatr) == maxrank for submatr in combinations(matrix,maxrank))
#generate all matrices that have all half-matrices with full rank
def nicematrices(m,n):
maxrank = min(m//2+1,n)
return (matr for matr in matrix_g(n,m) if halfrank(matr,maxrank))
#returns (number of nice matrices, number of all matrices)
def count_nicematrices(m,n):
from math import factorial
return (len(list(nicematrices(m,n)))*factorial(m)*2**m, 2**(m*n))
for i in range(0,6):
print (i, count_nicematrices(i,i))
`count_nicematrices(5,5)` takes about 15 seconds for me, the vast majority of
which is taken by the `matrix_rank` function.
|
Celery import error
Question: I am hitting an import error in starting celery. This is confusing, because
this was working a few days ago, and git shows nothing changed. I think
celery's heuristics for import directories are colliding with my split-out
setting structure, and maybe my path/env is different than it was when the
invokation was working? How should I tweak my invokation or environment to
help celery load all of its downstream imports? This is Celery 3.1.7 and
Django 1.6.
My invokation:
celery worker --app=proj.proj
The error:
Traceback (most recent call last):
File "/home/ben/.virtualenvs/proj/bin/celery", line 8, in <module>
load_entry_point('celery==3.1.7', 'console_scripts', 'celery')()
File "/home/ben/.virtualenvs/proj/local/lib/python2.7/site-packages/celery/__main__.py", line 30, in main
main()
File "/home/ben/.virtualenvs/proj/local/lib/python2.7/site-packages/celery/bin/celery.py", line 80, in main
cmd.execute_from_commandline(argv)
File "/home/ben/.virtualenvs/proj/local/lib/python2.7/site-packages/celery/bin/celery.py", line 723, in execute_from_commandline
super(CeleryCommand, self).execute_from_commandline(argv)))
File "/home/ben/.virtualenvs/proj/local/lib/python2.7/site-packages/celery/bin/base.py", line 303, in execute_from_commandline
return self.handle_argv(self.prog_name, argv[1:])
File "/home/ben/.virtualenvs/proj/local/lib/python2.7/site-packages/celery/bin/celery.py", line 715, in handle_argv
return self.execute(command, argv)
File "/home/ben/.virtualenvs/proj/local/lib/python2.7/site-packages/celery/bin/celery.py", line 669, in execute
).run_from_argv(self.prog_name, argv[1:], command=argv[0])
File "/home/ben/.virtualenvs/proj/local/lib/python2.7/site-packages/celery/bin/worker.py", line 175, in run_from_argv
return self(*args, **options)
File "/home/ben/.virtualenvs/proj/local/lib/python2.7/site-packages/celery/bin/base.py", line 266, in __call__
ret = self.run(*args, **kwargs)
File "/home/ben/.virtualenvs/proj/local/lib/python2.7/site-packages/celery/bin/worker.py", line 208, in run
state_db=self.node_format(state_db, hostname), **kwargs
File "/home/ben/.virtualenvs/proj/local/lib/python2.7/site-packages/celery/worker/__init__.py", line 95, in __init__
self.app.loader.init_worker()
File "/home/ben/.virtualenvs/proj/local/lib/python2.7/site-packages/celery/loaders/base.py", line 128, in init_worker
self.import_default_modules()
File "/home/ben/.virtualenvs/proj/local/lib/python2.7/site-packages/celery/loaders/base.py", line 121, in import_default_modules
tuple(maybe_list(self.app.conf.CELERY_INCLUDE))
File "/home/ben/.virtualenvs/proj/local/lib/python2.7/site-packages/celery/loaders/base.py", line 103, in import_task_module
return self.import_from_cwd(module)
File "/home/ben/.virtualenvs/proj/local/lib/python2.7/site-packages/celery/loaders/base.py", line 112, in import_from_cwd
package=package,
File "/home/ben/.virtualenvs/proj/local/lib/python2.7/site-packages/celery/utils/imports.py", line 101, in import_from_cwd
return imp(module, package=package)
File "/home/ben/.virtualenvs/proj/local/lib/python2.7/site-packages/celery/loaders/base.py", line 106, in import_module
return importlib.import_module(module, package=package)
File "/usr/lib/python2.7/importlib/__init__.py", line 37, in import_module
__import__(name)
File "/home/ben/Projects/proj/proj/proj/matches/management/tasks/valve_api_calls.py", line 9, in <module>
from matches.models import Match, LobbyType, GameMode,\
File "/home/ben/Projects/proj/proj/proj/matches/models.py", line 1, in <module>
from django.db import models
File "/home/ben/.virtualenvs/proj/local/lib/python2.7/site-packages/django/db/__init__.py", line 11, in <module>
if settings.DATABASES and DEFAULT_DB_ALIAS not in settings.DATABASES:
File "/home/ben/.virtualenvs/proj/local/lib/python2.7/site-packages/django/conf/__init__.py", line 53, in __getattr__
self._setup(name)
File "/home/ben/.virtualenvs/proj/local/lib/python2.7/site-packages/django/conf/__init__.py", line 48, in _setup
self._wrapped = Settings(settings_module)
File "/home/ben/.virtualenvs/proj/local/lib/python2.7/site-packages/django/conf/__init__.py", line 134, in __init__
raise ImportError("Could not import settings '%s' (Is it on sys.path?): %s" % (self.SETTINGS_MODULE, e))
ImportError: Could not import settings 'proj.settings.local' (Is it on sys.path?): No module named settings.local
My project looks like:
proj <git root>
└──proj <project root>
└── manage.py
└── proj <project app>
└── celery_app.py
└── settings
└── local.py
My env vars are:
DJANGO_SETTINGS_MODULE=proj.settings.local
DJANGO_PROJECT_DIR=/home/ben/Projects/proj/proj/proj
EDIT: I am using virtualenv, so my $PATH on startup looks like
PATH=/home/ben/.virtualenvs/proj/bin:
/usr/local/heroku/bin:/usr/lib/lightdm/lightdm:
/usr/local/sbin:/usr/local/bin:
/usr/sbin:
/usr/bin:
/sbin:
/bin:
/usr/games:
/usr/local/games
Answer: My virtualenv got corrupted somehow. A new virtualenv with identical env vars
and installed software works.
|
Bottle framework: how to return datetime in JSON response
Question: When I try to return JSON containing `datetime` value, I'm getting
File "/usr/lib/python2.7/json/encoder.py", line 178, in default
raise TypeError(repr(o) + " is not JSON serializable")
TypeError: datetime.datetime(2014, 2, 1, 0, 0) is not JSON serializable
Which is normal. Is there an easy way to add an object hook to `bottle` like
from bson import json_util
import json
json.dumps(anObject, default=json_util.default)
to get `datetime` values converted?
Answer: Interesting question! I can see a couple of ways of doing this. The one would
be to write a custom plugin that wraps the `JSONPlugin`:
from bottle import route, run, install, JSONPlugin
from bson import json_util
class JSONDefaultPlugin(JSONPlugin):
def __init__(self):
super(JSONDefaultPlugin, self).__init__()
self.plain_dump = self.json_dumps
self.json_dumps = lambda body: self.plain_dump(body, default=json_util.default)
Which can then be used like this:
@route('/hello')
def index(name):
return {'test': datetime.datetime(2014, 2, 1, 0, 0)}
install(JSONDefaultPlugin())
run(host='localhost', port=8080)
And will give output like this:
{"test": {"$date": 1391212800000}}
Another, shorter, way is to simply specify the `json_loads` parameter when
instantiating the JSONPlugin class:
import json
from bson import json_util
install(JSONPlugin(json_dumps=lambda body: json.dumps(body, default=json_util.default)))
This produces the same result.
### Background
This all makes a little more sense when you look at the [source code for
bottle](https://github.com/defnull/bottle/blob/master/bottle.py) (some parts
removed below for brevity):
class JSONPlugin(object):
name = 'json'
api = 2
def __init__(self, json_dumps=json_dumps):
self.json_dumps = json_dumps
def apply(self, callback, route):
dumps = self.json_dumps
if not dumps: return callback
def wrapper(*a, **ka):
...
if isinstance(rv, dict):
...
elif isinstance(rv, HTTPResponse) and isinstance(rv.body, dict):
rv.body = dumps(rv.body)
rv.content_type = 'application/json'
return rv
return wrapper
All we need to do is make sure the call to `dumps` there receives the
`default` keyword argument you wish to provide.
|
How to take sum and average of indexed values in a list?
Question: List B is expanded at index positions where list A has adjacent matching
values using [groupby](http://docs.python.org/2/library/itertools.html)
A = [476, 1440, 3060, 3060, 500,500]
B = [0,4,10,15]
so resultant list is:
B_update1 = [0,4,10,10,15,15]
which after some intermediate steps will be:
B_update2 = [0,4,12,10,20,20]
Now I want to take sum and mean of duplicated values which will give me back:
B_mean = [0,4,11,20]
B_sum = [0,4,22,40]
I am not sure how to do it. Any suggestions?
Answer:
B_update1, B_update2, B_mean, B_sum = [0,4,10,10,15,15], [0,4,12,10,20,20], [],[]
from itertools import groupby
from operator import itemgetter
for num, grp in groupby(enumerate(B_update1), itemgetter(1)):
tmp_list = [B_update2[idx] for idx, _ in grp]
B_mean.append(sum(tmp_list)/len(tmp_list))
B_sum.append(sum(tmp_list))
print B_mean, B_sum
**Output**
[0, 4, 11, 20] [0, 4, 22, 40]
|
creating surface data for axes3d
Question: Okay, apologies for this question but I'm pulling my hair out here.
I have a data structure loaded in python in the form:
[(1,0,#),(1,1,#),(1,2,#),(1,3,#),(2,0,#),(2,1,#) ... (26,3,#)]
with # being a different number each time that I wish to represent on the
z-axis. You can see that x and y are always integers.
Plotting a scatter graph is simple:
x,y,z = zip(*data)
fig = plt.figure()
ax = fig.gca(projection = '3d')
surface = ax.scatter(x, y, z)
plt.show()
But when it comes to surfaces, I can see two methods:
1) Call `ax.plot_trisurf()`, which should work with 1D arrays similar to
`ax.scatter()` and apparently works
[here](http://stackoverflow.com/questions/17367558/plot-a-3d-surface-from-x-y-
z-scatter-data-in-python), but for me gives me an error:
"AttributeError: Axes3D subplot object has not attribute 'plot_trisurf'"
This error also appears if I use the example source code at:
<http://matplotlib.org/mpl_toolkits/mplot3d/tutorial.html#tri-surface-plots>,
suggesting it's something wrong with my installation - my Matplotlib version
is 1.1.1rc,. This error does not appear if, for example, `ax.plot_surface()`
is called, nor `ax.scatter()`.
2) Use `meshgrid()` or `griddata()` in combination with `ax.plot_surface()` \-
in either case, after two days' of pouring over the documentation and
examples, I still don't understand how to correctly use these in my case,
particularly when it comes to generating the values for Z.
Any help would be much appreciated.
Answer: To address your first question (1) I believe you need to import `Axes3D` from
the `mplot3d` library, even if you're not directly calling it. Maybe try
adding
from mpl_toolkits.mplot3d import Axes3D
before your main code (this line triggered a memory while reading [the
tutorial](http://matplotlib.org/mpl_toolkits/mplot3d/tutorial.html)).
As for (2), `X`, `Y` and `Z` need to be matrix (2d array) type objects. This
can get confusing, but you may consider an example:
# two arrays - one for each axis
x = np.arange(-5, 5, 0.25)
y = np.arange(-5, 5, 0.25)
# create a mesh / matrix like object from the arrays
X, Y = np.meshgrid(x, y)
# create Z values - also in a mesh like shape
Z = np.sin(np.sqrt(X**2 + Y**2))
# plot!
surface = ax.plot_surface(X, Y, Z)
|
Find the most recent file on a http server (python)
Question: I have a site: <http://planet.osm.ch/replication/hour/000/006/> and I need to
get the most recent file listed on the server. How can I accomplish this
through python 2.6.x and using only the standard library.
Thank you
Edit:
When I mean the most recent, I mean the most recent files listed by the date
field.
Answer: Many people prefer to use Beautiful Soup for these tasks. But since you want
to use only the standard library , here is a quick solution using the re and
urllib2 modules.
import urllib2
import re
page = urllib2.urlopen(Your_site).read()
print re.findall(r"<a.+>(\d+.+)</a>",page)[-1]
Note : I know it is bad practice to use re to parse HTML, but this is a simple
website and the question requires so.
|
How to share a string amongst multiple processes using Managers() in Python?
Question: I need to read strings written by multiprocessing.Process instances from the
main process. I already use Managers and queues to pass arguments to
processes, so using the Managers seems obvious, [but Managers do not support
strings](http://docs.python.org/2/library/multiprocessing.html#sharing-state-
between-processes):
> A manager returned by Manager() will support types list, dict, Namespace,
> Lock, RLock, Semaphore, BoundedSemaphore, Condition, Event, Queue, Value and
> Array.
How do I share state represented by a string using Managers from the
multiprocessing module?
Answer: multiprocessing's Managers can hold
[Values](http://docs.python.org/2/library/multiprocessing.html#multiprocessing.Value)
which in turn can hold instances of the type
[c_char_p](http://docs.python.org/2/library/ctypes.html#fundamental-data-
types) from the ctypes module:
>>> import multiprocessing
>>> import ctypes
>>> v = multiprocessing.Value('c', "Hello, World!")
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
File "/usr/lib/python2.7/multiprocessing/__init__.py", line 253, in Value
return Value(typecode_or_type, *args, **kwds)
File "/usr/lib/python2.7/multiprocessing/sharedctypes.py", line 99, in Value
obj = RawValue(typecode_or_type, *args)
File "/usr/lib/python2.7/multiprocessing/sharedctypes.py", line 73, in RawValue
obj.__init__(*args)
TypeError: one character string expected
>>> cstring = multiprocessing.Value(ctypes.c_char_p, "Hello, World!")
>>> cstring
<Synchronized wrapper for c_char_p(166841564)>
>>> cstring.value
'Hello, World!'
See also: [Post with the original
solution](http://stackoverflow.com/a/16485061/906658) that I had a hard time
finding.
So a Manager can be used to share a string beneath multiple processes in
Python like this:
>>> from multiprocessing import Process, Manager, Value
>>> from ctypes import c_char_p
>>>
>>> def greet(string):
>>> string.value = string.value + ", World!"
>>>
>>> if __name__ == '__main__':
>>> manager = Manager()
>>> string = manager.Value(c_char_p, "Hello")
>>> process = Process(target=greet, args=(string,))
>>> process.start()
>>> process.join()
>>> print string.value
'Hello, World!'
|
python error when added a function to a class
Question: i just added this function to my class
def getTotalPopulation():
print 'there are {0} people in the world'.format(Person.population)
when i call it, i got this error:
Traceback (most recent call last):
File "<interactive input>", line 1, in <module>
TypeError: unbound method getTotalPopulation() must be called with Person instance as first argument (got nothing instead)
I call it like this:
from MyTests import Person
>>> Person.Person.getTotalPopulation()
### for people who need all code
class Person:
population = 0
def __init__(self, name, age):
self.name = name
self.age = age
Person.population += 1
print '{A} has been born'.format(A = self.name)
def __str__(self):
return '{0} is {1} years old'.format(self.name, self.age)
def __del__(self):
Person.population -=1
print '{0} is dying :( '.format(self.name)
def getTotalPopulation():
print 'there are {0} people in the world'.format(Person.population)
Answer: you need to make that a classmethod:
change
class Person:
def getTotalPopulation(self):
return Person.population
to:
class Person(object):
@classmethod
def getTotalPopulation(cls):
return cls.population
that is, add the `@classmethod` decorator right before the `def`.
additionally, the first parameter of a classmethod is conventionally spelled
`cls` instead of `self`; and you should use it in the method body to support
subclasses properly.
That's for python 2, though. For python three, your code works correctly,
because methods can be used implicitly as though they are `staticmethod`s. I
wouldn't particularly reccomend that, though, since you almost never need that
feature, but `classmethod`s are terrifically useful.
|
How to find set of most frequently occurring word-pairs in a file using python?
Question: I have a data set as follows:
"485","AlterNet","Statistics","Estimation","Narnia","Two and half men"
"717","I like Sheen", "Narnia", "Statistics", "Estimation"
"633","MachineLearning","AI","I like Cars, but I also like bikes"
"717","I like Sheen","MachineLearning", "regression", "AI"
"136","MachineLearning","AI","TopGear"
and so on
I want to find out the most frequently occurring word-pairs e.g.
(Statistics,Estimation:2)
(Statistics,Narnia:2)
(Narnia,Statistics)
(MachineLearning,AI:3)
The two words could be in any order and at any distance from each other
Can someone suggest a possible solution in python? This is a very large data
set.
Any suggestion is highly appreciated
So this is what I tried after suggestions from @275365
@275365 I tried the following with input read from a file
def collect_pairs(file):
pair_counter = Counter()
for line in open(file):
unique_tokens = sorted(set(line))
combos = combinations(unique_tokens, 2)
pair_counter += Counter(combos)
print pair_counter
file = ('myfileComb.txt')
p=collect_pairs(file)
text file has same number of lines as the original one but has only unique
tokens in a particular line. I don't know what am I doing wrong since when I
run this it splits the words in letters rather than giving output as
combinations of words. When I run this file it outputs split letters rather
than combinations of words as expected. I dont know where I am making a
mistake.
Answer: You might start with something like this, depending on how large your corpus
is:
>>> from itertools import combinations
>>> from collections import Counter
>>> def collect_pairs(lines):
pair_counter = Counter()
for line in lines:
unique_tokens = sorted(set(line)) # exclude duplicates in same line and sort to ensure one word is always before other
combos = combinations(unique_tokens, 2)
pair_counter += Counter(combos)
return pair_counter
The result:
>>> t2 = [['485', 'AlterNet', 'Statistics', 'Estimation', 'Narnia', 'Two and half men'], ['717', 'I like Sheen', 'Narnia', 'Statistics', 'Estimation'], ['633', 'MachineLearning', 'AI', 'I like Cars, but I also like bikes'], ['717', 'I like Sheen', 'MachineLearning', 'regression', 'AI'], ['136', 'MachineLearning', 'AI', 'TopGear']]
>>> pairs = collect_pairs(t2)
>>> pairs.most_common(3)
[(('MachineLearning', 'AI'), 3), (('717', 'I like Sheen'), 2), (('Statistics', 'Estimation'), 2)]
Do you want numbers included in these combinations or not? Since you didn't
specifically mention excluding them, I have included them here.
**EDIT: Working with a file object**
The function that you posted as your first attempt above is very close to
working. The only thing you need to do is change each line (which is a string)
into a tuple or list. Assuming your data looks exactly like the data you
posted above (with quotation marks around each term and commas separating the
terms), I would suggest a simple fix: you can use `ast.literal_eval`.
(Otherwise, you might need to use a regular expression of some kind.) See
below for a modified version with `ast.literal_eval`:
from itertools import combinations
from collections import Counter
import ast
def collect_pairs(file_name):
pair_counter = Counter()
for line in open(file_name): # these lines are each simply one long string; you need a list or tuple
unique_tokens = sorted(set(ast.literal_eval(line))) # eval will convert each line into a tuple before converting the tuple to a set
combos = combinations(unique_tokens, 2)
pair_counter += Counter(combos)
return pair_counter # return the actual Counter object
Now you can test it like this:
file_name = 'myfileComb.txt'
p = collect_pairs(file_name)
print p.most_common(10) # for example
|
Strategies for searching through strings in python?
Question: What are efficient ways to search for substrings in strings? \- Are there
specific functions built in python we can use? \- Can we convert them to lists
then access elements in the list? \- Can we use for loops to search through
individual elements? \- Is there one generally accepted method by Python
programmers?
It would be helpful to understand the different strategies to help me solve
the following problem:
Return the number of times that the string `"code"` appears anywhere in the
given string, except we'll accept any letter for the `'d'`, so `"cope"` and
`"cooe"` count.
count_code('aaacodebbb') → 1
count_code('codexxcode') → 2
count_code('cozexxcope') → 2
Answer: You can use `regex`:
>>> import re
def count(s):
return sum(1 for m in re.finditer(r'co.e', s))
...
>>> count('aaacodebbb')
1
>>> count('codexxcode')
2
>>> count('cozexxcope')
2
Here `.` matches any character, if you only want to match alphabets then use
`r'co[a-zA-Z]e'`.
|
Can not start boa-constructor successfully
Question: When I start boa-constructor from the command line by starting the script
"Boa.py", I got the message says "
D:\Python27\Lib\site-packages\boa-constructor>python Boa.py
Starting Boa Constructor v0.6.1
importing wxPython
reading user preferences
Traceback (most recent call last):
File "Boa.py", line 271, in <module>
import Preferences, Utils
File "D:\Python27\Lib\site-packages\boa-constructor\Preferences.py", line 151
in <module>
execfile(file)
File "C:\Users\madfrog\.boa-constructor\prefs.rc.py", line 26, in <module>
splitterStyle = wx.SP_LIVE_UPDATE | wx.SP_3DSASH | wx.NO_3D
AttributeError: 'module' object has no attribute 'NO_3D'
My python version is 2.7.4 and I download wxPyton "32-bit Python 2.7". There
are someone say it because the unmatched wxPython version, but there are only
64-bit or 32 bit for me, I don't know how to handle this problem. Maybe should
I reinstall the python, which version is 2.6?
Thanks for your help.
Answer: I had the same problem. I can't tell you why. I can just tell you how I fixed
it.
After you download and unzip the boa files go into the boa folder (On a Mac
this could be: /Users/your_user_name/Downloads/boa-constructor-0.6.1).
Then: "grep" for every file containing NO_3D (or use whatever you want to
search for a string in a set of files, I don't know how windows does this): In
my case I did: grep -ir NO_3D *
A list of files comes up. Simply edit each such file (there are ~6) and remove
any mentioning of "wx.NO_3D".
E.g., in Companions/BaseCompanions.py I find a match:
"self.windowStyles = ['wx.CAPTION', 'wx.MINIMIZE_BOX', 'wx.MAXIMIZE_BOX',
'wx.THICK_FRAME', 'wx.SIMPLE_BORDER', 'wx.DOUBLE_BORDER',
'wx.SUNKEN_BORDER', 'wx.RAISED_BORDER', 'wx.STATIC_BORDER',.
'wx.TRANSPARENT_WINDOW', 'wx.NO_3D', 'wx.TAB_TRAVERSAL',.
'wx.WANTS_CHARS', 'wx.NO_FULL_REPAINT_ON_RESIZE', 'wx.VSCROLL',.
'wx.HSCROLL', 'wx.CLIP_CHILDREN', 'wx.NO_BORDER', 'wx.ALWAYS_SHOW_SB']"
You see the '**wx.NO_3D** ' in the middle somewhere. Remove it and save the
file. Keep doing this for all files.
However, there is a minor complication in one file: "Inspector.py". Here, you cannot simply remove wx.NO_3D. In particular, the match is: **self.categories = wx.SplitterWindow(self, -1, style=wx.NO_3D | wx.SP_3D | wx.SP_LIVE_UPDATE)**
What I did was to replace "style=wx.NO_3D" with "style=wx.DEFAULT_FRAME_STYLE"
(I found this default name in one of the other files; you see how there are
different "styles" recognized by the program so I just chose some other style
than NO_3D).
Then I just ran Boa with: "python Boa.py"
and it worked (assuming you have the module wx installed and whatever else is
needed for Boa to run in the first place of course).
|
Requiring help in figuring out indent error in python code
Question: I get an indentation error when trying to run the code below. I am trying to
print out the URLs of a set of html pages recursively.
import urllib2
from BeautifulSoup import *
from urlparse import urljoin
# Create a list of words to ignore
ignorewords=set(['the','of','to','and','a','in','is','it'])
def crawl(self,pages,depth=2):
for i in range(depth):
newpages=set()
for page in pages:
try:
c=urllib2.urlopen(page)
except:
print "Could not open %s" % page
continue
soup=BeautifulSoup(c.read())
self.addtoindex(page,soup)
links=soup('a')
for link in links:
if ('href' in dict(link.attrs)):
url=urljoin(page,link['href'])
if url.find("'")!=-1: continue
url=url.split('#')[0] # remove location portion
if url[0:4]=='http' and not self.isindexed(url):
newpages.add(url)
linkText=self.gettextonly(link)
self.addlinkref(page,url,linkText)
self.dbcommit()
pages=newpages
Answer: Well you're coded is totally unindented so Python will cry when you try and
run it.
Remember in Python whitespace is important. Indenting with 4 spaces rather
than tab saves a lot of "invisible" indentation errors.
I've down-voted as the code was pasted unformatted/unindented which means
either the poster doesn't understand python (and hasn't read a basic tutorial)
or pasted the code without re-indenting , which makes it impossible for anyone
to answer.
|
How to delete an image file from GridFS by file metadata?
Question: I have an image with the following metadata:
> db.fs.files.find().pretty()
{
"_id" : ObjectId("4576874577342672346"),
"chunkSize" : 262144,
"user_name" : "my name",
"filename" : "image.jpg",
"length" : 7103,
"uploadDate" : ISODate("2014-01-23T13:31:48.155Z"),
"user_email" : "[email protected]",
"md5" : "1234567890"
}
>
I want to delete the image from Python (PyMongo).
The documentation on `delete()` seems to stipulate that the only accepted
parameter in the `delete()` function is the `file_id`:
<http://api.mongodb.org/python/current/api/gridfs/#gridfs.GridFS.delete>
Programmatically, I have the following values available that can be matched in
the files metadata:
* user_name
* filename
* user_email
How do I either:
* Get the `file_id` (through use of the above values if necessary) or
* Delete the file based on metadata fields other than `file_id`?
Additionally, I am only currently testing with single chunk files, if
interacting with larger files in the future will deleting by `file_id` or
other metadata remove all associated chunks as well?
Answer: Here's something I just tried without thinking if it's necessary or the best
way to do it, but it works.
So programatically I could have the `_id` available from querying on the files
metadata:
_Python Shell:_
>>> import pymongo
>>> import os
>>> hostname = os.environ['OPENSHIFT_MONGODB_DB_URL']
>>> conn = pymongo.MongoClient(host=hostname)
>>> db = conn.grid_files
>>> collection = db.fs.files
>>> result = collection.find_one({"user_email":"[email protected]","name":"my name","filename":"image.jpg"})
>>> result['_id']
ObjectId('52e119c47091447a86891d98')
# now use the _id to delete the file
>>> files_id = result['_id']
>>> import gridfs
>>> fs = gridfs.GridFS(db)
>>> fs.delete(files_id)
|
Type error when calling sdlttf.TTF_OpenFont() with the pysdl2 Python bindings
Question: I have all dependencies correctly installed (SDL2, SDL2_TTF, pysdl2). I've
tried to provide just the filename for the font and I've tried to hard code
the full path. The font is in the same directory as the python file.
import sys
try:
from sdl2 import *
import sdl2.ext as sdl2ext
import sdl2.sdlttf as sdlttf
except ImportError:
import traceback
traceback.print_exc()
sys.exit(1)
def run():
sdl2ext.init()
sdlttf.TTF_Init()
RESOURCES = sdl2ext.Resources(__file__, "")
# print(RESOURCES.get_path("arial.ttf"))
font = sdlttf.TTF_OpenFont(RESOURCES.get_path("arial.ttf"), 24)
window = sdl2ext.Window("SDL_TTF test", size=(800, 600))
message = sdlttf.TTF_RenderText_Solid(font, "Hello World", (255, 255, 255))
window.show()
running = True
while running:
events = sdl2ext.get_events()
for event in events:
if event.type == SDL_QUIT:
running = False
break
window.refresh()
return 0
if __name__ == "__main__":
sys.exit(run())
Returns:
Traceback (most recent call last):
File "sdl2_test.py", line 32, in <module>
sys.exit(run())
File "sdl2_test.py", line 17, in run
font = sdlttf.TTF_OpenFont(RESOURCES.get_path("arial.ttf"), 24)
ctypes.ArgumentError: argument 1: <class 'TypeError'>: wrong type
Answer: I got it. Since I'm using Python 3 the type is incorrect due to the standard
type used for representing strings in Python 3. I solved it by using
str.encode()
|
Modifying Active Directory Passwords via ldapmodify
Question: I'm investigating the scripting of various LDAP operations. However, I've hit
a bit of a speed bump with Active Directory user creation.
The following LDIF fails when I load it in via the `ldapmodify` command:
dn: CN=Frank,CN=Users,DC=domain,dc=local
changeType: add
objectClass: top
objectClass: person
objectClass: organizationalPerson
objectClass: user
cn: Frank
userPrincipalName: [email protected]
sAMAccountName: frank
givenName: Frank
sn: Stein
displayName: Frank Stein
description: Frankenstein's User
userAccountControl: 512
unicodePwd: "AnExamplePassword1!"
When attempting to add the user via LDIF, I used the following command:
ldapmodify -H 'ldaps://<ip-of-server>:636' -D 'DOMAIN\Administrator' -x -W -f frank-add.ldif
This fails with the following error:
ldap_add: Server is unwilling to perform (53)
additional info: 0000001F: SvcErr: DSID-031A120C, problem 5003 (WILL_NOT_PERFORM), data 0
This is a problem with the password policy denying the user.
However, the following Python script works:
#!/usr/bin/python
import ldap
import ldap.modlist as modlist
AD_LDAP_URL='ldaps://<ip-of-server>:636'
ADMIN_USER='DOMAIN\Administrator'
# User must be authorized to create accounts, naturally.
ADMIN_PASSWORD='password for ADMIN_USER'
BASE_DN='dc=domain,dc=local'
username='frank'
firstname='Frank'
surname='Stein'
displayName = "Frank Stein"
password='AnExamplePassword1!'
# The value of password still needs to adhere to the domain's password policy.
unicode_pass = unicode('\"' + password + '\"', 'iso-8859-1')
password_value = unicode_pass.encode('utf-16-le')
l = ldap.initialize(AD_LDAP_URL)
l.simple_bind_s(ADMIN_USER, ADMIN_PASSWORD)
dn=str('CN=%s,CN=Users,DC=domain,dc=local' % firstname)
attrs = {}
attrs['objectclass'] = ['top','person','organizationalPerson','user']
attrs['cn'] = str(username)
attrs['sAMAccountname'] = str(username)
attrs['unicodePwd'] = str(password_value)
attrs['givenName'] = str(firstname)
attrs['sn'] = str(surname)
attrs['displayName'] = str(displayName)
attrs['description'] = str("Frankenstein's User")
attrs['userPrincipalName'] = str("%[email protected]" % username)
attrs['userAccountControl'] = str(512)
ldif = modlist.addModlist(attrs)
l.add_s(dn,ldif)
Using the Python script, I am immediately able to sign in using the user's
password (minus the quotes that were escaped out). I can still trigger the
same "Unwilling to Perform" error by picking a password like 'password' that
is too simple. However, in this case the password being used is the same.
So far as I can see, the operations should be identical. The difference that
breaks the LDIF file is the way that I deal with the quotes that I need to
enclose the password in. Creation via LDIF succeeds if I make a disabled
account by setting the value of userAccountControl to 544 and not including a
password. However, this means that I would need to manually go and reset the
user's password.
So far, I've tried the following password formats via LDIF:
* Without quotes.
* Plain quotes.
* Escaped quotes via \
* Escaped quotes via ASCII: {\22}
* Using Python to Base64-encode the password (With and without quotes, and with the format of the LDIF modified to `unicodePwd::`)
While I'm happy that I have a working method of adding users via the Python,
I'm still a bit confused about how to properly escape out password values when
using LDIF files and `ldapmodify`. Is there an alternate method that I'm not
considering?
Answer: Why not use ldifde and unicode base64 encode the password as described here:
<http://support.microsoft.com/kb/263991>
Your python script seems to be encoding the password as unicode / base64.
Perhaps your password needs to be encoded in your ldif file (with the quotes
when encoding) rather than plain text as you are doing in your example.
Eg:
unicodePwd:: IgBBAG4ARQB4AGEAbQBwAGwAZQBQAGEAcwBzAHcAbwByAGQAMQAhACIA
For the example password you provided.
|
variable in try clause not accessible in finally clause - python
Question: I am new to python, so sorry if this question is dumb, but can someone tell me
what's going on here.
When I run the following code with no errors in the mdb.connect() call, the
code runs fine.
But when I purposely insert an error (for example, put in
'localhostblahblah'), I get a 'NameError: name 'con' is not defined' error
when I execute.
I thought that variables defined in the try clause should be accessible in the
finally clause. What's going on?
#!/usr/bin/python
import MySQLdb as mdb
import sys
try:
con = mdb.connect('localhost','jmtoung','','ptb_genetics')
except mdb.Error, e:
print "Error"
sys.exit(1)
finally:
if con:
con.close()
Answer: If `mdb.connect` errors, there's nothing to assign to `con`, so it doesn't get
defined.
Instead of `finally`, try using `else`, which is run only when there was no
exception. [Docs](http://docs.python.org/2/tutorial/errors.html#handling-
exceptions)
try:
con = mdb.connect('localhost','jmtoung','','ptb_genetics')
except mdb.Error as e:
print "Error"
sys.exit(1)
else: # else instead of finally
con.close()
|
Keyword values for error_kw in Python bar plots
Question: I want to adjust error bar properties in a bar plot. Apparently this is to be
done by using keyword arguments (i.e. in error_kw). e.g.
from pylab import *
fig = figure()
ax = fig.add_subplot(111)
ax.plot( left=0, width=1, height=5, error_kw=dict(elinewidth=3, ecolor='b') )
However, I cannot find a listing of the possible error_kw values.
I apologize in advance for asking such a trivial question, but I cannot find
this anywhere and it drives me nuts.
Answer: See the parameters for matplotlib.pyplot.bar
Parameters:
left : sequence of scalars
the x coordinates of the left sides of the bars
height : sequence of scalars
the heights of the bars
width : scalar or array-like, optional, default: 0.8
the width(s) of the bars
bottom : scalar or array-like, optional, default: None
the y coordinate(s) of the bars
color : scalar or array-like, optional
the colors of the bar faces
edgecolor : scalar or array-like, optional
the colors of the bar edges
linewidth : scalar or array-like, optional, default: None
width of bar edge(s). If None, use default linewidth; If 0, don’t draw edges.
xerr : scalar or array-like, optional, default: None
if not None, will be used to generate errorbar(s) on the bar chart
yerr :scalar or array-like, optional, default: None :
if not None, will be used to generate errorbar(s) on the bar chart
ecolor : scalar or array-like, optional, default: None
specifies the color of errorbar(s)
capsize : integer, optional, default: 3
determines the length in points of the error bar caps
error_kw : :
dictionary of kwargs to be passed to errorbar method. ecolor and capsize may be specified here rather than as independent kwargs.
align : [‘edge’ | ‘center’], optional, default: ‘edge’
If edge, aligns bars by their left edges (for vertical bars) and by their bottom edges (for horizontal bars). If center, interpret the left argument as the coordinates of the centers of the bars.
orientation : ‘vertical’ | ‘horizontal’, optional, default: ‘vertical’
The orientation of the bars.
log : boolean, optional, default: False
If true, sets the axis to be log scale
|
How do I right click on a windows tray icon and clicking on item on context menu in Python?
Question: I need to right click on a Windows Notification Tray icon, and select (left
clicking) one of the items on the resulting context menu.
I have tried to use [pywinauto](http://pywinauto.googlecode.com/), and while
running this code from the code on the [How
To's](http://pywinauto.googlecode.com/hg/pywinauto/docs/HowTo.html#how-to-
access-the-system-tray-aka-systray-aka-notification-area) page: from
pywinauto.application import Application from pywinauto import taskbar
# connect to outlook
outlook = Application().connect_(process=4436)
# click on Outlook's icon
taskbar.ClickSystemTrayIcon(12)
# Select an item in the popup menu
outlook.PopupMenu.MenuClick("Cancel Server Request")
I am getting the following error:
Traceback (most recent call last):
File "C:\dev\consumertms\temp.py", line 25, in <module>
taskbar.ClickSystemTrayIcon(12)
File "C:\Python27\lib\site-packages\pywinauto\taskbar.py", line 52, in ClickSystemTrayIcon
button = _get_visible_button_index(button)
File "C:\Python27\lib\site-packages\pywinauto\taskbar.py", line 42, in _get_visible_button_index
if not SystemTrayIcons.GetButton(i).fsState & \
File "C:\Python27\lib\site-packages\pywinauto\controls\common_controls.py", line 1878, in GetButton
button.idCommand)
RuntimeError: GetButtonInfo failed for button with command id 2
I am currently running Windows 8, but will require this to run on Windows XP
onwards.
I have searched around and was unable to find a workaround for this.
My Question: Is there a workaround for this error? If not, is there some other
Python module I can use to automate this process? Some code snippets will be
very much appreciated.
Thanks
Answer: A context menu or dropdown menu can be a window context on it's own. You will
need to find it with _findwindows.find_windows()_.
I encountered this problem when I needed to access dropdown menu items on a
non-native GUI. The easiest way to get the class name of that windows is by
using SWAPY, which lists all window objects and creates handy pywinauto code
<https://code.google.com/p/swapy/>.
A typical approach would be like this:
outlook = Application().connect_(process=4436)
taskbar.ClickSystemTrayIcon(12)
# Use SWAPY to find the class name of the popup menu
w_handle = findwindows.find_windows(title=u'', class_name='name-found-in-SWAPY')[0]
popup = app.window_(handle=w_handle)
popup.Click(coords=(x,y))
|
Python - create next file
Question: I am writing a small script. The script creates `.txt` files. I do not want to
replace existing files. So what I want python to do is to check if the file
already exists. If it does not it can proceed. If the file does exists I would
like python to increment the name and than check again if the file already
exists. If the file does not already exist python may create it. EXAMPLE:
current dir has these files in it:
`file_001.txt`
`file_002.txt`
I want python to see that the two files exists and make the next file:
`file_003.txt`
creating files can be done like this:
f = open("file_001.txt", "w")
f.write('something')
f.close()
[checking](http://stackoverflow.com/questions/82831/how-do-i-check-if-a-file-
exists-using-python) if a file exists:
import os.path
os.path.isfile(fname)
Answer: If you want to check whether it's both a file and that it exist then use
`os.path.exists` along with `os.path.isfile`. Or else just the former seems
suffice. Following might help:
import os.path as op
print op.exists(fname) and op.isfile(fname)
or just `print op.exists(fname)`
|
15 Python scripts into one executable?
Question: Ive been tinkering around all day with solutions from here and here:
[How would I combine multiple .py files into one .exe with
Py2Exe](http://stackoverflow.com/questions/7950335/how-would-i-combine-
multiple-py-files-into-one-exe-with-py2exe)
[Packaging multiple scripts in
PyInstaller](http://stackoverflow.com/questions/8888813/packaging-multiple-
scripts-in-pyinstaller)
but Its not quite working the way I thought it might.
I have a program that Ive been working on for the last 6 months and I just
sourced out one of its features to another developer who did his work in
Python.
What I would like to do is use his scripts without making the user have to
download and install python.
The problem as I see it is that 1 python script calls the other 14 python
scripts for various tasks.
So what I'm asking is whats the best way to go about this?
Is it possible to package 15 scripts and all their dependencies into 1 exe
that I can call normally? or is there another way that I can package the
initial script into an exe and that exe can call the .py scripts normally? or
should I just say f' it and include a python installer with my setup file?
This is for Python 2.7.6 btw
And this is how the initial script calls the other scripts.
import printSub as ps
import arrayWorker as aw
import arrayBuilder as ab
import rootWorker as rw
import validateData as vd
etc...
If this was you trying to incorporate these scripts, how would you go about
it?
Thanks
Answer: You can really use **py2exe** , it behaves the way you want.
See answer to the mentioned question: [How would I combine multiple .py files
into one .exe with Py2Exe](http://stackoverflow.com/questions/7950335/how-
would-i-combine-multiple-py-files-into-one-exe-with-py2exe)
Usually, py2exe bundles your main script to exe file and all your dependent
scripts (it parses your imports and finds all nescessary python files) to
library zip file (pyc files only). Also it collects dependent DLL libraries
and copies them to distribution directory so you can distribute whole
directory and user can run exe file from this directory. The benefit is that
you can have a large number of scripts - smaller exe files - to use one large
library zip file and DLLs.
Alternatively, you can configure py2exe to bundle all your scripts and
requirements to 1 standalone exe file. Exe file consists of main script,
dependent python files and all DLLs. I am using these options in setup.py to
accomplish this:
setup(
...
options = {
'py2exe' : {
'compressed': 2,
'optimize': 2,
'bundle_files': 1,
'excludes': excludes}
},
zipfile=None,
console = ["your_main_script.py"],
...
)
* * *
Working code:
from distutils.core import setup
import py2exe, sys, os
sys.argv.append('py2exe')
setup(
options = {
'py2exe' : {
'compressed': 1,
'optimize': 2,
'bundle_files': 3, #Options 1 & 2 do not work on a 64bit system
'dist_dir': 'dist', # Put .exe in dist/
'xref': False,
'skip_archive': False,
'ascii': False,
}
},
zipfile=None,
console = ['thisProject.py'],
)
|
Bitcoinrpc connection to remote server
Question: Hey I was wondering if anyone knew how to connect to a bitcoin wallet located
on another server with bitcoinrpc
I am running a web program made in django and using a python library called
bitcoinrpc to make connections.
When testing locally, I can use bitcoinrpc.connect_to_local), or even
bitcoinrpc.connect_to_remote('account','password') and this works as well as
long as the account and password match the values specified in my
'bitcoin.conf' file. I can then use the connection object to get values and do
some tasks in my django site.
The third parameter in connect_to_local is default localhost. I was wondering:
A) What to specify for this third parameter in order to connect from my
webserver to the wallet stored on my home comp (is it my IP address?)
B) Because the wallet is on my PC and not some dedicated server, does that
mean that my IP will change and I won't be able to access the wallet?
C) The connection string is in the django app - which is hosted on heroku.
Heroku apps are launched by pushing with git but I believe it is to a private
repository. Still, if anyone could see the first few lines of my 'view' they
would have all they need to take my BTC (or, more accurately, mBTC). Anyone
know how bad this is - or any ways to go about doing btc payments/movements in
a more secure way.
Thanks a lot.
Answer: I'm currently doing something very similar (heroku using express/nodejs
instead of django/python tho) so I will try to share my thoughts.
In spite of using other library and other language, all the wallet remote
libraries should be primarily a wrapper around JSON RPC (remote procedure
call) API, which is actually the same for most of the coins out there (i would
say all, but that would be a wild guess).
Specifically to your questions:
A)
To access the wallet from outside, use your external ip (fastest way to find
it is to query google for it). Depending on your ISP you hopefully have static
external address. You must provide this address to `bitcoin.conf` file under
`rpcallowip=` option to allow incomming connections.
Moreover you should forward the used port in your home router (usually under
NAT settings) to your local machine so the incoming connection from the server
is allowed and redirected to your wallet computer.
There is one important thing to consider
(<https://en.bitcoin.it/wiki/Running_Bitcoin>):
By default, only RPC connections from localhost are allowed. Specify
as many rpcallowip= settings as you like to allow connections from
other hosts (and you may use * as a wildcard character).
NOTE: opening up the RPC port to hosts outside your local
trusted network is NOT RECOMMENDED, because the rpcpassword
is transmitted over the network unencrypted.
I am yet to look into it further, from this comment alone it seems totally
unusable for monetary transactions.
B)
As I said before, it depends on your home ISP, type of connection and the
service provided to you.
C)
If I understand correctly from a django point of view, as long as the login
parameters (username/password) are inside a view (`views.py` of your app) and
the debug mode is turned off, source code of the server should not be publicly
accessible. But the security concern from A still applies.
|
SKLearn - Principal Component Analysis leads to horrible results in knn predictions
Question: by adding PCA to the algorithm, I'm working to improve %96.5 SKlearn kNN
prediction score for kaggle digit recognition tutorial, yet new kNN
predictions based on PCA output are horrible like 23%.
below is the full code and i appreciate if you point out where i am mistaken.
import pandas as pd
import numpy as np
import pylab as pl
import os as os
from sklearn import metrics
%pylab inline
os.chdir("/users/******/desktop/python")
traindata=pd.read_csv("train.csv")
traindata=np.array(traindata)
traindata=traindata.astype(float)
X,y=traindata[:,1:],traindata[:,0]
from sklearn.cross_validation import train_test_split
X_train, X_test, y_train, y_test= train_test_split(X,y,test_size=0.25, random_state=33)
#scale & PCA train data
from sklearn import preprocessing
from sklearn.decomposition import PCA
X_train_scaled = preprocessing.scale(X_train)
estimator = PCA(n_components=350)
X_train_pca = estimator.fit_transform(X_train_scaled)
# sum(estimator.explained_variance_ratio_) = 0.96
from sklearn.neighbors import KNeighborsClassifier
neigh = KNeighborsClassifier(n_neighbors=6)
neigh.fit(X_train_pca,y_train)
# scale & PCA test data
X_test_scaled=preprocessing.scale(X_test)
X_test_pca=estimator.fit_transform(X_test_scaled)
y_test_pred=neigh.predict(X_test_pca)
# print metrics.accuracy_score(y_test, y_test_pred) = 0.23
# print metrics.classification_report(y_test, y_test_pred)
Answer: When you are processing the test data, you used `fit_transform(X_test)` which
actually recomputes another PCA transformation on the test data. You should be
using `transform(X_test)`, so that the test data undergoes the same
transformation as the training data.
The portion of code will look something like (thanks ogrisel for the `whiten`
tip):
estimator = PCA(n_components=350, whiten=True)
X_train_pca = estimator.fit_transform(X_train)
X_test_pca = estimator.transform(X_test)
Try and see if it helps?
|
Tracking CPU time of Python process and children
Question: Is there an easy way to track the CPU time of not only a Process but of any
child processes launched by it?
I tried sub-classing `multiprocessing.Process` to time an arbitrary function,
like:
import time
from multiprocessing import Process
class TimedProcess(Process):
daemon = True
def __init__(self, *args, **kwargs):
super(TimedProcess, self).__init__(*args, **kwargs)
self.t0 = time.clock()
@property
def duration_seconds(self):
return time.clock() - self.t0
p = TimedProcess(target=my_long_running_func)
p.start()
while p.is_alive():
print p.duration_seconds
time.sleep(1)
However, when I tried to time functions involving Scikits-learn or other code
involving c-extensions or sub-processes, I found my `duration_sections` would
often report 0, or just a few seconds, even though the code would run for
hours. How would I fix this?
Answer: Your code almost prints the CPU time, but you're calling `time.clock()` in the
parent process instead of the child process. By using `multiprocessing.Pipe`,
you can pass the values from the child to the parent process:
import time
from threading import Thread
from multiprocessing import Process, Pipe
class TimedProcess(Process):
daemon = True
def __init__(self, *args, **kwargs):
super(TimedProcess, self).__init__(*args, **kwargs)
self.parent_conn, self.child_conn = Pipe()
self.child_finished = False
self._duration = 0.0
def get_duration(self):
if not self.child_finished:
self.parent_conn.send(None)
result = self.parent_conn.recv()
if result == 'done':
self.child_finished = True
else:
self._duration = result
return self._duration
def run(self):
try:
t0 = time.clock()
Thread(target=self._run).start()
while True:
request = self.child_conn.recv()
self.child_conn.send(time.clock() - t0)
if request == 'stop':
break
finally:
self.child_conn.send('done')
def _run(self):
try:
super(TimedProcess, self).run()
finally:
self.parent_conn.send('stop')
p = TimedProcess(target=my_long_running_func)
p.start()
while p.is_alive():
time.sleep(1)
print p.get_duration()
|
Split .TIF file using PIL
Question: I took a look at the [Split multi-page tiff with
python](http://stackoverflow.com/questions/9627652/split-multi-page-tiff-with-
python) file for Splitting a .TIFF File, however to be honest, I didn't fully
understand the answers, and I'm hoping for a little clarification.
I am attempting to take a .Tif file with multiple Invoices in it and Split it
into each page which will then be Zipped Up and uploaded into a database. PIL
is installed on the computers that will be running this program, as such I'd
like to stick with the PIL Library. I know that I can view information such as
the Size of each Image using PIL after it's open, however when I attempt to
Save each it gets dicey. (Example Code Below)
def Split_Images(img,numFiles):
ImageFile = Image.open(img)
print ImageFile.size[0]
print ImageFile.size[1]
ImageFile.save('InvoiceTest1.tif')[0]
ImageFile.save('InvoiceTest2.tif')[1]
However when I run this code I get the following Error:
TypeError: 'NoneType' object has no attribute '__getitem__'
Any Suggestions?
Thank you in advance,
Answer: You need the PIL Image "seek" method to access the different pages.
from PIL import Image
img = Image.open('multipage.tif')
for i in range(4):
try:
img.seek(i)
img.save('page_%s.tif'%(i,))
except EOFError:
break
|
Python Kerberos-1.1.1.tar.gz Install Failure on Windows
Question: I run Python on windows based environments (2003, win 7, 2008 r2, etc) both 32
and 64-bit flavors. I've recently had to authenticate to various corporate,
internally facing web-sites using both NTLM and Kerberos authentication
schemes.
I was successful with NTLM authentication using the 'requests' module.
Specifically there is some documentation discussing ways for [Other
Authentication](http://docs.python-
requests.org/en/latest/user/authentication/#new-forms-of-authentication).
Installing the 'requests-ntlm' packages worked great!
Unfortunately I cannot seem to get the requests-kerberos package to work. The
requirements.txt indicates that the kerberos-1.1.1 package is required, but I
am unable to build/install that package.
Here is what happens if I try to import the requests-kerberos library without
the kerberos-1.1.1:
>>> import requests
>>> from requests_kerberos import HTTPKerberosAuth
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
File "requests_kerberos\__init__.py", line 17, in <module>
from .kerberos_ import HTTPKerberosAuth, REQUIRED, OPTIONAL, DISABLED
File "requests_kerberos\kerberos_.py", line 1, in <module>
import kerberos
ImportError: No module named kerberos
>>>
And here is my errors when trying to build the kerberos-1.1.1 package from one
of my WIN 7 machines (with python 2.6.5):
>python setup.py install --install-lib "C:\tmp"
running install
running build
running build_ext
building 'kerberos' extension
c:\Program Files (x86)\Microsoft Visual Studio 9.0\VC\BIN\cl.exe /c /nologo /Ox
/MD /W3 /GS- /DNDEBUG -IC:\Python26\ArcGIS10.0\include -IC:\Python26\ArcGIS10.0\
PC /Tcsrc/kerberos.c /Fobuild\temp.win32-2.6\Release\src/kerberos.obj '{' is not
recognized as an internal or external command, operable program or batch file.
cl : Command line warning D9024 : unrecognized source file type ''{'', object fi
le assumed
cl : Command line warning D9027 : source file ''{'' ignored
cl : Command line warning D9024 : unrecognized source file type 'is', object fil
e assumed
cl : Command line warning D9027 : source file 'is' ignored
cl : Command line warning D9024 : unrecognized source file type 'not', object fi
le assumed
cl : Command line warning D9027 : source file 'not' ignored
cl : Command line warning D9024 : unrecognized source file type 'recognized', ob
ject file assumed
cl : Command line warning D9027 : source file 'recognized' ignored
cl : Command line warning D9024 : unrecognized source file type 'as', object fil
e assumed
cl : Command line warning D9027 : source file 'as' ignored
cl : Command line warning D9024 : unrecognized source file type 'an', object fil
e assumed
cl : Command line warning D9027 : source file 'an' ignored
cl : Command line warning D9024 : unrecognized source file type 'internal', obje
ct file assumed
cl : Command line warning D9027 : source file 'internal' ignored
cl : Command line warning D9024 : unrecognized source file type 'or', object fil
e assumed
cl : Command line warning D9027 : source file 'or' ignored
cl : Command line warning D9024 : unrecognized source file type 'external', obje
ct file assumed
cl : Command line warning D9027 : source file 'external' ignored
cl : Command line warning D9024 : unrecognized source file type 'command,', obje
ct file assumed
cl : Command line warning D9027 : source file 'command,' ignored
cl : Command line warning D9024 : unrecognized source file type 'operable', obje
ct file assumed
cl : Command line warning D9027 : source file 'operable' ignored
cl : Command line warning D9024 : unrecognized source file type 'program', objec
t file assumed
cl : Command line warning D9027 : source file 'program' ignored
cl : Command line warning D9024 : unrecognized source file type 'or', object fil
e assumed
cl : Command line warning D9027 : source file 'or' ignored
cl : Command line warning D9024 : unrecognized source file type 'batch', object
file assumed
cl : Command line warning D9027 : source file 'batch' ignored
cl : Command line warning D9024 : unrecognized source file type 'file.', object
file assumed
cl : Command line warning D9027 : source file 'file.' ignored
kerberos.c
\src\kerberosbasic.h(17) : fatal error C108
3: Cannot open include file: 'gssapi/gssapi.h': No such file or directory
error: command '"c:\Program Files (x86)\Microsoft Visual Studio 9.0\VC\BIN\cl.ex
e"' failed with exit status 2
I also have tried one of my WIN 2008 R2 servers (with python 2.7.2), but get a
different error:
>python.exe "setup.py" install --
install-lib "C:\tmp"
running install
running build
running build_ext
building 'kerberos' extension
error: Unable to find vcvarsall.bat
I think this has to do that these are being built from source and need some
sort of C or C++ compiler, whereas most other modules I've installed in the
past worked great. Any advise is appreciated!
Answer: I managed to fix this problem.
1. Install `$ pip install kerberos-sspi`
2. Download `requests-kerberos` ZIP from GitHub
3. In 'requests-kerberos/kerberos_.py', change the line `import kerberos` to `import kerberos_sspi as kerberos`
4. In 'requirements.txt', delete 'kerberos==1.1.1'
5. Run `$ python setup.py install`.
If you want to run `test_requests_kerberos.py` that is in requests-kerberos/
you need to change `import kerberos` with `import kerberos_sspi as kerberos`.
Beside that you need to change all occurrences of:
with patch.multiple('kerberos', ...)
with:
with patch.multiple('kerberos_sspi', ...)
That worked for me.
|
How python custom class differ from any other in-built object like list?
Question: I m not sure my question title is correct but :
My problem is :
When I created a new class called **classA** and i did **deepcopy** to another
name called **classB** and did **equality and identity test** :
Here is my first snippet: Creating class using `type`
>>> import copy
>>> classA = type('X', (object,), {})
>>> classB = copy.deepcopy(classA)
>>> classB is classA
True
>>> classB == classA
True
>>>
Second snippet: testing on class creating by using keywords 'class':
>>> class X(object): pass
...
>>> import copy
>>> Y = copy.deepcopy(X)
>>> Y is X
True
>>> Y == X
True
>>>
Third snippet: And when i do the same testing on list object:
>>> import copy
>>> objA = list()
>>> objB = copy.deepcopy(objA)
>>> objB == objA
True
>>> objB is objA
False
>>>
Why the first and remaining two are different ? Could someone please explain
me ?
Answer: It is [documented](http://docs.python.org/2/library/copy.html) behavior:
> This module does not copy types like module, method, stack trace, stack
> frame, file, socket, window, array, or any similar types. It does “copy”
> functions and classes (shallow and deeply), by returning the original object
> unchanged; this is compatible with the way these are treated by the pickle
> module.
As to why it was done that way, presumably it was because people don't have a
lot of need for having multiple identical but distinct classes.
|
Stuck at os.rename can't quite figure out how to tie it in with the rest of my script
Question: I am new to programming and python and this is my first program I decided to
try and tackle.
This loops through my files in the directory that I run it from and takes out
the string of text I don't want and leaves me with the file name I would like
(in theory). It all works except the problem I am stuck with is that I can not
figure out how to get `os.rename` (I think that is what I need to use) to work
from inside my loop.
I have read up on it but I guess I just don't get how to tie it in. I'm using
python 2.7. This is what I have got so far:
import os
file_count = 0
for files in os.listdir('.'): #Open for loop in the current dir.
if files.find('_The_Hype_Machine_') and files.endswith('.128.mp3') :
mod_list = list(files) #Turns filenames into a list so they can be edited
del(mod_list[-38:-4]) #specifies the piece of string I need taken out of each filename.
files =''.join(mod_list) #Turns the list back to a string
file_count += 1
updated_file = files.replace('_', ' ')
os.rename(files, **"not sure what goes here"**)
print updated_file
print 'Your modifed MP3 File Count: ', file_count;
I could use some direction and Help with understanding if anyone is up for it.
Thanks in advance.
Answer: I've made a few tweaks to your program, and annotated it with instructional
comments:
import os
# Each time through the following loop, "afile" will take on the next file name
# also we can use "enumerate" to give us a file_count as we go (instead
# of tracking the count separately)
# In general, we shouldn't change a list we're iterating over, so we'll save it off
file_list = os.listdir('.') # (as sk4x0r mentioned)
for file_count, afile in enumerate(file_list): #Open for loop in the current dir.
# using the 'some_string' in some_text is more typical python useage
if '_The_Hype_Machine_' in afile and afile.endswith('.128.mp3'):
# Now, strings are immutable, so we can't exactly remove the
# inside of a string
# What we can do is create a brand new string composed
# of everything we want to keep
new_name = afile[:-38] + afile[-4:]
updated_file = new_name.replace('_', ' ')
os.rename(afile, updated_file)
print updated_file
print 'Your modifed MP3 File Count: ', file_count
|
connect to telnet in python with a quizz as login?
Question: I need to connect to a remote server via telnet. To authenticate to the server
I have to answer like a 100 questions. So I tried to automate this task in
python using telnetlib but the prompt halts without returning any message.
here is what I did
import telnetlib
port = 2002
host = "23.23.190.204"
tn = telnetlib.Telnet(host, port)
tn.read_until("""
Welcome to EULER!
=================
Answer 100 simple questions to authenticate yourself
""")
print tn.read_all()
tn.close()
in the command line prompt I get this message
Welcome to EULER!
=================
Answer 100 simple questions to authenticate yourself
then I am getting asked a question if the answer is correct I get the next
question till I finished the 100. But in the python program I not getting
neither the message nor the questions! what to do?
**EDIT:**
after setting the debug level for telnet, I get the answer of the server.
Could you please explain why is that?
tn.set_debuglevel(9)
Answer: This is a fake telnet server using netcat (`ncat` from
[Nmap](http://nmap.org/)):
$ ncat -l 9000 < msg.txt > log.txt
listing on port 9000 and passes a file named `msg.txt` (the questions) and log
the input into `log.txt` (the answers), it should simulate your server.
The file `msg.txt` content:
Welcome to EULER!
=================
Answer 100 simple questions to authenticate yourself
What is your name?
How old are you?
Do you use Python?
the file content in hex (using `hexdump msg.txt`):
00000000: 0A 57 65 6C 63 6F 6D 65 20 74 6F 20 45 55 4C 45 | Welcome to EULE|
00000010: 52 21 0A 3D 3D 3D 3D 3D 3D 3D 3D 3D 3D 3D 3D 3D |R! =============|
00000020: 3D 3D 3D 3D 0A 41 6E 73 77 65 72 20 31 30 30 20 |==== Answer 100 |
00000030: 73 69 6D 70 6C 65 20 71 75 65 73 74 69 6F 6E 73 |simple questions|
00000040: 20 74 6F 20 61 75 74 68 65 6E 74 69 63 61 74 65 | to authenticate|
00000050: 20 79 6F 75 72 73 65 6C 66 0A 57 68 61 74 20 69 | yourself What i|
00000060: 73 20 79 6F 75 72 20 6E 61 6D 65 3F 0A 48 6F 77 |s your name? How|
00000070: 20 6F 6C 64 20 61 72 65 20 79 6F 75 3F 0A 44 6F | old are you? Do|
00000080: 20 79 6F 75 20 75 73 65 20 50 79 74 68 6F 6E 3F | you use Python?|
00000090: 0A | |
00000091; | |
notice the new line character, it's `\x0A` or `\n` (it can also be `\x0D\x0A`
or `\n\r`).
The client:
import telnetlib
port = 9000
host = "127.0.0.1"
tn = telnetlib.Telnet(host, port)
r = tn.read_until("""\nWelcome to EULER!
=================
Answer 100 simple questions to authenticate yourself\n""")
tn.read_until("What is your name?\n")
tn.write("foo\n") # The client sends `\n`, notice the server may expects `\n\r`.
print("Question 1 answered.")
tn.read_until("How old are you?\n")
tn.write("100\n")
print("Question 2 answered.")
tn.read_until("Do you use Python?\n")
tn.write("yep\n")
print("Question 3 answered.")
tn.close()
now lets test it, on the client side:
$ python client.py
Question 1 answered.
Question 2 answered.
Question 3 answered.
$
on the server side, dump the log file content:
$ ncat -l 9000 < msg.txt > log.txt
$
$ cat log.txt # or `type log.txt` on windows
foo
100
yep
$
$ hexdump log.txt
00000000: 66 6F 6F 0A 31 30 30 0A 79 65 70 0A |foo 100 yep |
0000000c;
$
put it together you should get the idea.
|
Sending an HTML rich email using python
Question: I am trying to send HTML rich email, so far the code is working but the colour
formatting i had in html message content is not showing when I check in my
mailbox i sent to.
So far here is the code :
from email.MIMEMultipart import MIMEMultipart
from email.MIMEBase import MIMEBase
from email.MIMEText import MIMEText
from email.Utils import COMMASPACE, formatdate
from email import Encoders
import smtplib
class EMail(object):
""" Class defines method to send email of attachment
"""
def __init__(self, sendto, mailFrom, server, usrname, password, files, debug=False, subjt=None):
self.debug = debug
self.mailto = sendto
self.mailFrom = mailFrom
self.smtpserver = server
self.EMAIL_PORT = 587
self.usrname = usrname
self.password = password
self.subject = subjt
# self.send(files)
def sendMessage(self, msgContent, files):
#collect info and prepare email
if files:
if self.subject == "":
#Subject should contains of file attached
if len(files) <=3: subjAdd = ','.join(files)
if len(files) > 3: subjAdd = ','.join(files[:3]) + '...'
self.subject= self.systemLogin() +" sent mail from maya "+ os.path.basename(subjAdd)
print "subject: ", self.subject
msg = self.prepareMail(self.mailFrom, self.mailto, self.subject, msgContent, files)
# connect to server and send email
server=smtplib.SMTP(self.smtpserver, port=self.EMAIL_PORT)
server.ehlo()
server.starttls()#use encrypted SSL mode
server.ehlo() # to make starttls work
server.login(self.usrname, self.password)
server.set_debuglevel(self.debug)
try:
failed = server.sendmail(From, to, msg.as_string())
except Exception as er:
print er
finally:
server.quit()
def prepareMail(self, From, to, subject, msgHTML, attachments):
msg = MIMEMultipart()
msg['From'] = From
msg['To'] = to
msg['Date'] = formatdate(localtime=True)
msg['Subject'] = subject
#The Body message
msg.attach(MIMEText(msgHTML, 'html'))
msg.attach(MIMEText("Sent from maya by Mini Me"))
if attachments:
for phile in attachments:
#we could check for MIMETypes here
part = MIMEBase('application',"octet-stream")
part.set_payload(open(phile, "rb").read())
Encoders.encode_base64(part)
part.add_header('Content-Disposition', 'attachment; filename="%s"' % os.path.basename(phile))
msg.attach(part)
return msg
and here is the HTML formatted text I am sending, (I have removed the HTML
head section it being long due to css)
<body class="body_foreground body_background" style="font-size: normal;" >
<pre>
---
send.py | 4 <span class="ansi32">+</span><span class="ansi31">---</span>
1 file changed, 1 insertion(+), 3 deletions(-)
<span class="ansi1">diff --git a/send.py b/send.py</span>
<span class="ansi1">index 87126d5..abb1fd8 100644</span>
<span class="ansi1">--- a/send.py</span>
<span class="ansi1">+++ b/send.py</span>
<span class="ansi36">@@ -49,14 +49,12 @@</span> class EMail(object):
server.quit()
def prepareMail(self, From, to, subject, msgHTML, attachments):
<span class="ansi31">- msg = MIMEMultipart('alternative')</span>
<span class="ansi32">+</span> <span class="ansi32">msg = MIMEMultipart()</span>
msg['From'] = From
msg['To'] = to
msg['Date'] = formatdate(localtime=True)
msg['Subject'] = subject
<span class="ansi31">- print msgHTML</span>
<span class="ansi31">-</span>
#The Body message
msg.attach(MIMEText(msgHTML, 'html'))
msg.attach(MIMEText("Sent from maya by Mini Me"))
--
1.8.3.4 (Apple Git-47)
</pre>
</body>
</html>
it seems only pre tag formatting is working not the css .. why would that be ?
Answer: Gmail doesn't support `<style>` blocks. You can see a css support comparison
between popular mail clients here: [Guide to CSS support in
email](http://www.campaignmonitor.com/css/).
|
HTTP Server Python: how to test it in local?
Question: I have 2 networks on my computer (Wifi network for internet, and local network
based on wired cable) with specific mask and IP (this configuration works).
I have a Python HTTP server (on my computer) for the local network:
or simply
>>> python server.py
Serving on localhost:8000
You can use this to test GET and POST methods.
"""
import SimpleHTTPServer
import SocketServer
import logging
import cgi
import sys
if len(sys.argv) > 2:
PORT = int(sys.argv[2])
I = sys.argv[1]
elif len(sys.argv) > 1:
PORT = int(sys.argv[1])
I = ""
else:
PORT = 8000
I = ""
class ServerHandler(SimpleHTTPServer.SimpleHTTPRequestHandler):
def do_GET(self):
print "======= GET STARTED ======="
logging.warning("======= GET STARTED =======")
logging.warning(self.headers)
SimpleHTTPServer.SimpleHTTPRequestHandler.do_GET(self)
def do_POST(self):
print "======= POST STARTED ======="
logging.warning("======= POST STARTED =======")
logging.warning(self.headers)
form = cgi.FieldStorage(
fp=self.rfile,
headers=self.headers,
environ={'REQUEST_METHOD':'POST',
'CONTENT_TYPE':self.headers['Content-Type'],
})
logging.warning("======= POST VALUES =======")
for item in form.list:
logging.warning(item)
logging.warning("\n")
SimpleHTTPServer.SimpleHTTPRequestHandler.do_GET(self)
Handler = ServerHandler
httpd = SocketServer.TCPServer(("10.0.0.2", PORT), Handler)
print "@rochacbruno Python http server version 0.1 (for testing purposes only)"
print "Serving at: http://%(interface)s:%(port)s" % dict(interface=I or "localhost", port=PORT)
httpd.serve_forever()
I just want to try if this server works: from my Google CHrome, I set this
URL: 10.0.0.2/?method=1234
And no trace appears on the Python shell...
So, my question is: how can I test this Python server from my computer in
first (to be sure it works) ?
Thank you very much guys for your help
Anthony
Answer: Ok guys, I found the problem: it was the port number; I changed it to 888 for
example and it works now :-)
Anthony
|
Why running a same script in different location cause errors?
Question: I try to run a script that's using third party module (completely install by
`pip install module`) in Ubuntu 13.10. This script located in NTFS partition.
import foo
API_KEY = "xxx"
api = foo.FOO(APIKEY)
and it's return error like
$ python test.py
Traceback (most recent call last):
File "test.py", line 3, in <module>
import foo
File "/media/path/to/project/test.py", line 6, in <module>
api = foo.Foo(API_KEY)
AttributeError: 'module' object has no attribute 'Foo'
but when I copy a same code to `~/Desktop/test.py` then it's work correctly.
Is script's location cause these error or if it's not what's the problem?
Answer: Check whether there is `foo.py` file in the directory. If there's one, it
could prevent importing the module you want.
Issuing following command in both directory will give you the path of foo
module:
python -c "import foo; print(foo.__file__)"
If you find there's unexpected `foo.py`, rename it or remove it. (Make sure
there's no `foo.pyc` remain)
|
Python couldn't insert row to MySQL
Question: I'm trying to accomplish following query:
sql = "INSERT INTO adr_citydistricts (CityDistrict, CityDistrictRU) VALUES (% (ua) s,% (ru) s);"
data = {'ua': 'ukrainian', 'ru': 'russian'}
cursor.execute (sql, data)
After executing this query, there is no such record in table.
If do the same query in SQLyog, record will exists.
I've also tried:
sql = "INSERT INTO adr_citydistricts (CityDistrict, CityDistrictRU) VALUES ('123 ', '333');"
cursor.execute (sql)
print sql
and there is no row in the table.
The console displays : `INSERT INTO adr_citydistricts (CityDistrict,
CityDistrictRU) VALUES ('123 ', '333');`
Executing this query in SQLyog, normally inserts a row in the table.
I've created another table with the same structure.
Can someone help me, please?
Answer: You need to [`cursor.commit()`](http://dev.mysql.com/doc/connector-
python/en/connector-python-api-mysqlconnection-commit.html) to reflect
changes.
> ### [9.2.3. Method
> `MySQLConnection.commit()`](http://dev.mysql.com/doc/connector-
> python/en/connector-python-api-mysqlconnection-commit.html)
>
> This method sends a COMMIT statement to the MySQL server, committing the
> current transaction. Since by default Connector/Python does not autocommit,
> it is important to call this method after every transaction that modifies
> data for tables that use transactional storage engines.
|
convert list into random list within list python
Question: Let us imagine that in python we have list of numbers, like this:
[1, 3, 4, 5, 6, 7, 8, 9]
What is the simplest possible way to convert this list of numbers into a
random series of lists within lists?
Like this:
[[1, 2, 3], [4], 5, 6, [7, 8], 9]
Answer: Using
[`random.randint`](http://docs.python.org/3/library/random.html#random.randint):
import random
def random_series(lst, size=3):
start = end = 0
n = len(lst)
while end < n:
end += random.randint(1, size)
if end - start == 1:
yield lst[start]
else:
yield lst[start:end]
start = end
Example usage:
>>> lst = [1, 2, 3, 4, 5, 6, 7, 8, 9]
>>> list(random_series(lst))
[[1, 2, 3], 4, 5, [6, 7], [8, 9]]
>>> list(random_series(lst))
[[1, 2], [3, 4], [5, 6], 7, 8, 9]
>>> list(random_series(lst))
[[1, 2], [3, 4, 5], [6, 7], [8, 9]]
>>> list(random_series(lst))
[[1, 2, 3], [4, 5, 6], 7, [8, 9]]
|
multiprocessing.Queue deadlocks after "reader" process death
Question: I've been playing with multiprocessing package and noticed that queue can be
deadlocked for reading when:
1. The "reader" process is using [get](http://docs.python.org/2/library/multiprocessing.html#multiprocessing.Queue.get) with _timeout_ > 0:
self.queue.get(timeout=3)
2. "reader" dies while [get](http://docs.python.org/2/library/multiprocessing.html#multiprocessing.Queue.get) is blocking due to _timeout_.
After that queue is locked forever.
### Application demonstrating the problem
I create two child processes "Worker" (putting into queue) and "Receiver"
(getting from queue). Also parent process periodically checks if his children
[are
alive](http://docs.python.org/2/library/multiprocessing.html#multiprocessing.Process.is_alive)
and starts new child if needed.
#!/usr/bin/env python
# -*- coding: utf-8 -*-
import multiprocessing
import procname
import time
class Receiver(multiprocessing.Process):
''' Reads from queue with 3 secs timeout '''
def __init__(self, queue):
multiprocessing.Process.__init__(self)
self.queue = queue
def run(self):
procname.setprocname('Receiver')
while True:
try:
msg = self.queue.get(timeout=3)
print '<<< `{}`, queue rlock: {}'.format(
msg, self.queue._rlock)
except multiprocessing.queues.Empty:
print '<<< EMPTY, Queue rlock: {}'.format(
self.queue._rlock)
pass
class Worker(multiprocessing.Process):
''' Puts into queue with 1 sec sleep '''
def __init__(self, queue):
multiprocessing.Process.__init__(self)
self.queue = queue
def run(self):
procname.setprocname('Worker')
while True:
time.sleep(1)
print 'Worker: putting msg, Queue size: ~{}'.format(
self.queue.qsize())
self.queue.put('msg from Worker')
if __name__ == '__main__':
queue = multiprocessing.Queue()
worker = Worker(queue)
worker.start()
receiver = Receiver(queue)
receiver.start()
while True:
time.sleep(1)
if not worker.is_alive():
print 'Restarting worker'
worker = Worker(queue)
worker.start()
if not receiver.is_alive():
print 'Restarting receiver'
receiver = Receiver(queue)
receiver.start()
### How processes tree looks like in _ps_
bash
\_ python queuetest.py
\_ Worker
\_ Receiver
### Console output
$ python queuetest.py
Worker: putting msg, Queue size: ~0
<<< `msg from Worker`, queue rlock: <Lock(owner=None)>
Worker: putting msg, Queue size: ~0
<<< `msg from Worker`, queue rlock: <Lock(owner=None)>
Restarting receiver <-- killed Receiver with SIGTERM
Worker: putting msg, Queue size: ~0
Worker: putting msg, Queue size: ~1
Worker: putting msg, Queue size: ~2
<<< EMPTY, Queue rlock: <Lock(owner=SomeOtherProcess)>
Worker: putting msg, Queue size: ~3
Worker: putting msg, Queue size: ~4
Worker: putting msg, Queue size: ~5
<<< EMPTY, Queue rlock: <Lock(owner=SomeOtherProcess)>
Worker: putting msg, Queue size: ~6
Worker: putting msg, Queue size: ~7
Is there any way to bypass this? Using
[get_nowait](http://docs.python.org/2/library/multiprocessing.html#multiprocessing.Queue.get_nowait)
combined with sleep seems to be some kind of workaround but it does not read
the data "as it comes".
### System information
$ uname -sr
Linux 3.11.8-200.fc19.x86_64
$ python -V
Python 2.7.5
In [3]: multiprocessing.__version__
Out[3]: '0.70a1'
### "it just works" solution
While writing this question I came up with some silly modification to Receiver
class:
class Receiver(multiprocessing.Process):
def __init__(self, queue):
multiprocessing.Process.__init__(self)
self.queue = queue
def run(self):
procname.setprocname('Receiver')
while True:
time.sleep(1)
while True:
try:
msg = self.queue.get_nowait()
print '<<< `{}`, queue rlock: {}'.format(
msg, self.queue._rlock)
except multiprocessing.queues.Empty:
print '<<< EMPTY, Queue rlock: {}'.format(
self.queue._rlock)
break
But it doesn't seem very good to me.
Answer: It's probably because *not_empty.release()* from _Queue.get()_ never happends
(the proccess has been killed already). Did you try to catch the TERM signal
in Receiver and release the Queue mutex before exiting?
|
how to work with time.strftime in django 1.6
Question: I am one of the new user in django 1.6 but one thing very bad I have noticed
in this version of django is that time.strftime("%H:%M:%S") does not working
and giving a wrong time in my view . Is there any alternating approach for
getting a right time in django view or not ?
_**Note : if you type print(time.strftime("%H:%M:%S")) in python 3 you will
see a right time but in django 1.6 it is not true_**
Thank you.
Answer: Maybe you're dealing with UTC time. Convert it to local time before call
`strftime`:
>>> from django.utils import timezone
>>> now = timezone.now()
>>> now.strftime('%H:%M:%S')
'13:23:52'
>>> timezone.localtime(now).strftime('%H:%M:%S')
'22:23:52'
See [Time zones | Django documentation](https://docs.djangoproject.com/en/1.6/topics/i18n/timezones/).
|
Python findAll not working on beautifulsoup 3
Question: I am trying to parse a html file and write the results to a csv file. The html
file is:
<table BORDER='1' CELLSPACING='0' CELLPADDING='0'>
<tr>
<td><small>15</small></td >
<td><small><small>Cat</small></small></td>
</tr>
<tr>
<td><small><small>16</small></small></td>
<td><small><small> </small></small></td>
</tr>
<tr>
<td><small>17</small></td >
<td><small><small>Dog</small></small></td>
</tr>
</table>
and the code I have atm is:
import csv
from BeautifulSoup import BeautifulSoup as bs
soup = bs (open("Animals.html"))
for i in soup.findAll('small'):
if " " in i.text:
i.string = '-'
print soup
f = csv.writer(open("Animals.csv", "a")) # Open the output file for writing before the loop
trs = soup.findAll('tr')
for tr in trs:
tds = tr.findAll("td")
try: #we are using "try" because the table is not well formatted. This allows the program to continue after encountering an error.
id = str(tds[0].get_text()) # This structure isolate the item by its column in the table and converts it into a string.
animal = str(tds[1].get_text())
except:
print "Bad tr string"
continue #This tells the computer to move on to the next item after it encounters an error
f.writerow([id, animal])
When I print out the contents of soup after replacing the `%nbsp;` I get:
<table BORDER='1' CELLSPACING='0' CELLPADDING='0'>
<tr>
<td><small>15</small></td >
<td><small></small><small>Cat</small></td >
</tr>
<tr>
<td><small><small>16</small></small></td >
<td><small></small><small>-</small></td >
</tr>
<tr>
<td><small>17</small></td >
<td><small></small><small>Dog</small></td >
</tr>
</table>
But when I look at the .csv file it is empty. However if I change the code to
use BeautifulSoup 4, then I can't replace the ` ` but the results will be
saved to the .csv file. The other code that I use is:
import csv
from bs4 import BeautifulSoup as bs
soup = bs (open("Animals.html"))
f = csv.writer(open("Animals.csv", "w")) # Open the output file for writing before the loop
trs = soup.find_all('tr')
for tr in trs:
tds = tr.find_all("td")
try: #we are using "try" because the table is not well formatted. This allows the program to continue after encountering an error.
id = str(tds[0].get_text()) # This structure isolate the item by its column in the table and converts it into a string.
animal = str(tds[1].get_text())
except:
print "Bad tr string"
continue #This tells the computer to move on to the next item after it encounters an error
f.writerow([id, animal])
The reason why that one won't do me is because I want the ` ` to be
replaced with `-` and I haven't been able to get that (the find_all()) to work
with beautifulsoup 4. What is causing the information to be saved to the csv
file and how can I fix it (and/or get it working with beautifulsoup 4)?
Answer: BeautifulSoup 4 will convert that 'nbsp;' into a Unicode character \xa0 when
the 'soup' is constructed. If you search-and-replace on that unicode character
it will work:
soup = BeautifulSoup(html)
for i in soup.find_all('small'):
i.string.replace_with(i.string.replace(u'\xa0', '-'))
The syntax there is a little verbose. This is because `i.string` is not a
string, but a `bs4.element.NavigableString`. You can't edit these in place
with a straightforward `i.string.replace(...)`; instead you must call
beautifulsoup's own `replace_with` method.
`replace_with` accepts just one argument, so we have to generate the new
version of the string and pass it in. For this we can use Python's built in
`replace` method for strings, to strip out the u'\xa0' characters and replace
them with '-'
Alternatively, you could just use regular expressions on the original HTML. If
all you need is to replace all ` ` instances with a `-`:
import re
newhtml = re.sub(r' ', '-', html)
Though you could customise this further so it only affects `<small>` tags -
let me know if you'd like this added to the answer.
|
Python 2.6 ImportError: No module named argparse
Question: I'm trying to run git-cola from Red Hat Enterprise Linux Server release 6.5
and receive:
Traceback (most recent call last):
File "....../bin/git-cola", line 24, in <module>
from argparse import ArgumentParser
ImportError: No module named argparse
I think I have all of the required packages installed:
* git-1.7.1-3.el6_4.1.x86_64
* python-2.6.6-51.el6.x86_64
* PyQt4.x86_64 0:4.6.2-9.el6
* /usr/lib/python2.6/site-packages/argparse-1.2.1-py2.6.egg
I read in other blogs that there may be a problem with Python 2.6 and may need
to move to 2.7.
Additional information - @iljau noticed that argparse is in a 32 bit lib,
while the rest of python is in 64 bits. I would have expected that:
easy_install argparse
would have sorted this out and installed the 64 bit version.
Additional question: Does anyone know how to install the 64 bit version of
argparse. It is not apparent to me from searching the internet. I will
continue looking.
I installed argparse by downloading the tar file and
python setup.py install
However, it still installed it in the lib rather than lib64 path - and it
looks like a 64 bit install. So something else must be the problem in
referencing argparse properly. I don't know Python enough to debug it, but I
suspect that git-cola needs some work for Python 2.6.
Answer: As a simple solution copy `argparse.py` from
<https://code.google.com/p/argparse/source/browse/argparse.py> to your project
folder.
* * *
And indeed, for Python 2.6 `argparse` needs to be installed separately.
From: <https://pypi.python.org/pypi/argparse>
> As of Python >= 2.7 _.._ the argparse module is maintained within the Python
> standard library. For users who still need to support Python < 2.7 _.._ it
> is also provided as a separate package, which _.._ also supports older
> Python versions.
But even after you install `argparse`, it may refuse to work for some
mysterious reasons.
Additional debugging tips may be found in answers and comments to question
["ImportError: No module named
argparse"](http://stackoverflow.com/q/15093444/2419207).
|
How do I import a text file with no separators in python, using numpy?
Question: How do I import a file with no separators?
I have a file named `text.txt` which contains 2 lines of text:
> 00000000011100000000000000000000
> 00000000011111110000000000000000
When I use
> f = open("text.txt")
> data = np.loadtxt(f)
I get
> [ 1.11000000e+22 1.11111100e+22]
Using `sep=""` changes nothing.
I would like to get this result, in the form of many single digit integers:
> [ [00000000011100000000000000000000]
> [00000000011111110000000000000000] ]
Any help is appreciated.
**UPDATE:** Thank you all for the great answers and the many valid solutions
to an awkward question.
Answer: I'll take the statement "I would like to get this result, in the form of many
single digit integers:" literally, and ignore the format of the sample that
follows it (which appears to be just two integers, rather than many single
digit integers). You can do that with
[`genfromtxt`](http://docs.scipy.org/doc/numpy/reference/generated/numpy.genfromtxt.html)
by using the arguments `delimiter=1` and `dtype=int`. When `delimiter` is an
integer or a sequence of integers, the values are interpreted as the field
widths of a file containing fixed-width fields of data.
For example:
In [15]: genfromtxt('text.txt', delimiter=1, dtype=int)
Out[15]:
array([[0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
0, 0, 0, 0, 0, 0, 0, 0, 0, 0],
[0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 1, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0,
0, 0, 0, 0, 0, 0, 0, 0, 0, 0]])
|
No module named _graphviz
Question: I installed graphviz and pygraphviz, when I open a cmd and type
python
import _graphviz
_graphviz can be imported, but when I run a C++ program which will invoke a
.py file, there is a line in this .py file which is
import pygraphviz as pgv
Then it will not be able to import _graphviz, it shows the following info:
Traceback (most recent call last):
File "E:\project\graph\analysis\x64\Debug\gengraph.py", line 1, in <module>
import pygraphviz as pgv
File "C:\Program Files\Python27\lib\site-packages\pygraphviz\__init__.py", lin
e 54, in <module>
from agraph import AGraph, Node, Edge, Attribute, ItemAttribute
File "C:\Program Files\Python27\lib\site-packages\pygraphviz\agraph.py", line
20, in <module>
import graphviz as gv
File "C:\Program Files\Python27\lib\site-packages\pygraphviz\graphviz.py", lin
e 7, in <module>
import _graphviz
ImportError: No module named _graphviz
Can you help me, any advice is welcome, thank you!
Answer: What system are you using? I spent a good 4 hours trying to figure it out on
Windows but ended up migrating my project to Ubuntu. From what I've learned,
it's caused by the program not finding the pygraphviz file. It searches in
this sequence on Windows: 1,register; 2,PATH; 3,folders. Some methods
availables:
**Find the block in setup.py for register and skip it.**
**Rename folder of pygraphviz installation(remove blanks) and move it to a
path without blanks**
In Ubuntu, you could simply "sudo easy-install pygraphviz" which worked for
me.
|
feature_importances_ showing up as NoneType in ExtraTreesClassifier :TypeError: 'NoneType' object is not iterable
Question: I am trying to select important features (or at least understand which
features explain more variabilty) for a given dataset. Towards this I use both
ExtraTreesClassifier and GradientBoostingRegressor - and then use :-
clf = ExtraTreesClassifier(n_estimators=10,max_features='auto',random_state=0) # stops after 10 estimation passes, right ?
clf.fit(x_train, y_train)
feature_importance=clf.feature_importances_ # does NOT work - returns NoneType for feature_importance
Post this **I am really interested** in plotting them(for visual
representation) - or even preliminary, just **looking at the relative order of
importance and the corresponding indices**
# Both of these do not work as the feature_importance is of NoneType
feature_importance = 100.0 * (feature_importance / feature_importance.max())
indices = numpy.argsort(feature_importance)[::-1]
What I found puzzling was - if I were to use GradientBoostingRegressor as
below, I do get the feature_importance and the indices thereof. What am I
doing wrong ?
#Works with GradientBoostingRegressor
params = {'n_estimators': 100, 'max_depth': 3, 'learning_rate': 0.1, 'loss': 'lad'}
clf = GradientBoostingRegressor(**params).fit(x_train, y_train)
clf.fit(x_train, y_train)
feature_importance=clf.feature_importances_
_other info_ : I have 12 independent vars(x_train) and one label var(y_train))
with multiple values (say 4,5,7) and type(x_train) is and
type(feature_importance) is
_Acknowledgments_ : Some elements are borrowed from this post
<http://www.tonicebrian.com/2012/11/05/training-gradient-boosting-trees-with-
python/>
Answer: When initializing an [ExtraTreeClassifier](http://scikit-
learn.org/stable/modules/generated/sklearn.tree.ExtraTreeClassifier.html),
there is an option `compute_importances` which defaults to `None`. In other
words, you need to initialize `ExtraTreeClassifier` as
clf = ExtraTreesClassifier(n_estimators=10,max_features='auto',random_state=0,compute_importances=True)
so that it will compute the feature importance.
Where as for [GradientBoostedRegressor](http://scikit-
learn.org/stable/modules/generated/sklearn.ensemble.GradientBoostingRegressor.html),
there is no such option and feature importance will always be computed.
|
path.py not recognized in eclipse
Question: I installed the path package:
easy_install path.py
running ipython I can validly run:
from path import path
Eclipse (after restart) does not recognize this (unresolved import "path"). It
also will not auto-complete class members and functions.
Any idea how to solve this?
Answer: Accroding to [PyDev FAQ](http://pydev.org/faq.html#PyDevFAQ-
IhavealibraryinstalledandPyDevdoesnotfindit):
> ## I have a library installed and PyDev does not find it
>
> Well, problems have been reported on Mac and Linux, and the main reason
> seems to be symlinks. PyDev will only find extensions that are 'really'
> below the python install directory. This happens because the 'less common
> denominator', which in this case is windows, does not have symlinks. A
> workaround to this problem includes **manually adding the given folder
> installation to the pythonpath** or **changing the installation of the
> package to be under the site-packages folder.**
|
Using Flask-Mail asynchronously results in "RuntimeError: working outside of application context"
Question: I am trying to send some mail asynchronously (based on the code in [The Flask
Mega-Tutorial, Part XI: Email
Support](http://blog.miguelgrinberg.com/post/the-flask-mega-tutorial-part-xi-
email-support)). However, I get the following error about working outside an
application context. How do I fix this problem?
Traceback (most recent call last):
File "C:\Users\Primoz\Desktop\RecycleFlaskServer\recycleserver\helpers.py", line 17, in send_async_email
mail.send(msg)
File "C:\Python33\lib\site-packages\flask_mail-0.9.0-py3.3.egg\flask_mail.py", line 434, in send
message.send(connection)
File "C:\Python33\lib\site-packages\flask_mail-0.9.0-py3.3.egg\flask_mail.py", line 369, in send
connection.send(self)
File "C:\Python33\lib\site-packages\flask_mail-0.9.0-py3.3.egg\flask_mail.py", line 173, in send
email_dispatched.send(message, app=current_app._get_current_object())
File "C:\Python33\lib\site-packages\werkzeug-0.9.4-py3.3.egg\werkzeug\local.py", line 297, in _get_current_object
return self.__local()
File "C:\Python33\lib\site-packages\flask-0.10.1-py3.3.egg\flask\globals.py", line 34, in _find_app
raise RuntimeError('working outside of application context')
RuntimeError: working outside of application context
from flask import Flask
from flask.ext.mail import Mail
app = Flask(__name__)
app.config.from_object('recycleserver.settings')
mail = Mail(app)
def async(f):
def wrapper(*args, **kwargs):
thr = Thread(target = f, args = args, kwargs = kwargs)
thr.start()
return wrapper
@async
def send_async_email(msg):
mail.send(msg)
def send_simple_mail(subject, sender, to_who, text_body="", html_body=""):
msg = Message(subject=subject,sender=sender, recipients=to_who)
msg.body = text_body
msg.html = html_body
send_async_email(msg)
Answer: The code should run in an app context. Add `with app.app_context()`:
@async
def send_async_email(msg):
with app.app_context():
mail.send(msg)
|
Is there an NSCoding-like facility in Python?
Question: As an iOS developer recently experimenting with Python, I'm curious to know if
there's something like `NSCoding` that would allow me to implement a method or
a pair of methods which would define how my objects can be automatically saved
to disk, much like `NSCoding`.
I've found [this
repo](https://code.google.com/p/jsstep/source/browse/trunk/framework/python/jsstep/foundation/protocols/NSCoding.py?r=38)
but I'm not sure if it's part of a larger framework, which I'd rather not
incorporate into my (small) project.
Is there something that ships with Python? Anything popular out there that
deals with object persistence in a primitive yet powerful way?
Answer: The `pickle` module is used for serializing objects.
<http://docs.python.org/2/library/pickle.html>
You can usually just use it as-is, but if you need to define how objects
should be serialized, you can override the special methods, `__getstate__` and
`__setstate__`
import cPickle as pickle # faster implementation
path = 'test.dat'
obj = ('Hello, world!', 123, {'x': 0})
# save to disk
with open(path, 'wb') as fp:
pickle.dump(obj, fp)
# load from disk
with open(path, 'rb') as fp:
obj = pickle.load(fp)
print obj
|
Searching for equivalent of FileNotFoundError in Python 2
Question: I created a class named Options. It works fine but not not with Python 2. And
I want it to work on both Python 2 and 3. The problem is identified:
FileNotFoundError doesn t exist in Python 2. But if I use IOError it doesn t
work in Python 3
Changed in version 3.3: EnvironmentError, IOError, WindowsError, VMSError,
socket.error, select.error and mmap.error have been merged into OSError.
What should I do ???(Please do not discuss my choice of portability, I have
reasons.)
Here s the code:
#!/usr/bin/python
#-*-coding:utf-8*
#option_controller.py
#Walle Cyril
#25/01/2014
import json
import os
class Options():
"""Options is a class designed to read, add and change informations in a JSON file with a dictionnary in it.
The entire object works even if the file is missing since it re-creates it.
If present it must respect the JSON format: e.g. keys must be strings and so on.
If something corrupted the file, just destroy the file or call read_file method to remake it."""
def __init__(self,directory_name="Cache",file_name="options.json",imported_default_values=None):
#json file
self.option_file_path=os.path.join(directory_name,file_name)
self.directory_name=directory_name
self.file_name=file_name
#self.parameters_json_file={'sort_keys':True, 'indent':4, 'separators':(',',':')}
#the default data
if imported_default_values is None:
DEFAULT_INDENT = 2
self.default_values={\
"translate_html_level": 1,\
"indent_size":DEFAULT_INDENT,\
"document_title":"Titre"}
else:
self.default_values=imported_default_values
def read_file(self,read_this_key_only=False):
"""returns the value for the given key or a dictionary if the key is not given.
returns None if it s impossible"""
try:
text_in_file=open(self.option_file_path,'r').read()
except FileNotFoundError:#not 2.X compatible
text_in_file=""#if the file is not there we re-make one with default values
if text_in_file=="":#same if the file is empty
self.__insert_all_default_values()
text_in_file=open(self.option_file_path,'r').read()
try:
option_dict=json.loads(text_in_file)
except ValueError:
#if the json file is broken we re-make one with default values
self.__insert_all_default_values()
text_in_file=open(self.option_file_path,'r').read()
option_dict=json.loads(text_in_file)
if read_this_key_only:
if read_this_key_only in option_dict:
return option_dict[read_this_key_only]#
else:
#if the value is not there it should be written for the next time
if read_this_key_only in self.default_values:
self.add_option_to_file(read_this_key_only,self.default_values[read_this_key_only])
return self.default_values[read_this_key_only]
else:
#impossible because there is not default value so the value isn t meant to be here
return None
else:
return option_dict
def add_option_to_file(self,key,value):#or update
"""Adds or updates an option(key and value) to the json file if the option exists in the default_values of the object."""
option_dict=self.read_file()
if key in self.default_values:
option_dict[key]=value
open(self.option_file_path,'w').write(\
json.dumps(option_dict,sort_keys=True, indent=4, separators=(',',':')))
def __insert_all_default_values(self):
"""Recreate json file with default values.
called if the document is empty or non-existing or corrupted."""
try:
open(self.option_file_path,'w').write(\
json.dumps(self.default_values,sort_keys=True, indent=4, separators=(',',':')))
except FileNotFoundError:
os.mkdir(self.directory_name)#Create the directory
if os.path.isdir(self.directory_name):#succes
self.__insert_all_default_values()
else:
print("Impossible to write in %s and file %s not found" % (os.getcwd(),self.option_file_path))
#demo
if __name__ == '__main__':
option_file_object=Options()
print(option_file_object.__doc__)
print(option_file_object.read_file())
option_file_object.add_option_to_file("","test")#this should have no effect
option_file_object.add_option_to_file("translate_html_level","0")#this should have an effect
print("value of translate_html_level:",option_file_object.read_file("translate_html_level"))
print(option_file_object.read_file())
Answer: If `FileNotFoundError` isn't there, define it:
try:
FileNotFoundError
except NameError:
FileNotFoundError = IOError
Now you can catch `FileNotFoundError` in Python 2 since it's really `IOError`.
Be careful though, `IOError` has other meanings. In particular, any message
should probably say "file could not be read" rather than "file not found."
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.