text
stringlengths 226
34.5k
|
|---|
pylab scilimits not working
Question: I'm trying to make a simple graph in with python 2.7's matplotlib module.
The problem I'm having is that the function
`ticklabel_format(style='sci',axis='y',scilimits=(-3.0e-6,-1.0e-6))` is not
applying the given scilimit values. I've tried turning off the autoscaling
before and after the plot command
If I use the values in the `ylim` function it does work, but it won't be in
scientific notation. Any help would be hot.
from pylab import *
v=[-1,-2,-3,-4,-5]
i=[-1.57e-6,-1.8e-6,-1.97e-6,-2.18e-6,-2.30e-6]
plot(v,i,"bo")
autoscale(enable=False)
xlim(-6,0)
#ylim(-3e-6,-1e-6)
ticklabel_format(style='sci',axis='y',scilimits=(-3.0e-6,-1.0e-6))
xlabel("Voltage/(V)")
ylabel("Current/(A)")
title("Current vs Voltage \n(Schottky Reverse Bias)")
grid()
show()
Answer: Try:
gca().ticklabel_format(style='sci',axis='y',scilimits=(0,0))
ylim(-3e-6,-1e-6)
|
Resolve Substitutions in RestructuredText
Question: I want to take the following restructured text snippet that contains a
[substitution
definition](http://docutils.sourceforge.net/docs/ref/rst/restructuredtext.html#substitution-
definitions):
text = """
|python|
.. |python| image:: python.jpg
"""
And resolve the definitions so the substitution text is displayed:
resolved_text = """
.. image:: python.jpg
"""
Is there a function or utility in docutils or another module that can do this?
Answer: `docutils` provides [publisher
functions](http://docutils.sourceforge.net/docs/api/publisher.html#publisher-
convenience-functions) to use docutils as a library.
So using `docutils.core.publish_string` could be an option for your usecase.
In [90]: from docutils import core
In [91]: text = '|python|\n\n.. |python| image:: python.jpg\n'
In [92]: print core.publish_string(text)
<document source="<string>">
<paragraph>
<image alt="python" uri="python.jpg">
<substitution_definition names="python">
<image alt="python" uri="python.jpg">
By default `puplish_string` uses a `pseudoxml` writer, which you can see in
the output. However if you really want to have the plain text output from your
question, you need a custom writer class derived from
`docutils.writers.Writer`. I'm not sure how to implement this, maybe the
`Sphinx`
[TextWriter](https://bitbucket.org/birkenfeld/sphinx/src/8ec0b3a74e791e59dfee2d484380c34881530a89/sphinx/writers/text.py?at=default#cl-133)
could be a starting point.
Seems that if you really only need the simple substitution, using `replace` on
your text would be a simpler solution, if you need more complicated things,
implement this using docutils is complicated, too.
|
Python BeautifulSoup Extract specific URLs
Question: Is it possible to get only specific URLs?
Like:
<a href="http://www.iwashere.com/washere.html">next</a>
<span class="class">...</span>
<a href="http://www.heelo.com/hello.html">next</a>
<span class="class">...</span>
<a href="http://www.iwashere.com/wasnot.html">next</a>
<span class="class">...</span>
Output should be only URLs from `http://www.iwashere.com/`
like, output URLs:
http://www.iwashere.com/washere.html
http://www.iwashere.com/wasnot.html
I did it by string logic. Is there any direct method using BeautifulSoup?
Answer: You can match multiple aspects, including using a regular expression for the
attribute value:
import re
soup.find_all('a', href=re.compile('http://www\.iwashere\.com/'))
which matches (for your example):
[<a href="http://www.iwashere.com/washere.html">next</a>, <a href="http://www.iwashere.com/wasnot.html">next</a>]
so any `<a>` tag with a `href` attribute that has a value that starts with the
string `http://www.iwashere.com/`.
You can loop over the results and pick out just the `href` attribute:
>>> for elem in soup.find_all('a', href=re.compile('http://www\.iwashere\.com/')):
... print elem['href']
...
http://www.iwashere.com/washere.html
http://www.iwashere.com/wasnot.html
To match all relative paths instead, use a negative look-ahead assertion that
tests if the value does _not_ start with a schem (e.g. `http:` or `mailto:`),
or a double slash (`//hostname/path`); any such value _must_ be a relative
path instead:
soup.find_all('a', href=re.compile(r'^(?!(?:[a-zA-Z][a-zA-Z0-9+.-]*:|//))'))
|
Python not calling an external program part 3
Question: I have been having problems trying to run an external program from a python
program that was generated from a trigger in a postgres 9.2 database. The
trigger works. It writes to a file. I had tried just running the external
program but the permissions would not allow it to run. I was able to create a
folder (using os.system(“mkdir”) ). The owner of the folder is NETWORK
SERVICE.
I need to run a program called sdktest. When I try to run it no response
happens so I think that means that the python program does not have enough
permissions (with an owner of NETWORK SERVICE) to run it.
I have been having my program copy files that it needs into that directory so
they would have the correct permissions and that has worked to some degree but
the program that I need to run is the last one and it is not running because
it does not have enough permissions.
My python program runs a C++ program called PG_QB_Connector which calls
sdktest.
Is there any way I can change the owner of the process to be a “normal” owner?
Is there a better way to do this? Basically I just need to have this C++
program have eniough perms to run correctly.
BTW, when I run the C++ program by hand, the line that runs the sdktest
program runs correctly, however, when I run it from the postgres/python it
does not do anything...
I have Windows 7, python 3.2. The other 2 questions that I asked about this
are located [here](http://stackoverflow.com/questions/14278109/python-not-
calling-external-program) and
[here](http://stackoverflow.com/questions/14364928/python-not-calling-an-
external-program-part-2)
The python program:
CREATE or replace FUNCTION scalesmyone (thename text)
RETURNS int
AS $$
a=5
f = open('C:\\JUNK\\frompython.txt','w')
f.write(thename)
f.close()
import os
os.system('"mkdir C:\\TEMPWITHOWNER"')
os.system('"mkdir C:\\TEMPWITHOWNER\\addcustomer"')
os.system('"copy C:\\JUNK\\junk.txt C:\\TEMPWITHOWNER\\addcustomer"')
os.system('"copy C:\\BATfiles\\junk6.txt C:\\TEMPWITHOWNER\\addcustomer"')
os.system('"copy C:\\BATfiles\\run_addcust.bat C:\\TEMPWITHOWNER\\addcustomer"')
os.system('"copy C:\\Workfiles\\PG_QB_Connector.exe C:\\TEMPWITHOWNER\\addcustomer"')
os.system('"copy C:\\Workfiles\\sdktest.exe C:\\TEMPWITHOWNER\\addcustomer"')
import subprocess
return_code = subprocess.call(["C:\\TEMPWITHOWNER\\addcustomer\\PG_QB_Connector.exe", '"hello"'])
$$ LANGUAGE plpython3u;
The C++ program that is called from the python program and calls sdktest.exe
is below
command = "copy C:\\Workfiles\\AddCustomerFROMWEB.xml C:\\TEMPWITHOWNER\\addcustomer\\AddCustomerFROMWEB.xml";
system(command.c_str());
//everything except for the qb file is in my local folder
command = "C:\\TEMPWITHOWNER\\addcustomer\\sdktest.exe \"C:\\Users\\Public\\Documents\\Intuit\\QuickBooks\\Company Files\\Shain Software.qbw\" C:\\TEMPWITHOWNER\\addcustomer\\AddCustomerFROMWEB.xml C:\\TEMPWITHOWNER\\addcustomer\\outputfromsdktestofaddcust.xml";
system(command.c_str());
Answer: It sounds like you want to invoke a command-line program from within a
PostgreSQL trigger or function.
A usually-better alternative is to have the trigger send a `NOTIFY` and have a
process with a PostgreSQL connection `LISTEN`ing for notifications. When a
notification comes in, the process can start your program. This is the
approach I would recommend; it's a lot cleaner and it means your program
doesn't have to run under PostgreSQL's user ID. See
[`NOTIFY`](http://www.postgresql.org/docs/current/static/sql-notify.html) and
[`LISTEN`](http://www.postgresql.org/docs/current/static/sql-listen.html).
If you really need to run commands from inside Pg:
You can use
[`PL/Pythonu`](http://www.postgresql.org/docs/current/static/plpython.html)
with `os.system` or `subprocess.check_call`;
[`PL/Perlu`](http://www.postgresql.org/docs/current/static/plperl.html) with
`system()`; etc. All these can run commands from inside Pg if you need to. You
can't invoke programs directly from PostgreSQL, you need to use one of the
'untrusted' (meaning fully privileged, not sandboxed) procedural languages to
invoke external executables. PL/TCL can probably do it too.
**Update** :
Your Python code as shown above has several problems:
* Using `os.system` in Python to copy files is just wrong. Use the `shutil` library: <http://docs.python.org/3/library/shutil.html> to copy files, and the simple `os.mkdir` command to create directories.
* The double-layered quoting looks wrong; didn't you mean to quote only each argument not the whole command? You should be using `subprocess.call` instead of `os.system` anyway.
* Your final `subprocess.call` invocation appears OK, but fails to check the error code so you'll never know if it went wrong; you should use `subprocess.check_call` instead.
The C++ code also appears to fail to check for errors from the `system()`
invocations so you'll never know if the command it runs fails.
Like the Python code, copying files in C++ by using the `copy` shell command
is generally wrong. Microsoft Windows provides the
[`CopyFile`](http://msdn.microsoft.com/en-
us/library/windows/desktop/aa363851%28v=vs.85%29.aspx) function for this;
equivalents or alternatives exist on other platforms and you can use portable-
but-less-efficient stream copying too.
|
Python's NLTK documentation
Question: Where can I found the offline documentation for NLTK? It's not in
usr/share/doc, where I mostly find docs of Python modules. And there is no
nltk-doc package that can be installed.
Answer: Okay so it definitely doesn't come with any package. However it can be built.
So first:
sudo apt-get install python-epydoc
This is needed to build the documentation. Then I made this script to automate
the build process for you:
#!/bin/bash
NLTK_VERSION=$(python -c 'import nltk; print nltk.__version__')
NLTK_URL=$(python -c 'import nltk; print nltk.__url__')
EPYDOC_OPTS = --name=nltk --navlink="nltk ${NLTK_VERSION}"\
--url=${NLTK_URL} --inheritance=listed --debug
# Rebuild from scratch
[[ -e ~/python-nltk-docs ]] && rm -rf ~/python-nltk-docs
mkdir ~/python-nltk-docs
epydoc ${EPYDOC_OPTS} -o ~/python-nltk-docs /usr/share/pyshared/nltk
This will drop html docs into `~/python-nltk-docs` for your viewing. I
basically pulled this together from their [doc
Makefile](https://code.google.com/p/nltk/source/browse/trunk/nltk/doc/Makefile).
|
Running django-celery on windows. EOFError
Question: I am using windows 7 64 bit. I installed the latest versions of billiard,
django-celery,and kombu. I included:
import djcelery
djcelery.setup_loader()
to my project setting.py
When I run the following from the root of my project:
python manage.py celeryd -l info
I get the following message (this is the last part of the message):
File "c:\python27\lib\pickle.py", line 562, in save_tuple
save(element)
File "c:\python27\lib\pickle.py", line 286, in save
f(self, obj) # Call unbound method with explicit self
File "c:\python27\lib\pickle.py", line 548, in save_tuple
save(element)
File "c:\python27\lib\pickle.py", line 306, in save
rv = reduce(self.proto)
File "c:\python27\lib\site-packages\celery\app\base.py", line 412, in __reduce__
(self.__class__, self.Pickler) + self.__reduce_args__(),
File "c:\python27\lib\site-packages\celery\app\base.py", line 422, in __reduce_args__
else self.conf._pickleable_changes())
File "c:\python27\lib\site-packages\celery\app\utils.py", line 77, in _pickleable_changes
R.update(d)
TypeError: 'LazySettings' object is not iterable
C:\sources\tourtle>Traceback (most recent call last):
File "<string>", line 1, in <module>
File "c:\python27\lib\site-packages\billiard\forking.py", line 530, in main
self = load(from_parent)
File "c:\python27\lib\pickle.py", line 1378, in load
return Unpickler(file).load()
File "c:\python27\lib\pickle.py", line 858, in load
dispatch[key](self)
File "c:\python27\lib\pickle.py", line 880, in load_eof
raise EOFError
EOFError
I installed MinGW and added distutils.cfg to c:\MinGW\bin but it did not help
Thanks
Answer: Check this discussion on github:
<https://github.com/celery/django-celery/issues/228>
A workaround is that you change celery/app/base.py (lines 418-419) in the way
asksol proposes there:
from:
conf = (self.conf.changes if _forking._forking_is_enabled
else self.conf._pickleable_changes())'
to:
conf = (self.conf.changes if _forking._forking_is_enabled
else {})
It should then work fine
|
Can't run Popen.communicate() twice. (Python subprocess module)
Question: Can anyone explain why I get this error if I run the communicate function
twice?
For instance
from subprocess import *
SVN=Popen('which svn', shell=True, stdout=PIPE)
print SVN.communicate()[0]
returns
"/usr/bin/svn"
but running communicate again...
print SVN.communicate()[0]
returns...
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
File "/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/subprocess.py", line 746, in communicate
stdout = _eintr_retry_call(self.stdout.read)
File "/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/subprocess.py", line 478, in _eintr_retry_call
return func(*args)
ValueError: I/O operation on closed file
Answer: Because the "file", which is actually the stdout of the program being invoked,
has been closed. This means you have already read all the output in the
previous `communicate()`, so calling it again can never produce anything.
|
Square root of number python
Question: Here's my code:
import cmath
root = (cmath.sqrt(25))
print (root)
raw_input()
The problem i face is the result of root is 5+0j which is undesirable i only
want the square root. How can i fix this?
Answer: Use the `math` module instead of the `cmath` module; the latter is for complex
numbers only:
>>> import math
>>> print math.sqrt(25)
5.0
For what it's worth, the `cmath` result is correct, _if you expected a complex
number_. You could take just the `.real` component of the result, but since
there is a regular floating point equivalent in the `math` module there is no
point in having your computer do the extra work.
|
beautifulsoup "list object has no attribute" error
Question: I'm trying to scrape temperatures from a [weather
site](http://www.wunderground.com/history/airport/KAPA/2013/3/1/DailyHistory.html)
using the following:
import urllib2
from BeautifulSoup import BeautifulSoup
f = open('airport_temp.tsv', 'w')
f.write("Location" + "\t" + "High Temp (F)" + "\t" + "Low Temp (F)" + "\t" + "Mean Humidity" + "\n" )
eventually parse from http://www.wunderground.com/history/airport/\w{4}/2012/\d{2}/1/DailyHistory.html
for x in range(10):
locationstamp = "Location " + str(x)
print "Getting data for " + locationstamp
url = 'http://www.wunderground.com/history/airport/KAPA/2013/3/1/DailyHistory.html'
page = urllib2.urlopen(url)
soup = BeautifulSoup(page)
location = soup.findAll('h1').text
locsent = location.split()
loc = str(locsent[3,6])
hightemp = soup.findAll('nobr')[6].text
htemp = hightemp.split()
ht = str(htemp[1])
lowtemp = soup.findAll('nobr')[10].text
ltemp = lowtemp.split()
lt = str(ltemp[1])
avghum = soup.findAll('td')[23].text
f.write(loc + "\t|" + ht + "\t|" + lt + "\t|" + avghum + "\n" )
f.close()
Unfortunately, I get an error saying:
Getting data for Location 0
Traceback (most recent call last):
File "airportweather.py", line 18, in <module>
location = soup.findAll('H1').text
AttributeError: 'list' object has no attribute 'text'
I've looked through BS and Python documentation, but am still pretty green, so
I couldn't figure it out. Please help this newbie!
Answer: The `.findAll()` method returns a _list_ of matches. If you wanted _one_
result, use the `.find()` method instead. Alternatively, pick out a specific
element like the rest of the code does, or loop over the results:
location = soup.find('h1').text
or
locations = [el.text for el in soup.findAll('h1')]
or
location = soup.findAll('h1')[2].text
|
Python replace function [replace once]
Question: I need help with a program I'm making in Python.
Assume I wanted to replace every instance of the word `"steak"` to `"ghost"`
(just go with it...) but I also wanted to replace every instance of the word
`"ghost"` to `"steak"` at the same time. The following code does not work:
s="The scary ghost ordered an expensive steak"
print s
s=s.replace("steak","ghost")
s=s.replace("ghost","steak")
print s
it prints: `The scary steak ordered an expensive steak`
What I'm trying to get is `The scary steak ordered an expensive ghost`
Answer: I'd probably use a regex here:
>>> import re
>>> s = "The scary ghost ordered an expensive steak"
>>> sub_dict = {'ghost':'steak','steak':'ghost'}
>>> regex = '|'.join(sub_dict)
>>> re.sub(regex, lambda m: sub_dict[m.group()], s)
'The scary steak ordered an expensive ghost'
Or, as a function which you can copy/paste:
import re
def word_replace(replace_dict,s):
regex = '|'.join(replace_dict)
return re.sub(regex, lambda m: replace_dict[m.group()], s)
Basically, I create a mapping of words that I want to replace with other words
(`sub_dict`). I can create a regular expression from that mapping. In this
case, the regular expression is `"steak|ghost"` (or `"ghost|steak"` \-- order
doesn't matter) and the regex engine does the rest of the work of finding non-
overlapping sequences and replacing them accordingly.
* * *
_Some possibly useful modifications_
* `regex = '|'.join(map(re.escape,replace_dict))` \-- Allows the regular expressions to have special regular expression syntax in them (like parenthesis). This escapes the special characters to make the regular expressions match the literal text.
* `regex = '|'.join(r'\b{0}\b'.format(x) for x in replace_dict)` \-- make sure that we don't match if one of our words is a substring in another word. In other words, change `he` to `she` but not `the` to `tshe`.
|
How do I insert a row in my google fusion table using Python
Question: I am working on a project and part of it involves inserting rows in to a
Google Fusion Table for the Project from a python script. I have spent the
last couple days trying to figure out just how to do that and I am officially
confused.
My research seems to indicate that I need to use Oauth 2.0 to access the API.
In doing so I can successfully get an access token but I can't seem to
successfully get a refresh token. I'm not sure if this is going to hamper my
ability to successfully integrate access to my Fusion Table with my Python
code.
The second problem I am having is that I don't really understand how exactly
to code inserting a row in my table. Most of the material I have found on it
is from the deprecated Fusion Tables SQL API and I don't fully understand the
new way of doing it.
I'm a beginner at this sort of thing and any direction to help me is very much
appreciated!
Edit: So the code I have working so far looks like this:
client_id = "<client_i>"
client_secret = "<client_secret>"
table_id = "<table_id>"
access_token = ""
refresh_token = "<refresh_token>"
# the refresh token is used to request a new access token
data = urllib.urlencode({
'client_id': client_id,
'client_secret': client_secret,
'refresh_token': refresh_token,
'grant_type': 'refresh_token'})
request = urllib2.Request(
url='https://accounts.google.com/o/oauth2/token',
data=data)
request_open = urllib2.urlopen(request)
response = request_open.read()
request_open.close()
tokens = json.loads(response)
access_token = tokens['access_token']
# Read the table
request_read = urllib2.Request(
url='https://www.google.com/fusiontables/api/query?%s' % \
(urllib.urlencode({'access_token': access_token,
'sql': 'SELECT * FROM table_id'})))
request_open = urllib2.urlopen(request_read)
response = request_open.read()
request_open.close()
print response
And my code for trying to insert a new row into my table:
date = str(datetime.now().date())
time = str(datetime.now().time())
query = 'INSERT INTO table_id (Date,Time,Saskatoon,Regina,MeadowLake)VALUES(date,time,60.01,60.02,59.99)'
data = urllib2.Request(
url='https://www.google.com/fusiontables/api/query?%s' % \
(urllib.urlencode({'access_token': access_token,
'sql': query})))
request_open = urllib2.urlopen(data)
When I run this i get
> HTTP Error 400: HTTP GET can only be used for select queries.
I am know I'm supposed to be making a POST not a GET for the INSERT, I'm just
not sure what needs to change in my code for that to happen. Sorry for being a
noob.
2ND EDIT:
Sorry for making this longer but I feel it is pertinent to show where I've
gotten so far. I switched to the library requests and things have gotten
somewhat easier however I still haven't successfully made a POST. My new code
for importing rows is as follows:
def importRows(self):
print 'IMPORT ROWS'
date = str(datetime.now().date())
time = str(datetime.now().time())
data = {'Date': date,
'Time': time,
'Saskatoon': '60.01',
'Regina': '59.95'}
url = 'https://www.googleapis.com/upload/fusiontables/v1/tables/%s/import/%s' % \
(tableid, self.params) # self.params is access token
importRow = requests.post(url, params=data)
print importRow.status_code
print importRow.text
Which gives me
400
{
"error": {
"errors": [
{
"domain": "fusiontables",
"reason": "badImportInputEmpty",
"message": "Content is empty."
}
],
"code": 400,
"message": "Content is empty."
}
}
Answer: > If your application needs offline access to a Google API, then the request
> for an authorization code should include the access_type parameter, where
> the value of that parameter is offline.
<https://developers.google.com/accounts/docs/OAuth2WebServer#offline>
Then, to obtain an access token using the refresh token you send a POST
request including `grant_type` with value `refresh_token`.
Basically, the way SQL works is you send POST requests using a subset of SQL
statements
`https://www.googleapis.com/fusiontables/v1/query?sql=STATEMENT_HERE`
Refer to
<https://developers.google.com/fusiontables/docs/v1/reference/query>
<https://developers.google.com/fusiontables/docs/v1/sql-reference>
Edit:
Since you are using `urllib2` without a data parameter, it defaults to GET. To
fix this you should either use another HTTP library that allows for explicitly
specifying method (like [`requests`](http://docs.python-
requests.org/en/latest/) or `httplib`) or do something like this:
query = "INSERT INTO %s(EXAMPLE_COL1,EXAMPLE_COL2) VALUES"\
"('EXAMPLE_INFO1','EXAMPLE_INFO2')" % table_id # Single quotes
opener = urllib2.build_opener(urllib2.HTTPHandler)
request = urllib2.Request('https://www.google.com/fusiontables/api/query?%s' % \
(urllib.urlencode({'access_token': access_token,
'sql': query})),
headers={'Content-Length':0}) # Manually set length to avoid 411 error
request.get_method = lambda: 'POST' # Change HTTP request method
response = opener.open(request).read()
print response
Important to notice:
1. Monkey patch the method to do what we want (POST with an empty body) otherwise we would receive `HTTP Error 400: HTTP GET can only be used for SELECT queries`.
2. Manually specify that we do not have a body (`Content-Length` is `0`) otherwise we would receive `HTTP Error 411: Length Required`.
3. Must use **double quotes with single quotes inside** or **escape the inner quotes** to submit strings via the query. In other words, `"INSERT INTO %s(EXAMPLE_COL1,EXAMPLE_COL2) VALUES(EXAMPLE_INFO1,EXAMPLE_INFO2)" % table_id` does not work.
If we tried to use the previous line we would get something like `HTTP Error
400: Parse error near 'SOME_STRING' (line X, position Y)`
See for info on changing method with urllib2:
[Is there any way to do HTTP PUT in
python](http://stackoverflow.com/questions/111945/is-there-any-way-to-do-http-
put-in-python)
|
Reading stderr of subprocess while it is executing
Question: I'd like to read what is written to stderr by a subprocess while it is
executing.
However, when I use this script that I've written, stderr does not seem to
have anything for me to read until the subprocess has exited.
#!/usr/bin/env python2
import sys
from subprocess import Popen, PIPE, STDOUT
if len(sys.argv) < 2:
print "Please provide a command"
sys.exit(1)
sub = Popen(sys.argv[1:], stdout=PIPE, stderr=STDOUT)
for i, line in enumerate(sub.stdout):
sys.stdout.write("%d: %s" % (i, line))
**edit:**
Ok, I've gotten closer now. If I specify the number of bytes to read it
overcomes the buffering.
#!/usr/bin/env python2
import sys
from subprocess import Popen, PIPE, STDOUT
if len(sys.argv) < 2:
print "Please provide a command"
sys.exit(1)
sub = Popen(sys.argv[1:], stdout=PIPE, stderr=STDOUT)
i = 0
while sub.poll() is None:
line = sub.stdout.read(64)
line.strip("\b")
sys.stdout.write("%d: %s\n" % (i, line))
i += 1
Snippet of output:
58: 86 q=21.0 size= 4541841kB time=00:00:22.08 bitrate=1685014.2kbi
frame= 567 fps= 86 q=22.0 size= 4543667kB time=00:00:2
frame= 621 fps= 87 q=20.0 sizs/s
frame= 4545352kB time=00:00:26.11 bitrate=1425939.2kbits/s
62: = 686 fps= 90 q=12.0 size= 4546970kB time=00:00:28.89 bitrate=1
frame= 758 fps= 93 q=25.0 size= 4548534kB t
frame= 794 fps= 92 bitrate=1168185.5kbits/s
65: q=27.0 size= 4550901kB time=00:00:33.40 bitrate=1115897.0kbits/
frame= 827 fps= 91 q=27.0 size= 4552324kB time=00:00:34.7
frame= 857 fps= 89 q=26.0 size=
frame= 254kB time=00:00:36.12 bitrate=1032874.9kbits/s
69: 892 fps= 88 q=25.0 size= 4556598kB time=00:00:37.36 bitrate=9988
frame= 948 fps= 89 q=19.0 size= 4558565kB time=
frame= 1006 fps= 90 q=19937320.4kbits/s
72: .0 size= 4560139kB time=00:00:42.16 bitrate=885880.0kbits/s
73: frame= 1060 fps= 91 q=19.0 size= 4561958kB time=00:00:44.49 bitr
frame= 1122 fps= 93 q=18.0 size= 4563460
frame= 1173 fps=0:47.08 bitrate=793898.4kbits/s
It looks like my problem now is that ffmpeg is using backspace characters or
similar to mess with stdout. Not sure what's happening here.
Answer: I suggest to use [sh](https://pypi.python.org/pypi/sh) module. It is very nice
piece of software which wraps subprocesses in python and gives you pythonic,
beautiful interface which you will love. Look at the
[docs](http://amoffat.github.com/sh/).
If you really do not want `sh` module, use
[communicate](http://docs.python.org/2/library/subprocess.html#subprocess.Popen.communicate)
method of `Popen`
|
How can I install packages on my heroku app?
Question: I have an app that makes use of shortuuid
(<https://pypi.python.org/pypi/shortuuid/0.1>) that is working fine locally
when I run it with runapp.py:
import os
from paste.deploy import loadapp
from waitress import serve
if __name__ == "__main__":
port = int(os.environ.get("PORT", 5000))
app = loadapp('config:production.ini', relative_to='.')
serve(app, host='0.0.0.0', port=port)
It does not work, however, when I try and run it with ../bin/pserve
development.ini. I get the error: import error: no module named shortuuid.
When I push it to heroku I get the same error. I have installed shortuuid into
my virtual environment where my app is run and can only conclude that the
absence of this installation on heroku is whats causing the problem.
I have tried replacing the development.ini code with the production.ini code
and it still does not work so I assume its something else (maybe the import os
line on runapp.py?)
Answer: I usually create a `requirements.txt` file that contains the packages:
Flask==0.9
Jinja2==2.6
Werkzeug==0.8.3
distribute==0.6.27
wsgiref==0.1.2
Flask-Cache==0.10.0
gunicorn==0.17.2
You can create that file with `pip`:
$ pip freeze > requirements.txt
|
Argument types differ in normal and reflected operator overload (__sub__ / __rsub__)
Question: How do I get access to the properties of an numpy array after passing it
through an righthand operator like `__rsub__`?
I wrote a very simple class in python that defines the two functions:
class test(object):
def __sub__(self, other):
return other
def __rsub__(self, other):
return other
Basically they should do the same. The left-hand operator `__sub__` works as
expected, but it seems that the numpy array is stripped off its properties on
the right-hand operator
from skimage import data
from skimage.color import rgb2gray
lena = data.lena()
grayLena = rgb2gray(lena)
t = test()
## overloaded - operator
left_hand = t - grayLena
print left_hand
# Output:
#array([[ 0.60802863, 0.60802863, 0.60779059, ..., 0.64137412,
# 0.57998235, 0.46985725],
# [ 0.60802863, 0.60802863, 0.60779059, ..., 0.64137412,
# 0.57998235, 0.46985725],
# [ 0.60802863, 0.60802863, 0.60779059, ..., 0.64137412,
# 0.57998235, 0.46985725],
# ...,
# [ 0.13746353, 0.13746353, 0.16881412, ..., 0.37271804,
# 0.35559529, 0.34377725],
# [ 0.14617059, 0.14617059, 0.18730588, ..., 0.36788784,
# 0.37292549, 0.38467529],
# [ 0.14617059, 0.14617059, 0.18730588, ..., 0.36788784,
# 0.37292549, 0.38467529]])
right_hand = grayLena - t
print right_hand
# Output:
# array([[0.6080286274509803, 0.6080286274509803, 0.6077905882352941, ...,
# 0.6413741176470589, 0.5799823529411765, 0.4698572549019608],
# [0.6080286274509803, 0.6080286274509803, 0.6077905882352941, ...,
# 0.6413741176470589, 0.5799823529411765, 0.4698572549019608],
# [0.6080286274509803, 0.6080286274509803, 0.6077905882352941, ...,
# 0.6413741176470589, 0.5799823529411765, 0.4698572549019608],
# ...,
# [0.1374635294117647, 0.1374635294117647, 0.1688141176470588, ...,
# 0.3727180392156863, 0.35559529411764706, 0.34377725490196076],
# [0.1461705882352941, 0.1461705882352941, 0.18730588235294118, ...,
# 0.3678878431372549, 0.37292549019607846, 0.3846752941176471],
# [0.1461705882352941, 0.1461705882352941, 0.18730588235294118, ...,
# 0.3678878431372549, 0.37292549019607846, 0.3846752941176471]], dtype=object)
So the difference between both operations is that `__rsub__` receives an array
of dtype=object. If I would just set the dtype of this array, everything would
work fine.
However, it works only with the return value, outside of `__rsub__`. Inside my
`__rsub__` I get only rubbish, that I cannot convert back, namely if I do
npArray = np.array(other, dtype=type(other))
I get a 1D array of the type (floats in my case). But for some reason, the
shape information is lost. Has anyone done this or an idea how I can access
the original properties of the array (shape and type)?
Answer: I am not sure of what the exact control flow inside the `ndarray`'s machinery
is, but what's happening in your case is more or less clear:
What `ndarray` is delegating to your object's `__rsub__` method is not the
overall substraction operation, but the substraction of your object from each
of the items in the array. And apparently when it has to delegate an operation
to the object's methods, the return type is set to `object` regardless of what
gets returned. You can check it with this slight modification of your code:
class test(object):
def __sub__(self, other):
return other
def __rsub__(self, other):
return other if other != 1 else 666
In [11]: t = test()
In [12]: t - np.arange(4)
Out[12]: array([0, 1, 2, 3])
In [13]: np.arange(4) - t
Out[13]: array([0, 666, 2, 3], dtype=object)
I don't think there is an easy way of overriding this behaviour. You could try
[making `test` a subclass of
`ndarray`](http://docs.scipy.org/doc/numpy/user/basics.subclassing.html#array-
wrap-for-ufuncs) with a high `__array_priority__` and abuse a little the
`__array_wrap__` method:
class test(np.ndarray):
__array_priority__ = 100
def __new__(cls):
obj = np.int32([1]).view(cls)
return obj
def __array_wrap__(self, arr, context) :
if context is not None :
ufunc = context[0]
args = context[1]
if ufunc == np.subtract :
if self is args[0] :
return args[1]
elif self is args[1] :
return args[0]
return arr
And now:
>>> t = test()
>>> np.arange(4) - t
array([0, 1, 2, 3])
>>> t - np.arange(4)
array([0, 1, 2, 3])
But:
>>> np.arange(4) + t
test([1, 2, 3, 4])
>>> t + np.arange(4)
test([1, 2, 3, 4])
It is a little bit wasteful, because we are doing the operation of adding the
`1` inside `t` to every value in the array, and then silently discarding it,
but I can't think of any way of overriding that.
|
syntax error on production server where running bin/python setup.py test-q
Question: When I attempt to do the following on a production server:
$ sudo -u vretnet ../bin/python setup.py test -q
It will show the following error, how should I fix this? Or could it be that
my development.ini went wrong?
Traceback (most recent call last):
File "setup.py", line 34, in <module>
paster_plugins=['pyramid'],
File "/opt/python3.2.3/lib/python3.2/distutils/core.py", line 148, in setup
dist.run_commands()
File "/opt/python3.2.3/lib/python3.2/distutils/dist.py", line 917, in run_commands
self.run_command(cmd)
File "/opt/python3.2.3/lib/python3.2/distutils/dist.py", line 936, in run_command
cmd_obj.run()
File "/home/vretnet/env/lib/python3.2/site-packages/distribute-0.6.34-py3.2.egg/setuptools/command/test.py", line 138, in run self.with_project_on_sys_path(self.run_tests)
File "/home/vretnet/env/lib/python3.2/site-packages/distribute-0.6.34-py3.2.egg/setuptools/command/test.py", line 118, in with_project_on_sys_path
func()
File "/home/vretnet/env/lib/python3.2/site-packages/distribute-0.6.34-py3.2.egg/setuptools/command/test.py", line 164, in run_tests
testLoader = cks
File "/opt/python3.2.3/lib/python3.2/unittest/main.py", line 123, in __init__
self.parseArgs(argv)
File "/opt/python3.2.3/lib/python3.2/unittest/main.py", line 191, in parseArgs
self.createTests()
File "/opt/python3.2.3/lib/python3.2/unittest/main.py", line 198, in createTests
self.module)
File "/opt/python3.2.3/lib/python3.2/unittest/loader.py", line 132, in loadTestsFromNames
suites = [self.loadTestsFromName(name, module) for name in names]
File "/opt/python3.2.3/lib/python3.2/unittest/loader.py", line 132, in <listcomp>
suites = [self.loadTestsFromName(name, module) for name in names]
File "/opt/python3.2.3/lib/python3.2/unittest/loader.py", line 91, in loadTestsFromName
module = __import__('.'.join(parts_copy))
File "/home/vretnet/env/ECommerce/ecommerce/__init__.py", line 1, in <module>
from pyramid.config import Configurator
File "/home/vretnet/env/lib/python3.2/site-packages/pyramid-1.4-py3.2.egg/pyramid/config/__init__.py", line 10, in <module>
from webob.exc import WSGIHTTPException as WebobWSGIHTTPException
File "/home/vretnet/env/lib/python3.2/site-packages/WebOb-1.2.3-py3.2.egg/webob/exc.py", line 1115, in <module>
from paste import httpexceptions
File "/home/vretnet/env/lib/python3.2/site-packages/Paste-1.7.5.1-py3.2.egg/paste/httpexceptions.py", line 634
except HTTPException, exc:
^
SyntaxError: invalid syntax
Answer: It is Python 3, you should write `as`:
except HTTPException as exc:
|
How to perform an assignment inside a lambda function
Question: Python 2.7.1
I would like to understand why I can't do the following which seems like a
sensible thing to do
def do_stuff():
# return a function which takes a map as an argument and puts a key in there
f = lambda map: map['x'] = 'y' #compilation error
return f
x = do_stuff()
map = {}
x(map)
print map['x']
I can have that lambda function to be somethign simpler something like `f =
lambda map: os.path.exists` however I cannot get it to change the map. Can
someone tell me how I can achieve this? If this is not possible at all why?
Answer: You can't use assignment in an expression, it is a statement. A `lambda` can
only contain _one_ expression, and statements are not included.
You _can_ assign to the map though, by using the [`operator.setitem()`
function](http://docs.python.org/2/library/operator.html#operator.setitem)
instead:
import operator
lambda map: operator.setitem(map, 'x', 'y')
|
scipy.misc module has no attribute imread?
Question: I am trying to read an image with scipy. However it does not accept the
`scipy.misc.imread` part. What could be the cause of this?
>>> import scipy
>>> scipy.misc
<module 'scipy.misc' from 'C:\Python27\lib\site-packages\scipy\misc\__init__.pyc'>
>>> scipy.misc.imread('test.tif')
Traceback (most recent call last):
File "<pyshell#11>", line 1, in <module>
scipy.misc.imread('test.tif')
AttributeError: 'module' object has no attribute 'imread'
Answer: You need to install [PIL](http://www.pythonware.com/products/pil/). From [the
docs](http://docs.scipy.org/doc/scipy/reference/misc.html) on `scipy.misc`:
> Note that the Python Imaging Library (PIL) is not a dependency of SciPy and
> therefore the pilutil module is not available on systems that don’t have PIL
> installed.
After installing PIL, I was able to access `imread` as follows:
In [1]: import scipy.misc
In [2]: scipy.misc.imread
Out[2]: <function scipy.misc.pilutil.imread>
|
Python PIL library not working image.thumbnail(size, Image.ANTIALIAS)
Question: I'm trying to debug this script in python from PIL import Image, ImageChops,
ImageOps
I've searched all over the problem seems to be "image.thumbnail(size,
Image.ANTIALIAS)" here. Anyone have any ideas? Thanks
image = Image.open(f_in)
print "got here"
image.thumbnail(size, Image.ANTIALIAS)
print "cannot get here"
image_size = image.size
if pad:
thumb = image.crop( (0, 0, size[0], size[1]) )
offset_x = max( (size[0] - image_size[0]) / 2, 0 )
offset_y = max( (size[1] - image_size[1]) / 2, 0 )
thumb = ImageChops.offset(thumb, offset_x, offset_y)
else:
thumb = ImageOps.fit(image, size, Image.ANTIALIAS, (0.5, 0.5))
thumb.save(f_out)
**EDIT** Thanks for the quick answer Mark. I figured it out.
I had to:
pip uninstall PIL
sudo apt-get install libjpeg8-dev
pip install PIL
I didn't have libjpeg installed. Not sure why I didn't get an error.
Answer: If the program never gets to the line "cannot get here" then the problem is
that `thumbnail` is throwing an exception. You didn't mention that in the
question though, it should have generated an error.
PIL uses lazy image loading - in the `open` call it might open the file, but
it doesn't actually try to read the whole thing in. If your file is corrupt or
in the wrong format it will fail once you try to do something with the image,
as `thumbnail` is doing.
|
how to check which compiler was used to build Python
Question: Is there a way to tell which compiler was used to build a `Python` install on
a specific linux machine?
I tried using `ldd` on the `Python` dynamic libraries [1], but I didn't manage
to understand if it was compiled with `gcc` or Intel compiler.
[1]
$ ldd libpython2.7.so.1.0
linux-vdso.so.1 => (0x00007fff4a5ff000)
libpthread.so.0 => /lib64/libpthread.so.0 (0x00002ab8de8ae000)
libdl.so.2 => /lib64/libdl.so.2 (0x00002ab8deac9000)
libutil.so.1 => /lib64/libutil.so.1 (0x00002ab8deccd000)
libm.so.6 => /lib64/libm.so.6 (0x00002ab8deed1000)
libc.so.6 => /lib64/libc.so.6 (0x00002ab8df154000)
/lib64/ld-linux-x86-64.so.2 (0x0000003b9a400000)
Answer: I think you have it in `sys.version`:
>>> import sys
>>> print(sys.version)
3.2.3 (default, Oct 19 2012, 19:53:16)
[GCC 4.7.2]
It should also usually tell you when you start the interactive interpreter:
wim@wim-zenbook:~$ python3
Python 3.2.3 (default, Oct 19 2012, 19:53:16)
[GCC 4.7.2] on linux2
Type "help", "copyright", "credits" or "license" for more information.
>>>
|
HTML Email Rendered Incorrectly When Carriage Returns Are Not Used
Question: The following python script generates an email file that can be piped to
sendmail. When I send this to my gmail account, lines 25, 50, and 51 are not
what I would have expected. All other lines appear as expected.
import sys
print "From:[email protected]"
print "To:[email protected]"
print "Subject: test no carriage return"
print "MIME-Version: 1.0"
print "Content-Disposition: inline;"
print "Content-Type: text/html"
sys.stdout.write ("<html>" )
count = 1
while ( count < 55):
# output without a carriage return
sys.stdout.write( "<tr><td>test" + str(count) + " no carriage returns!</td>")
count = count + 1
sys.stdout.write ("</html>")
In the email I would expect this for lines 25,50,51:
test25 no carriage returns!
test50 no carriage returns!
test51 no carriage returns!
instead, this is rendered:
test25 no carriage retur! ns!
test50 no ca! rriage returns!
test51 no carriage returns! test52 no carriage returns!
If I change the output to use `print` instead of `stdout`, then the email
displays as expected. I have also tried this in an MS Outlook with the same
effect. What is the reasoning for the unexpected result when carriage returns
are not used?
Answer: Not sure if it is a typo, but for one thing you are not closing your row. You
are missing a:
</tr>
As well as opening and closing table tags.
|
How to use a python context manager inside a generator
Question: In python, should with-statements be used inside a generator? To be clear, I
am not asking about using a decorator to create a context manager from a
generator function. I am asking whether there is an inherent issue using a
with-statement as a context manager inside a generator as it will catch
`StopIteration` and `GeneratorExit` exceptions in at least some cases. Two
examples follow.
A good example of the issue is raised by Beazley's example (page 106). I have
modified it to use a with statement so that the files are explicitly closed
after the yield in the opener method. I have also added two ways that an
exception can be thrown while iterating the results.
import os
import fnmatch
def find_files(topdir, pattern):
for path, dirname, filelist in os.walk(topdir):
for name in filelist:
if fnmatch.fnmatch(name, pattern):
yield os.path.join(path,name)
def opener(filenames):
f = None
for name in filenames:
print "F before open: '%s'" % f
#f = open(name,'r')
with open(name,'r') as f:
print "Fname: %s, F#: %d" % (name, f.fileno())
yield f
print "F after yield: '%s'" % f
def cat(filelist):
for i,f in enumerate(filelist):
if i ==20:
# Cause and exception
f.write('foobar')
for line in f:
yield line
def grep(pattern,lines):
for line in lines:
if pattern in line:
yield line
pylogs = find_files("/var/log","*.log*")
files = opener(pylogs)
lines = cat(files)
pylines = grep("python", lines)
i = 0
for line in pylines:
i +=1
if i == 10:
raise RuntimeError("You're hosed!")
print 'Counted %d lines\n' % i
In this example, the context manager successfully closes the files in the
opener function. When an exception is raised, I see the trace back from the
exception, but the generator stops silently. If the with-statement catches the
exception why doesn't the generator continue?
When I define my own context managers for use inside a generator. I get
runtime errors saying that I have ignored a `GeneratorExit`. For example:
class CManager(object):
def __enter__(self):
print " __enter__"
return self
def __exit__(self, exctype, value, tb):
print " __exit__; excptype: '%s'; value: '%s'" % (exctype, value)
return True
def foo(n):
for i in xrange(n):
with CManager() as cman:
cman.val = i
yield cman
# Case1
for item in foo(10):
print 'Pass - val: %d' % item.val
# Case2
for item in foo(10):
print 'Fail - val: %d' % item.val
item.not_an_attribute
This little demo works fine in case1 with no exceptions raised, but fails in
case2 where an attribute error is raised. Here I see a `RuntimeException`
raised because the with statement has caught and ignored a `GeneratorExit`
exception.
Can someone help clarify the rules for this tricky use case? I suspect it is
something I am doing, or not doing in my `__exit__` method. I tried adding
code to re-raise `GeneratorExit`, but that did not help.
Answer: from the [Data model entry for
`object.__exit__`](http://docs.python.org/2/reference/datamodel.html#object.__exit__)
> If an exception is supplied, and the method wishes to suppress the exception
> (i.e., prevent it from being propagated), it should return a true value.
> Otherwise, the exception will be processed normally upon exit from this
> method.
In your `__exit__` function, you're returning `True` which will suppress _all_
exceptions. If you change it to return `False`, the exceptions will continue
to be raised as normal (with the only difference being that you guarantee that
your `__exit__` function gets called and you can make sure to clean up after
yourself)
For example, changing the code to:
def __exit__(self, exctype, value, tb):
print " __exit__; excptype: '%s'; value: '%s'" % (exctype, value)
if exctype is GeneratorExit:
return False
return True
allows you to do the right thing and not suppress the `GeneratorExit`. Now you
_only_ see the attribute error. Maybe the rule of thumb should be the same as
with any Exception handling -- **only intercept Exceptions if you know how to
handle them**. Having an `__exit__` return `True` is on par (maybe slightly
worse!) than having a bare except:
try:
something()
except: #Uh-Oh
pass
* * *
Note that when the `AttributeError` is raised (and not caught), I believe that
causes the reference count on your generator object to drop to 0 which then
triggers a `GeneratorExit` exception within the generator so that it can clean
itself up. Using my `__exit__`, play around with the following two cases and
hopefully you'll see what I mean:
try:
for item in foo(10):
print 'Fail - val: %d' % item.val
item.not_an_attribute
except AttributeError:
pass
print "Here" #No reference to the generator left.
#Should see __exit__ before "Here"
and
g = foo(10)
try:
for item in g:
print 'Fail - val: %d' % item.val
item.not_an_attribute
except AttributeError:
pass
print "Here"
b = g #keep a reference to prevent the reference counter from cleaning this up.
#Now we see __exit__ *after* "Here"
|
python webdriver os window
Question: I need to upload a file using Python and Selenium. When I click the upload
HTML element a "File Upload" window is opened and the click() method does not
return since it waits to fully load the page. Therefore I cannot continue
using pywinauto code to control the window.
The first method clicks the HTML element (an img) to upload a new file:
def add_file(self):
return self.selenium.find_element(By.ID, "add_file").click()
and the second method is using pywinauto to type the path to the file and then
click open
def upload(self):
from pywinauto import application
app = application.Application()
app.connect_(title_re = "File Upload")
app.file_upload.TypeKeys("C:\\Path\\To\\FIle")
app.file_upload.Open.Click()
How can I force add_file method to return and to be able to run the upload
method?
Answer: Solve it. There was an iframe dealing with the upload but was hidden and
didn't see it in the first place. The iframe contains an input of type file
also hidden. To solve it make the iframe visible using javascript:
selenium.execute_script("document.getElementById('iframe_id').style.display = 'block';")
then switch to the iframe and make the input visible also:
selenium.switch_to_frame(0)
selenium.execute_script("document.getElementById('input_field_id').type = 'visible';")
and simply send the path to the input:
selenium.find_element(By.ID, 'input_field_id').send_keys("path\\\\to\\\\file")
For windows use 4 '\\\\\\\' as path separator.
|
Python iterator that iterates a function
Question: So I must make the following function -> iterate. On first call it should
return identity, on second func, on third func.func. Any idea how to do it? I
tried looking at the **iter** and **next** method buf failed: (
>>> def double(x):
return 2 * x
>>> i = iterate(double)
>>> f = next(i)
>>> f(3)
3
>>> f = next(i)
>>> f(3)
6
>>> f = next(i)
>>> f(3)
12
>>> f = next(i)
>>> f(3)
24
Answer: Something like this perhaps:
>>> import functools
>>> def iterate(fn):
def repeater(arg, _count=1):
for i in range(_count):
arg = fn(arg)
return arg
count = 0
while True:
yield functools.partial(repeater, _count=count)
count += 1
>>> i = iterate(double)
>>> f, f2, f3, f4 = next(i), next(i), next(i), next(i)
>>> f(3), f2(3), f3(3), f4(3)
(3, 6, 12, 24)
>>> f(3), f2(3), f3(3), f4(3)
(3, 6, 12, 24)
So you write a function that calls the original function the number of times
specified as a parameter and you pre-bind the count parameter.
|
Read Excel Files and Only Use Specific Files
Question: in my past questions, I've stated that I'm new to python. I've only used it
once for work. And yet again, there's a small project I have to do for work.
I have to read an excel file, and in that excel file, there are 3 columns
(col1, col2, col3). There are about 100 rows.
col1 has 2 values A and B. col2 has values ranging from ONLY 1 - 10. col3,
there are plenty of different values.
But I want my python program to look at each distinct value in col1, and then
at each distinct value in col2, and then calculate the avg of all the
corresponding values of col3.
Hopefully, the output can look something like this:
A - 1 = 2.3
A - 2 = 6.2
A - 3 = 5.7
etc. etc.
B - 1 = 3.5
B - 2 = 4.1
B - 3 = 8.1
etc. etc.
I know, it's a lot to ask, but I've done this so far:
import xlrd #import package
#opening workbook and reading first sheet
book = xlrd.open_workbook('trend.xls')
sheet = book.sheet_by_index(0)
#print sheet name, number of rows and columns
#print sheet.name #print sheet name
#print sheet.nrows #print number of rows
#print sheet.ncols #print number of colums
#print cellname along with value in for loop
for row_index in range(sheet.nrows):
for col_index in range(sheet.ncols):
print xlrd.cellname(row_index,col_index),'-',
print sheet.cell(row_index,col_index).value
It started printing all the values within each cell, along with the name and
such. But then I realized it's not doing what it's supposed to really be
doing. And I can't find a proper tutorial on how to do this.
If any of you have any suggestions, I'll appreciate it very much. Thank you so
much!
Answer: Try this:
import xlrd
book = xlrd.open_workbook('trend.xls')
sheet = book.sheet_by_index(0)
unique_combinations = {}
for row_index in range(sheet.nrows):
cell_1 = sheet.cell(row_index, 0)
cell_2 = sheet.cell(row_index, 1)
cell_3 = sheet.cell(row_index, 2)
unique_combo = (cell_1.value, int(cell_2.value))
if unique_combinations.has_key(unique_combo):
unique_combinations[unique_combo].append(cell_3.value)
else:
unique_combinations[unique_combo] = [cell_3.value]
for k in unique_combinations.keys():
values = unique_combinations[k]
average = sum(values ) / len(values )
print '%s - %s = %s' % (k[0], k[1], average)
|
WindowsError: [Error 193] %1 is not a valid Win32 application in Python
Question: I wish to import [liblas](http://www.liblas.org/tutorial/python.html) module
in Python 2.7 on window 64bit. If I import the module with IDLE (Python GUI) I
have no problem.
If I use
[PyScripter](https://code.google.com/p/pyscripter/downloads/detail?name=PyScripter-v2.5.3-x64-Setup.exe&can=2&q=)
"PyScripter-v2.5.3-x64-Setup.exe" I get this error message.
>>> import liblas
Traceback (most recent call last):
File "<interactive input>", line 1, in <module>
File "C:\Python27\lib\site-packages\liblas\__init__.py", line 2, in <module>
from core import get_version
File "C:\Python27\lib\site-packages\liblas\core.py", line 138, in <module>
las = ctypes.CDLL(os.path.join(local_dlls, lib_name))
File "C:\Python27\Lib\ctypes\__init__.py", line 365, in __init__
self._handle = _dlopen(self._name, mode)
WindowsError: [Error 193] %1 is not a valid Win32 application
I have used liblas in PyScripter many times without problem and right now I
can load all standard modules (e.g.: numpy, GDAL, etc.), but tonight (I need
to finish an analysis!!!) I have this inconvenience.
Answer: Please make sure to have Python 2.7 64b edition :) or even though you are
working on 64b OS, use the x86 (AKA 32b) edition of PyScripter
**Edit 1 (following comments exchange w/ Gianni)**
One should verify his/her _entire_ Python process "composed" from same
entities in the sense of 32b/64b builds (e.g. if your Python interpreter is
32b one, then it must use C types coming from C dll Python extensions which
were compiled as 32b dlls).
In our example (liblas) one should go to `C:\Python27\lib\site-
packages\liblas` , find the extension dll and see its type via
[dumpbin](http://www.mohid.com/wiki/index.php?title=Dumpbin) , here is some
picture for demonstration :
|
How to selectively import module in python?
Question: I have several different modules, and I need to import one of them depending
on different situations, for example:
if check_situation() == 1:
import helper_1 as helper
elif check_situation() == 2:
import helper_2 as helper
elif ...
...
else:
import helper_0 as helper
these helpers contain same dictionaries `dict01`, `dict02`, `dict03`...but
have different values to be called in different situations.
But this has some problems:
1. import sentences are all written in the top of a file, but `check_situation()` function here needs prerequisites so that it's now far from top.
2. more than 1 file needs this helper module, so it's hard and ugly to use this kind of import.
So, how to re-arrange these helpers?
Answer: You can use `__import__()`, it accepts a string and returns that module:
helper=__import__("helper_{0}".format(check_situation()))
example :
In [10]: mod=__import__("{0}math".format(raw_input("enter 'c' or '': ")))
enter 'c' or '': c #imports cmath
In [11]: mod.__file__
Out[11]: '/usr/local/lib/python2.7/lib-dynload/cmath.so'
In [12]: mod=__import__("{0}math".format(raw_input("enter 'c' or '': ")))
enter 'c' or '':
In [13]: mod.__file__
Out[13]: '/usr/local/lib/python2.7/lib-dynload/math.so'
As pointed out by @wim and from python3.x docs on `__import__()`:
> Import a module. Because this function is meant for use by the Python
> interpreter and not for general use it is better to use
> `importlib.import_module()` to programmatically import a module.
|
How can I further profile and optimize this string tokenization function?
Question: Feel free to skip my long-winded explanation if looking at the source code is
easier!
So I've written a function to tokenize strings of text. In the simplest case,
it takes a string like `It's a beautiful morning` and returns a list of
tokens. For the preceding example, the output would be `['It', "'", 's', ' ',
'a', ' ', 'beautiful', ' ', 'morning']`.
This is achieved with the first two lines of the function:
separators = dict.fromkeys(whitespace + punctuation, True)
tokens = [''.join(g) for _, g in groupby(phrase, separators.get)]
The thing to notice here is that `It's` get's split into `["It", "'", "s"]`.
In most cases, this is not a problem, but sometimes it is. For this reason, I
added the `stop_words` kwarg, which takes a set of strings that are to be "un-
tokenized". For example:
>>> tokenize("It's a beautiful morning", stop_words=set("It's"))
>>> ["It's", , ' ', 'a', ' ', 'beautiful', ' ', 'morning']
This "un-tokenization" works by means of a sliding-window that moves across
the list of tokens. Consider the schema below. The window is depicted as `[]`
Iteration 1: ['It', "'",] 's', ' ', 'a', ' ', 'beautiful', ' ', 'morning'
Iteration 2: 'It', ["'", 's',] ' ', 'a', ' ', 'beautiful', ' ', 'morning'
Iteration 3: 'It', "'", ['s', ' ',] 'a', ' ', 'beautiful', ' ', 'morning'
At each iteration, the strings contained in the window are joined and checked
against the contents of `stop_words`. If the window reaches the end of the
token list and no match is found, then the window's size increases by 1. Thus:
Iteration 9: ['It', "'", 's',] ' ', 'a', ' ', 'beautiful', ' ', 'morning'
Here we have a match, so the entire window is replaced with a single element:
its contents, joined. Thus, at the end of iteration 9, we obtain:
"It's", ' ', 'a', ' ', 'beautiful', ' ', 'morning'
_Now_ , we have to start all over again in case this new token, when combined
it's neighbors, forms a stop word. The algorithm sets the window size back to
2 and continues on. **The entire process stops at the end of the iteration in
which the window-size is equal to the length of the token list.**
This recursion is the source of my algorithm's inefficiency. For small strings
with few untokenizations, it works very quickly. However, the computational
time seems to grow exponentially with the number of untokenizations and the
overall length of the original string.
Here is the full source code for the function:
from itertools import groupby, tee, izip
from string import punctuation, whitespace
def tokenize(phrase, stop_words=None):
separators = dict.fromkeys(whitespace + punctuation, True)
tokens = [''.join(g) for _, g in groupby(phrase, separators.get)]
if stop_words:
assert isinstance(stop_words, set), 'stop_words must be a set'
window = 2 # Iterating over single tokens is useless
while window <= len(tokens):
# "sliding window" over token list
iters = tee(tokens, window)
for i, offset in izip(iters, xrange(window)):
for _ in xrange(offset):
next(i, None)
# Join each window and check if it's in `stop_words`
for offset, tkgrp in enumerate(izip(*iters)):
tk = ''.join(tkgrp)
if tk in stop_words:
pre = tokens[0: offset]
post = tokens[offset + window + 1::]
tokens = pre + [tk] + post
window = 1 # will be incremented after breaking from loop
break
window += 1
return tokens
And here are some hard numbers to work with (the best I could do, in any
case).
>>> import cProfile
>>> strn = "it's a beautiful morning."
>>> ignore = set(["they're", "we'll", "she'll", "it's", "we're", "i'm"])
>>> cProfile.run('tokenize(strn * 100, ignore=ignore)')
cProfile.run('tokenize(strn * 100, ignore=ignore)')
57534203 function calls in 15.737 seconds
Ordered by: standard name
ncalls tottime percall cumtime percall filename:lineno(function)
1 10.405 10.405 15.737 15.737 <ipython-input-140-6ef74347708e>:1(tokenize)
1 0.000 0.000 15.737 15.737 <string>:1(<module>)
1 0.000 0.000 0.000 0.000 {built-in method fromkeys}
899 0.037 0.000 0.037 0.000 {itertools.tee}
900 0.000 0.000 0.000 0.000 {len}
1 0.000 0.000 0.000 0.000 {method 'disable' of '_lsprof.Profiler' objects}
365450 1.459 0.000 1.459 0.000 {method 'join' of 'str' objects}
57166950 3.836 0.000 3.836 0.000 {next}
From this I gathered that the majority of execution time was taking place in
my function's scope. As stated above, I _suspect_ that the incessant resetting
of `window` is responsible for the inefficiency, but I'm not sure how to
diagnose this any further.
**My questions are as follows:**
1. How can I further profile this function to ascertain whether it is, indeed, the resetting of `window` that is responsible for the long execution time?
2. What can I do to improve performance?
Thanks very much in advance!
Answer: I might have misunderstood the problem, but it seems like just searching for
the ignored words before spliting will solve the issue:
def tokenize(phrase, stop_words=()):
stop_words = '|'.join(re.escape(x) + r'\b' for x in stop_words)
other = '\s+|\w+|[^\s\w]+'
regex = stop_words + '|' + other if stop_words else other
return re.findall(regex, phrase)
As pointed by Michael Anderson, you should add `\b` to avoid matching parts of
words
Edit: the new regex will separate whitespace from punctuation.
|
Match href value with a regular expression
Question: My input is similar to this:
<a href="link">text</a> <a href="correctLink">See full summary</a>
From this string i want to get only `correctLink` (the link that has _See full
summary_ as text) .
I'm working with python, and i tried:
re.compile( '<a href="(.*?)">See full summary</a>', re.DOTALL | re.IGNORECASE )
but the only string i get with `findall()` is `link">text</a> <a
href="correctLink`.
Where is my mistake?
Answer: Limit your link pattern to non-quote characters:
re.compile('<a href="([^"]+?)">See full summary</a>', re.DOTALL | re.IGNORECASE)
giving:
>>> import re
>>> patt = re.compile('<a href="([^"]+?)">See full summary</a>', re.DOTALL | re.IGNORECASE)
>>> patt.findall('<a href="link">text</a> <a href="correctLink">See full summary</a>')
['correctLink']
Better yet, use a proper HTML parser.
Using [BeautifulSoup](http://www.crummy.com/software/BeautifulSoup/), finding
that link would be as easy as:
soup.find('a', text='See full summary')['href']
for an exact text match:
>>> from bs4 import BeautifulSoup
>>> soup=BeautifulSoup('<a href="link">text</a> <a href="correctLink">See full summary</a>')
>>> soup.find('a', text='See full summary')['href']
u'correctLink'
|
Using distutils to make a package sutiable for zipimport
Question: I'm embedding python in an application that I'm creating and I'm looking for a
convenient way to distribute the python code with it. I recently read about
`zipimport` and figured that would be a convenient way to distribute all my
python code rather than including the fully expanded tree. So, I set up my
package similarly to this:
.
├── setup.py
└── testpack
├── __init__.py
└── pack1
├── foo.py
└── __init__.py
where `setup.py` looks like:
from distutils.core import setup
setup(
name='testpack',
author='FatalError',
version='1.0',
packages=['testpack.pack1']
)
and then I ran `python setup.py bdist --format=zip`. But then when I look at
the content of the zip:
$ unzip -l testpack-1.0.linux-x86_64.zip
Archive: testpack-1.0.linux-x86_64.zip
Length Date Time Name
--------- ---------- ----- ----
183 2013-03-13 10:47 usr/local/lib/python2.7/dist-packages/testpack-1.0.egg-info
152 2013-03-13 10:47 usr/local/lib/python2.7/dist-packages/testpack/pack1/__init__.pyc
181 2013-03-13 10:47 usr/local/lib/python2.7/dist-packages/testpack/pack1/foo.pyc
0 2013-03-13 10:41 usr/local/lib/python2.7/dist-packages/testpack/pack1/__init__.py
33 2013-03-13 10:41 usr/local/lib/python2.7/dist-packages/testpack/pack1/foo.py
--------- -------
549 5 files
Clearly the result is (not so surprisingly) not suitable for use with
`zipimport`. Rather, this is a zip archive meant to be unzipped at `/` to
install the package.
Is there any way to get `distutils` (or `setuptools`, etc) to instead build
the package so that it will work with `zipimport`? Since the code I have is
really application specific, it doesn't belong installed into the system
library.
I realize that I can script it myself, but well, then what fun is that? For
example, I want to make sure everything is pre-compiled and my package
includes a unit test package that isn't meant to be distributed. So, I was
hoping one of these tools could do it for me.
Answer: `egg` archives are zipimport-capable (unless flagged to the contrary, in which
case they'll be unpacked during installation).
Use `python setup.py bdist --formats=egg`.
|
BDD in Scala - Does it have to be ugly?
Question: I've used [lettuce](http://lettuce.it) for python in the past. It is a simple
BDD framework where specs are written in an external plain text file.
Implementation uses regex to identify each step, proving reusable code for
each sentence in the specification.
Using scala, either with [specs2](http://etorreborre.github.com/specs2/) or
[scalatest](http://www.scalatest.org/) I'm being forced to write the the
specification alongside the implementation, making it impossible to reuse the
implementation in another test (sure, we could implement it in a function
somewhere) and making it impossible to separate the test implementation from
the specification itself (something that I used to do, providing acceptance
tests to clients for validation).
Concluding, I raise my question: Considering the importance of validating
tests by clients, is there a way in BDD frameworks for scala to load the tests
from an external file, raising an exception if a sentence in the test is not
implemented yet and executing the test normally if all sentences have been
implemented?
Answer: I've just discovered a [cucumber plugin for
sbt](http://blog.knoldus.com/2013/01/15/atdd-cucumber-and-scala/). Tests would
be implemented under test/scala and specifications would be kept in
test/resources as plain txt files. I'm just not sure on how reliable the
library is and if it will have support in the future.
Edit: The above is a wrapper for the following plugin wich solves perfectly
the problem and supports Scala. <https://github.com/cucumber/cucumber-jvm>
|
SQL / Python Create Table Error
Question: I am getting a strange error when I am trying to create this table.... When I
track it back I have nothing on line 5? Can anyone help me on how to track
this error?
import settings import mysql.connector from database import login_info import
datetime as dt
def main():
db = mysql.connector.Connect(**login_info)
cursor = db.cursor()
sql =('DROP TABLE IF EXISTS messages')
cursor.execute(sql)
db.commit()
message_table = """\
CREATE TABLE messages(
msgID INTEGER AUTO_INCREMENT PRIMARY KEY,
message VARCHAR(500) DEFAULT NULL,
subject VARCHAR(500) DEFAULT NULL,
)"""
cursor.execute(message_table)
db.commit()
Error == mysql.connector.errors.ProgrammingError: 1064: You have an error in
your SQL syntax; check the manual that corresponds to your MySQL server
version for the right syntax to use near ')' at line 5
I can connect ot SQl in an interactive window no problem.
Answer: Try removing the `,` at the end of line 4.
|
Most efficient way of sending a string with multiple variables as POST data using urllib
Question: I feel really dumb for having to post this, but I am brand new to Python, and
it isn't anything like PHP, which I do know.
I have a string of data, which contains 1 or more variables, example:
"var1=value1&var2=value2&var3=value3"
I need to send this data to a web server using POST, using urllib.
I have no problems manually formatting the POST data, and send it, but I am
having trouble figuring out how to do this with code, without having to write
complex code.
It's pretty easy to use split('&') to change this string into an array, but
then what?
It looks like I need convert the data to the following syntax before I can
urllib.urlencode it:
{"var1":"value1","var2":"value2","var3":"value3"}
Any suggestions would be greatly appreciated!
Answer: Python has functions for most operations you will have to do with
querystrings/urls. You can turn your string into a dict (like below)
Python 2.7.3 (default, Aug 1 2012, 05:14:39)
[GCC 4.6.3] on linux2
Type "help", "copyright", "credits" or "license" for more information.
>>> qs = "var1=value1&var2=value2&var3=value3"
>>> from urlparse import parse_qs
>>> parse_qs(qs)
{'var1': ['value1'], 'var3': ['value3'], 'var2': ['value2']}
>>> data_dict = parse_qs(qs)
>>> import urllib
>>> post_data_str = urllib.urlencode(data_dict)
>>> post_data_str
'var1=%5B%27value1%27%5D&var3=%5B%27value3%27%5D&var2=%5B%27value2%27%5D'
|
How to silently uninstall Python 2.7 on Windows?
Question: Does anyone know how to silently uninstall Python 2.7 - i.e. uninstall it
unattended, with no need for user interaction? I need to do it as part of an
uninstallation script that installs a bunch of software silently.
I've tried running msiexec with the /x and /qn flags on the msi file that was
originally installed, but it fails - it just throws up the general help
message, implying that I'm using invalid options.
I've done a Google search, and can find help for earlier versions - they can
be uninstalled silently by running the unwise.exe that's installed with them,
with the right options. But 2.7 doesn't seem to include an unwise.exe, so I
can't do that.
Does anyone know how to do this?
**Edit** : The answer turned out to be embarrassingly simple. Those were the
correct command-line options all along - it's just that the order matters. The
correct command was:
`msiexec /x python-2.7.3.amd64.msi /qn`
The important thing was to have the /qn option _after_ the msi file.
Answer: **_Edit:_** Ignore what I previously said, here's the solution according to
the [Python 2.4 Documentation](http://www.python.org/getit/releases/2.4/msi/):
It is not necessary to have the MSI file available for uninstallation;
alternatively, **the package or product code can also be specified**. You can
find the product code by looking at the **properties of the Uninstall
shortcut** that Python installs in the start menu.
Hit the Windows Key, search Python Uninstall, right click it and go to
Properties. The Product Key is in the Target field, you can use that to
uninstall by doing:
msiexec /x {03mY-L0NG-A77-K3Y}.msi /qn
|
PHP and Importing pylab
Question: I have a PHP script that calls in a python program. Here is the php script:
<?php
$last_line = popen('/Library/Frameworks/Python.framework/Versions/Current/bin/python test.py', 'r');
$results = fgets($last_line);
print $results;
?>
and this is the content of test.py:
test.py:
import numpy as np
from matplotlib.patches import Ellipse
# import matplotlib.pyplot as plt
# from matplotlib.pyplot import figure, show
# import pylab
print "Hello World!"
Now, this works fine and I get "Hello World!" in browser. However, if I
uncomment any of the imports (i.e., import matplotlib.pyplot as plt, import
matplotlib.pyplot as plt or import pylab) I don't get the result from PHP. It
will be great if someone could help me with this as I need all the plotting
functions from Python.
Answer: No complete answer but perhaps helpful:
Assuming you're on Mac OS, I have changed your `.php` file to to:
<br><br>==== Start ====<br><br>
<?php
error_reporting(E_ALL);
$handle = popen('python test.py 2>&1', 'r');
while (($buffer = fgets($handle, 4096)) !== false) {
echo $buffer."<br>";
}
pclose($handle);
?>
<br><br>==== End ====<br><br>
and the `.py` file to:
import numpy as np
import matplotlib.pyplot as plt
print "Hello World!"
The `2>&1` redirects the error output of programs to the standard output, this
can usefull for debugging purposes.
The result on the page in the browser contained:
> File "/Library/Python/2.6/site-
> packages/matplotlib-0.91.1-py2.6-macosx-10.6-universal.egg/matplotlib/**init**.py",
> line 403, in _get_configdir raise RuntimeError("Failed to create
> %s/.matplotlib; consider setting MPLCONFIGDIR to a writable directory for
> matplotlib configuration data"%h) RuntimeError: Failed to create
> /Library/WebServer/.matplotlib; consider setting MPLCONFIGDIR to a writable
> directory for matplotlib configuration data
Than i did as root:
mkdir /Library/WebServer/.matplotlib
chown _www /Library/WebServer/.matplotlib/
And than the page in the browser contained as last error:
> File "/Library/Python/2.6/site-
> packages/matplotlib-0.91.1-py2.6-macosx-10.6-universal.egg/matplotlib/numerix/ma/**init**.py",
> line 16, in from numpy.core.ma import * ImportError: No module named ma
hmm, thats still disappointing, however you're mileage may vary, the problem
has probably to do with the environment/permissions of the webserver user
(_www).
|
Django: No module named 'app'
Question: Django barfs with
ImportError at /store/
No module named store
But right there is the debug message there is the setting
INSTALLED_APPS =
('django.contrib.auth',
'django.contrib.contenttypes',
'django.contrib.sessions',
'django.contrib.sites',
'django.contrib.messages',
'django.contrib.staticfiles',
'django.contrib.admin',
'django.contrib.admindocs',
'store')
Environment:
Request Method: GET
Request URL: http://localhost:8000/
Django Version: 1.4.5
Python Version: 2.7.3
Installed Applications:
('django.contrib.auth',
'django.contrib.contenttypes',
'django.contrib.sessions',
'django.contrib.sites',
'django.contrib.messages',
'django.contrib.staticfiles',
'django.contrib.admin',
'django.contrib.admindocs',
'store')
Installed Middleware:
('django.middleware.common.CommonMiddleware',
'django.contrib.sessions.middleware.SessionMiddleware',
'django.middleware.csrf.CsrfViewMiddleware',
'django.contrib.auth.middleware.AuthenticationMiddleware',
'django.contrib.messages.middleware.MessageMiddleware')
Traceback:
File "/usr/lib/python2.7/site-packages/django/core/handlers/base.py" in get_response
111. response = callback(request, *callback_args, **callback_kwargs)
File "/home/paul/cs462/store/store/views.py" in main
37. return redirect(reverse('django.contrib.auth.views.login'))
File "/usr/lib/python2.7/site-packages/django/core/urlresolvers.py" in reverse
476. return iri_to_uri(resolver._reverse_with_prefix(view, prefix, *args, **kwargs))
File "/usr/lib/python2.7/site-packages/django/core/urlresolvers.py" in _reverse_with_prefix
363. possibilities = self.reverse_dict.getlist(lookup_view)
File "/usr/lib/python2.7/site-packages/django/core/urlresolvers.py" in reverse_dict
276. self._populate()
File "/usr/lib/python2.7/site-packages/django/core/urlresolvers.py" in _populate
253. for name in pattern.reverse_dict:
File "/usr/lib/python2.7/site-packages/django/core/urlresolvers.py" in reverse_dict
276. self._populate()
File "/usr/lib/python2.7/site-packages/django/core/urlresolvers.py" in _populate
265. lookups.appendlist(pattern.callback, (bits, p_pattern, pattern.default_args))
File "/usr/lib/python2.7/site-packages/django/core/urlresolvers.py" in callback
216. self._callback = get_callable(self._callback_str)
File "/usr/lib/python2.7/site-packages/django/utils/functional.py" in wrapper
27. result = func(*args)
File "/usr/lib/python2.7/site-packages/django/core/urlresolvers.py" in get_callable
105. not module_has_submodule(import_module(parentmod), submod)):
File "/usr/lib/python2.7/site-packages/django/utils/importlib.py" in import_module
35. __import__(name)
Exception Type: ImportError at /
Exception Value: No module named store
The shell works just fine (for what I try), but this error is displayed at
every page I have. Doesn't having 'store' in the apps means that the module is
imported???
EDIT: I've used Django for project many times. This was working a few hours
ago. There is a blank `__init__.py` file in store/. Moreover, by using a print
statement, I was able to determine that this gets executed (twice). `urls.py`
and `models.py` also are executed (but not `views.py`). I have no idea what I
could do to get this error.
Answer: If it were not for version control, I would have never found this. As it was,
it took me almost an hour to track it down.
The mistake was in store/urls.py:
urlpatterns = patterns('store.views',
url(r'^$', 'main'),
url(r'^new_delivery_user/$', 'new_delivery_user'),
...
url(r'^event_signal/$', 'store.views.event_signal'), # problem
)
I had moved the last URL from the project url.py to this app-specific one,
which used the shorthand 'store.views' for prepending each of the views.
It should have appeared:
url(r'^event_signal/$', 'event_signal'),
|
Why my python and objective-c code get different hmac-sha1 result?
Question: I am writing a client/server project that need a signature. I use
`base64(hmac-sha1(key, data))` to generate a signature. But I got different
signatures between python code and objective-c code:
get_signature('KEY', 'TEXT') //python get 'dAOnR2oXWP9xa4vUBdDvVXTpzQo='
[self hmacsha1:@"KEY" @"TEXT"] //obj-c get '7FH0NG0Ou4nb5luKUyjfrdWunos='
Not only the base64 values are different, the hmac-sha1 digest values are
different too. I'm trying to work it out with my friend for a few hours, still
don't get it. Where is the problem of my code?
My python code:
import hmac
import hashlib
import base64
def get_signature(key, msg):
return base64.b64encode(hmac.new(key, msg, hashlib.sha1).digest())
My friend's objective-c code (copy from [Objective-C sample code for HMAC-
SHA1](http://stackoverflow.com/questions/756492/objective-c-sample-code-for-
hmac-sha1)):
(NSString *)hmac_sha1:(NSString *)key text:(NSString *)text{
const char *cKey = [key cStringUsingEncoding:NSASCIIStringEncoding];
const char *cData = [text cStringUsingEncoding:NSASCIIStringEncoding];
unsigned char cHMAC[CC_SHA1_DIGEST_LENGTH];
CCHmac(kCCHmacAlgSHA1, cKey, strlen(cKey), cData, strlen(cData), cHMAC);
NSData *HMAC = [[NSData alloc] initWithBytes:cHMAC length:sizeof(cHMAC)];
NSString *hash = [GTMBase64 stringByEncodingData:HMAC];
return hash;
}
SOLVED: Thanks for everyone below. But I'm not gotta tell you that the real
reason is I typed "TE **S** T" in my python IDE while typed "TE **X** T" in
this post :P
For not wasting your time, I made some tests and got a nicer solution, base on
your answers:
print get_signature('KEY', 'TEXT')
# 7FH0NG0Ou4nb5luKUyjfrdWunos=
print get_signature(bytearray('KEY'), bytearray('TEXT'))
# 7FH0NG0Ou4nb5luKUyjfrdWunos=
print get_signature('KEY', u'你好'.encode('utf-8')) # best solution, i think!
# PxEm7Oibj7ijZ55ko7V3isSkD1Q=
print get_signature('KEY', bytearray(u'你好'))
# TypeError: unicode argument without an encoding
print get_signature('KEY', u'你好')
# UnicodeEncodeError: 'ascii' codec can't encode characters in position 0-1: ordinal not in range(128)
print get_signature(u'KEY', 'TEXT')
# TypeError: character mapping must return integer, None or unicode
print get_signature(b'KEY', b'TEXT')
# 7FH0NG0Ou4nb5luKUyjfrdWunos=
Conclusion:
1. The message to be signature should be encoded to utf-8 string with both sides.
2. (Thanks to [DJV](http://stackoverflow.com/users/1974792/djv))In python 3, strings are all unicode, so they should be used with 'b', or bytearray(thanks to [Burhan Khalid](http://stackoverflow.com/users/790387/burhan-khalid)), or encoded to utf-8 string.
Answer: Your friend is completely right, but so are you (sorta). Your function is
completely right in both Python 2 and Python 3. However, your call is a little
erroneous in Python 3. You see, in Python 3,
[strings](http://docs.python.org/3.0/howto/unicode.html#the-string-type) are
unicode, so in order to pass an ASCII string (as your Objective C friend does
and as you would do in Python 2), you need to call your function with:
get_signature(b'KEY', b'TEXT')
in order to specify that those strings are
[bytes](http://docs.python.org/3.0/library/functions.html#bytes) a.k.a. ASCII
strings.
**EDIT:** As [Burhan Khalid](http://stackoverflow.com/users/790387/burhan-
khalid) noted, the flexible way of doing this in Python 3 is to either call
your function like this:
get_signature(key.encode('ascii'), test.encode('ascii'))
or define it as:
def get_signature(key, msg):
if(isinstance(key, str)):
key = key.encode('ascii')
if(isinstance(msg, str)):
msg = msg.encode('ascii')
return base64.b64encode(hmac.new(key, msg, hashlib.sha1).digest())
|
Bash can't find python library but pydev can
Question: I am trying to write some script using Python DNS library (dnspython). I
installed it (python-dns and python-dnspython) using packet manager (apt-get
install).
I was trying to write the script interactively on the shell, but it keeps
saying that it can't find the library.
>>> import dns
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
ImportError: No module named dns
The funny part is, when I make the same import on Eclipse (pydev) it has no
problem placing it. It must be something I do wrong, like not defining the
path etc (although this one isn't very likely, since -as far as I know- apt-
get is supposed to handle it automatically).
OS: Ubuntu 12.04 Python version: 2.7.3
I am a beginner on Linux and on Python (bad combination, I know). Any help
will be appreciated. Thanks in advance!
Answer: Try this in both environments to see what the difference is:
import sys
print sys.path
|
How do I get Boto to return EC2 instances - S3 works fine
Question: I'm having some issues with the EC2 bit of Boto (Boto v2.8.0, Python v2.6.7).
The first command returns a list of S3 Buckets - all good! The second command
to get a list of EC2 instances blows up with a 403 with "Query-string
authentication requires the Signature, Expires and AWSAccessKeyId parameters"
s3_conn = S3Connection(AWSAccessKeyId, AWSSecretKey)
print s3_conn.get_all_buckets()
ec2_conn = EC2Connection(AWSAccessKeyId, AWSSecretKey)
print ec2_conn.get_all_instances()
Also, my credentials are all good (Full admin) - I tested them using the Ruby
aws-sdk, both EC2 and S3 work fine.
I also noticed that the **host** attribute in the ec2_conn object is **s3-eu-
west-1.amazonaws.com** , "s3"...? Surely thats wrong? I've tried retro fixing
it to the correct endpoint but no luck.
Any help would be great appreciate Thanks
Answer: Here's some working code I use to list all my instances across potentially
multiple regions. Its doing a lot more than you need, but maybe you can pare
it down to what you want.
#!/usr/bin/python
import boto
import boto.ec2
import sys
class ansi_color:
red = '\033[31m'
green = '\033[32m'
reset = '\033[0m'
grey = '\033[1;30m'
def name(i):
if 'Name' in i.tags:
n = i.tags['Name']
else:
n = '???'
n = n.ljust(16)[:16]
if i.state == 'running':
n = ansi_color.green + n + ansi_color.reset
else:
n = ansi_color.red + n + ansi_color.reset
return n
def pub_dns( i ):
return i.public_dns_name.rjust(43)
def pri_dns( i ):
return i.private_dns_name.rjust(43)
def print_instance( i ):
print ' ' + name(i) + '| ' + pub_dns(i) + ' ' + pri_dns(i)
regions = sys.argv[1:]
if len(regions)==0:
regions=['us-east-1']
if len(regions)==1 and regions[0]=="all":
rr = boto.ec2.regions()
else:
rr = [ boto.ec2.get_region(x) for x in regions ]
for reg in rr:
print "========"
print reg.name
print "========"
conn = reg.connect()
reservations = conn.get_all_instances()
for r in reservations:
# print ansi_color.grey + str(r) + ansi_color.reset
for i in r.instances:
print_instance(i)
|
Retrieve JPEG image from a redirected URL and display it on a GUI window
Question: I'm trying to download a JPEG file from a URL and display it on a tkinter GUI
window
This is the code I am trying to use to download and display the JPEG:
picURL = "https://graph.facebook.com/" + ID + "/picture"
picBytes= urlopen(picURL).read()
picData = io.BytesIO(picBytes)
picPil = Image.open(picData)
picTk = ImageTk.PhotoImage(picPil)
label_9 = Label(image = picTK, bg = "blue").pack()
The problem is that the image isn't showing up. All I get is a blue box. How
can i make it so the picture is shown?
Thanks
Im using python 3.3 on windows
Answer: What library are you using to access the image? I would recommend
[requests](http://docs.python-requests.org/en/latest/ "requests"). It
automatically handles redirects for you:
import requests
import Image
from StringIO import StringIO
r = requests.get(https://graph.facebook.com/userID/picture)
im = Image.open(StringIO(r.content))
|
Python-opencv: Read image data from stdin
Question: How can I read image data from stdin rather than from a file?
With the C++ interface, it seems to be possible:
<http://stackoverflow.com/a/5458035/908515>. The function `imdecode` is
available in Python as well. But it expects a `numpy array` as (first)
argument. I have no idea how to convert the stdin data.
This is what I tried:
import cv
import sys
import numpy
stdin = sys.stdin.read()
im = cv.imdecode(numpy.asarray(stdin), 0)
Result: `TypeError: <unknown> data type = 18 is not supported`
Answer: Looks like python stdin buffer is too small for images. You can run your
program with `-u` flag in order to remove buffering. More details in
[this](http://stackoverflow.com/a/3670470/723891) answer.
Second is that `numpy.asarray` probably not right way to get numpy array from
the data, `numpy.frombuffer` works for me very well.
So here is working code (only I used `cv2` instead of `cv` hope it wont matter
too much):
import sys
import cv2
import numpy
stdin = sys.stdin.read()
array = numpy.frombuffer(stdin, dtype='uint8')
img = cv2.imdecode(array, 1)
cv2.imshow("window", img)
cv2.waitKey()
Can be executed this way:
python -u test.py < cat.jpeg
|
Setting up Python Flask app with admin section
Question: I've built a few small Flask apps before that were read only and I really
enjoyed the process. now I'm adding an admin section to a Flask app and I'm
looking for some guidance.
Current directory structure looks like this:
├── Makefile
├── Procfile
├── app.py
├── requirements.txt
├── static
│ ├── css
│ ├── fonts
│ ├── img
│ └── js
└── templates
├── about.html
├── base.html
├── contact.html
└── index.html
My app.py file looks like this:
import os
from flask import Flask, render_template
app = Flask(__name__)
app.debug = True
# MAIN APPLICATION
@app.route('/')
@app.route('/work/<gallery>/')
def index(gallery='home'):
return render_template('index.html', gallery=gallery)
@app.route('/views/<view>/')
def view(view):
return render_template(view + '.html')
@app.route('/data/<gallery>/<size>/')
def data(gallery='home', size='md'):
data = '[\
{"image": "/static/img/photos/md/img_1.jpg","color": "white"},\
{"image": "/static/img/photos/md/img_2.jpg","color": "white"},\
{"image": "/static/img/photos/md/img_3.jpg","color": "black"}\
]'
return data
if __name__ == '__main__':
# Bind to PORT if defined, otherwise default to 5000.
port = int(os.environ.get('PORT', 5000))
app.run(host='0.0.0.0', port=port)
I've done some research and found the [Blueprints
framework](http://flask.pocoo.org/docs/blueprints/) and [Flask-
Admin](https://github.com/mrjoes/flask-admin) which seem like they might work
together. Does anyone have an alternate suggestion that might be more
efficient or easier to set up?
Answer: Blueprints allow you to group functionality into isolated modules.
If you feel your service will be very small, there's no need to use blueprints
- you can add routes to the Flask application, like you do in your example.
However, if application will get bigger, it is better to split it into smaller
pieces by using blueprints. In your example, "work" is first possible
blueprint, "views" is another, etc.
Flask-Admin allows you to build administrative interface a-la Django admin. It
does not matter how you're structuring rest of your application - you add
Flask-Admin and it just works.
|
Calling Custom functions from Python using rpy2
Question: Is there a way to call functions defined in a file say myfunc.r
---------------myfunc.r --------------
myfunc = function(){
return(c(1,2,3,4,5,6,7,8,9,10))
}
getname = function(){
return("chart title")
}
---- Python
How to call getname() here ?
Any help would be greatly appreciated ?
Answer: The are features in rpy2 that should help making this cleaner than dumping
objects into the global workspace.
from rpy2.robjects.packages import STAP
# if rpy2 < 2.6.1 do:
# from rpy2.robjects.packages import SignatureTranslatedAnonymousPackage
# STAP = SignatureTranslatedAnonymousPackage
with open('myfunc.r', 'r') as f:
string = f.read()
myfunc = STAP(string, "myfunc")
The objects in the R file can now be accessed with `myfunc.myfunc` and
`myfunc.getname`.
Check the documention about [importing arbitrary R code as a
package](http://rpy2.readthedocs.org/en/version_2.7.x/robjects_rpackages.html#importing-
arbitrary-r-code-as-a-package) (older doc
[here](http://rpy.sourceforge.net/rpy2/doc-
dev/html/robjects_rpackages.html#importing-arbitrary-r-code-as-a-package)).
|
Convert String In Python to insert into MySQL DB date column date
Question: I have an unusual date string that I want to insert into a MySQL DB.
date = 'Thu, 14 Mar 2013 13:33:07 -0400'
And here is the insert statement
self.cursor.execute("INSERT INTO table1 (`DATE`)VALUES (%s);",(date))
When I do it like this it shows up in the database like :
0000-00-00 00:00:00
Even if I enter the SQL manualy it shows up the same way.
How do I convert the date string into a mysql readable date for insert?
Answer:
from dateutil.parser import parse
date = 'Thu, 14 Mar 2013 13:33:07 -0400'
parse(date).strftime("%Y-%m-%d %H:%M:%S")
|
Error importing gtk with python on OS X
Question: I've just installed pygtk through Homebrew(awesome tool) as well as its
dependences (including gtk+); the thing is when I try to import gtk on the
python interpreter it throws an ImportError, which don't happens when
importing pygtk or any other module into the interpreter, I can't figure out
what's wrong. :S
Answer: After clarification from the OP, the original answer does not describe his
problem… although I think it's related, and it may help other people, so I
will leave it. But first, the relevant part.
Before you can `import gtk`, you need to call `pygtk.require`, as shown in the
[Getting Started](http://www.pygtk.org/pygtk2tutorial/ch-GettingStarted.html)
section of the tutorial. (For more details, see the [PyGTK
FAQ](http://faq.pygtk.org/index.py?req=show&file=faq02.006.htp).)
That should solve your problem… but you're just crashing with `Fatal Python
error: PyThreadState_Get: no current thread`. There are a number of reasons
you can get this, but the most likely in this case is that you're running a C
extension (`pygtk`/`gtk`/whatever) built for one version of Python against a
different version of Python. (This is actually [covered in the PyGTK
FAQ](http://faq.pygtk.org/index.py?req=show&file=faq01.010.htp) as well, but
in this case it's a more general issue with CPython C extension modules, not
something PyGTK specific.)
If you have multiple Python 2.7 versions (and if you have 2.7.3, you very
definitely have two, because Apple's is 2.7.2), you have to figure out which
ones you have, and which one you used to build `pygtk`, and make sure you use
it from the same one.
And that takes us back to the original answer, which I've left below.
* * *
There are two reasons you can have this problem.
* * *
First, if you haven't installed any extra Python versions besides the ones
that came with OS X, you may not have read the instructions that `brew` prints
out about `pygtk` whenever you install it, or info it, etc.:
For example:
$ brew info pygtk
pygtk: stable 2.24.0
...
==> Caveats
For non-Homebrew Python, you need to amend your PYTHONPATH like so:
export PYTHONPATH=/usr/local/lib/python2.7/site-packages:$PYTHONPATH
Homebrew installs Python packages into /usr/local/lib/pythonX.Y—even if it's
installing for Apple's Python installation. But Apple's Python installation
doesn't look for packages there by default. So, you need to do what this says.
Just typing this line at the Terminal will work for the rest of that terminal
session. If you want to make it permanent… well, there are many options,
depending on exactly what you want. See [this
answer](http://stackoverflow.com/questions/603785/environment-variables-in-
mac-os-x/4567308#4567308) for details.
This is explained in more detail at [Gems, Eggs and Perl
Modules](https://github.com/mxcl/homebrew/wiki/Gems,-Eggs-and-Perl-Modules)
and [Homebrew and Python](https://github.com/mxcl/homebrew/wiki/Homebrew-and-
Python).
(This is one of the multiple reasons why Homebrew usually recommends using
`pip` whenever possible, rather than looking for packages in `brew`. But there
are a few exceptions, and I could easily believe pygtk is one of them.)
* * *
Second, if you installed Homebrew's Python, you probably don't have your PATH
set up right, so you're installing packages into the Homebrew Python's site
packages, but then running the Apple Python installation instead.
If you're just typing `python` and don't know which one you're running, `which
python` should tell you. If it's `/usr/bin/python` it's Apple's; if it's
`/usr/local/bin/python`, that's Homebrew's.
You can also tell from the Python startup banner, because Mountain Lion comes
with 2.7.2, while Homebrew will install 2.7.3. (Also, IIRC, Apple used a
prerelease clang to build their Python, while anything you build with Homebrew
will be built with whatever clang/gcc/llvm-gcc you have, which is not going to
be a prerelease build…)
**NOTE: Just because you see the word "Apple" somewhere in the banner doesn't
mean it's Apple's Python!** If you build a Homebrew Python, or install a
python.org Python, it will almost certainly be built with Apple GCC, Apple
Clang, or Apple LLVM-GCC. And it's running on an Apple OS, too. So, "Apple" or
"apple" will appear up to three times in the banner for _any_ Python, Apple or
not.
The fix for this is to run the Python you want to run. For example:
* Use `virtualenv` to create one or more virtual environments based on either or both installations, and pick and choose using the venv tools.
* Always use full paths—e.g., type `/usr/local/bin/python` to run Homebrew's Python, `/usr/bin/python` to run Apple's. (And modify the shebang lines in any of your scripts to do the same.)
* Change your `PATH` variable to make sure whichever one you want first comes first. For Homebrew, you want either /usr/local/Cellar/python/2.7.3/bin (for just Python) or /usr/local/bin (for everything) before /usr/bin; for Apple, the other way around.
* Add the Python framework bin directory(ies) to the PATH, so you can manipulate their order separately from general binaries. (This one isn't really relevant with Homebrew Python, because the Cellar directory serves the same purpose. But it can be useful with other third-party Python installations.)
All of this applies to other tools. Many people get into trouble by having,
e.g., one installation's `pip` or `idle` come first in the path, while a
different installation's `python` does…
* * *
If you've installed a _different_ Python, e.g., by using the installers from
python.org, you could easily have _both_ of the above problems. For example,
you could be installing stuff for python.org Python, but running Apple Python,
and on top of that, neither one may be configured to look in the Homebrew
site-packages directory.
|
Django: Can't find template files. / App works without template files?
Question: Yesterday I tried to edit a template in my django app and noticed that the
template-file isn't even used (anymore). Even if I delete it the app will
continue to work and changes I make in the file wont appear online. I couldn't
find any other template file on my server, so could it be that Django imported
it somehow or copied/saved it somewhere else?
The app is hosted on a shared host, with Python2.7, Django 1.4.5 and FCGI.
My settings.py looks like this:
# Hosts/domain names that are valid for this site; required if DEBUG is False
# See https://docs.djangoproject.com/en/1.4/ref/settings/#allowed-hosts
ALLOWED_HOSTS = ['*']
#FORCE_SCRIPT_NAME = '/polls'
# Local time zone for this installation. Choices can be found here:
# http://en.wikipedia.org/wiki/List_of_tz_zones_by_name
# although not all choices may be available on all operating systems.
# In a Windows environment this must be set to your system time zone.
TIME_ZONE = 'Europe/Berlin'
# Language code for this installation. All choices can be found here:
# http://www.i18nguy.com/unicode/language-identifiers.html
LANGUAGE_CODE = 'de-de'
SITE_ID = 1
# If you set this to False, Django will make some optimizations so as not
# to load the internationalization machinery.
USE_I18N = True
# If you set this to False, Django will not format dates, numbers and
# calendars according to the current locale.
USE_L10N = True
# If you set this to False, Django will not use timezone-aware datetimes.
USE_TZ = True
# Absolute filesystem path to the directory that will hold user-uploaded files.
# Example: "/home/media/media.lawrence.com/media/"
MEDIA_ROOT = ''
# URL that handles the media served from MEDIA_ROOT. Make sure to use a
# trailing slash.
# Examples: "http://media.lawrence.com/media/", "http://example.com/media/"
MEDIA_URL = ''
# Absolute path to the directory static files should be collected to.
# Don't put anything in this directory yourself; store your static files
# in apps' "static/" subdirectories and in STATICFILES_DIRS.
# Example: "/home/media/media.lawrence.com/static/"
STATIC_ROOT = 'http://ulli.cepheus.uberspace.de/static/'
# URL prefix for static files.
# Example: "http://media.lawrence.com/static/"
STATIC_URL = 'http://ulli.cepheus.uberspace.de/static/'
# Additional locations of static files
STATICFILES_DIRS = (
"/var/www/virtual/ulli/html/static",
# Put strings here, like "/home/html/static" or "C:/www/django/static".
# Always use forward slashes, even on Windows.
# Don't forget to use absolute paths, not relative paths.
)
# List of finder classes that know how to find static files in
# various locations.
STATICFILES_FINDERS = (
'django.contrib.staticfiles.finders.FileSystemFinder',
'django.contrib.staticfiles.finders.AppDirectoriesFinder',
# 'django.contrib.staticfiles.finders.DefaultStorageFinder',
)
# List of callables that know how to import templates from various sources.
TEMPLATE_LOADERS = (
'django.template.loaders.filesystem.Loader',
'django.template.loaders.app_directories.Loader',
# 'django.template.loaders.eggs.Loader',
)
MIDDLEWARE_CLASSES = (
'django.middleware.common.CommonMiddleware',
'django.contrib.sessions.middleware.SessionMiddleware',
'django.middleware.csrf.CsrfViewMiddleware',
'django.contrib.auth.middleware.AuthenticationMiddleware',
'django.contrib.messages.middleware.MessageMiddleware',
# Uncomment the next line for simple clickjacking protection:
# 'django.middleware.clickjacking.XFrameOptionsMiddleware',
)
ROOT_URLCONF = 'mysite.urls'
# Python dotted path to the WSGI application used by Django's runserver.
WSGI_APPLICATION = 'mysite.wsgi.application'
TEMPLATE_DIRS = (
# Put strings here, like "/home/html/django_templates" or "C:/www/django/templates".
# Always use forward slashes, even on Windows.
# Don't forget to use absolute paths, not relative paths.
"/template",
"/template/polls",
"/var/www/virtual/ulli/html/template/polls",
"http://ulli.cepheus.uberspace.de/template",
)
INSTALLED_APPS = (
'django.contrib.auth',
'django.contrib.contenttypes',
'django.contrib.sessions',
'django.contrib.sites',
'django.contrib.messages',
'django.contrib.staticfiles',
# Uncomment the next line to enable the admin:
'django.contrib.admin',
# Uncomment the next line to enable admin documentation:
# 'django.contrib.admindocs',
'polls',
)
# A sample logging configuration. The only tangible logging
# performed by this configuration is to send an email to
# the site admins on every HTTP 500 error when DEBUG=False.
# See http://docs.djangoproject.com/en/dev/topics/logging for
# more details on how to customize your logging configuration.
LOGGING = {
'version': 1,
'disable_existing_loggers': False,
'filters': {
'require_debug_false': {
'()': 'django.utils.log.RequireDebugFalse'
}
},
'handlers': {
'mail_admins': {
'level': 'ERROR',
'filters': ['require_debug_false'],
'class': 'django.utils.log.AdminEmailHandler'
}
},
'loggers': {
'django.request': {
'handlers': ['mail_admins'],
'level': 'ERROR',
'propagate': True,
},
}
}
Thank you for your help! :)
Answer: Just a guess, but the template [might be
cached](https://docs.djangoproject.com/en/dev/ref/templates/api/#django.template.loaders.cached.Loader).
Although, I don't see this cached loader in your settings. Might worth trying
a restart anyway?
|
Python, IDLE: Too many recursive errors
Question: This is supposedly a problem with the IDLE editor for Python. (I'm running
Python 3.3.0 on OSX, but the same problem occurs with 2.7.3)
I'm using IDLE to write Python programs. My problem is: Calling a recursive
function, which calls itself too many times (1000 times), doesn't give me a
single runtime error, but rather, it keeps sending me error messages until I
close the program.
The error which it should be sending is: "RuntimeError: maximum recursion
depth exceeded." The error which it sends a thousand times isntead is simply a
point out to where in the script the problem is:
Traceback (most recent call last):
File "<pyshell#112>", line 1, in <module>
factorial(1.5)
File "/Users/User/Documents/Python/Scripts/program1.py", line 187, in factorial
recurse = factorial(n-1)
File "/Users/User/Documents/Python/Scripts/program1.py", line 187, in factorial
recurse = factorial(n-1)
etc.
This goes with all recursive functions calling itself too many times, but the
specific function used here is:
def factorial(n):
if n == 0:
return 1
else:
recurse = factorial(n-1)
result = n * recurse
return result
Answer: To stop python from showing those hundreds of errors, you can use a `try-
except` block:
def factorial(n):
if n == 0:
return 1
else:
recurse = factorial(n-1)
result = n * recurse
return result
try:
print (factorial(6000))
except RuntimeError as e:
print (e)
output:
#print factorial(1000)
93326215443944152681699238856266700490715968264381621468592963895217599993229915608941463976156518286253697920827223758251185210916864000000000000000000000000
#print factorial(6000)
maximum recursion depth exceeded in comparison
In your case this error occurs because python has a limit on the maximum
recursion depth,it is there to stop the C stack from overflow. But you can
change it using `sys.setrecursionlimit`:
In [4]: import sys
In [5]: sys.getrecursionlimit()
Out[5]: 1000
|
pycurl login joomla website
Question: I try create small script for login joomla web site whit python pycurl, im
write this code :
import sys, re
import pycurl
import cStringIO
import time
import urllib
def LoginJoomla(url):
buf = cStringIO.StringIO()
c = pycurl.Curl()
c.setopt(c.URL, url)
post_params = [('usrname','admin'),('passwd','1234567789'),('submit','Login')]
resp_data = urllib.urlencode(post_params)
c.setopt(c.POSTFIELDS, resp_data)
c.setopt(pycurl.POST, 1)
c.setopt(c.WRITEFUNCTION, buf.write)
c.perform()
html = buf.getvalue()
buf.close()
print html
LoginJoomla("http://www.domain.com/administrator/index.php?option=com_user&view=login")
Bat not working, give me the normal login webpage, please any body can say me
where i wrong.
Answer: Read the BUT first!
You need to get the URL parameters right (I think your URL is bad):
`POST to http://www.example.com/administrator/`
with the **following parameters:**
* option=com_login
* task=login
* username=YOURUSER (not usrname! as you have)
* passwd
**BUT** from my knowledge about Joomla! autentication, you can't do it this
way, because Joomla! from the web browser will send a token, to make sure the
form was posted from a browser.
If it's not posted from a browser, an error like 'The most recent request was
denied because it contained an invalid security token. Please refresh the page
and try again.'
I know it's possible to remotely login to Joomla!, just keep searching. You
may need a custom authentication plugin.
|
Refresh a list content with another list in Python
Question: How would I extend the content of a given list with another given list without
using the method `.extend()`? I imagine that I could use something with
dictionaries.
**Code**
>>> tags =['N','O','S','Cl']
>>> itags =[1,2,4,3]
>>> anew =['N','H']
>>> inew =[2,5]
I need a function which returns the refreshed lists
tags =['N','O','S','Cl','H']
itags =[3,2,4,3,5]
When an element is already in the list, the number in the other list is added.
If I use the `extend()` method, the the element `N` will appear in list `tags`
twice:
>>> tags.extend(anew)
>>>itags.extend(inew)
>>> print tags,itags
['N','O','S','Cl','N','H'] [1,2,4,3,5,2,5]
Answer: You probably want a
[Counter](http://docs.python.org/2/library/collections.html?highlight=collections#collections.Counter)
for this.
from collections import Counter
tags = Counter({"N":1, "O":2, "S": 4, "Cl":3})
new = Counter({"N": 2, "H": 5})
tags = tags + new
print tags
output:
Counter({'H': 5, 'S': 4, 'Cl': 3, 'N': 3, 'O': 2})
|
Python Xml Parsing for Wolfram Api
Question: I'm trying to get the out put of the wolfram api using a python xml parsing
script. Here's my script:
import urllib
import urllib.request
import xml.etree.ElementTree as ET
xml_data=urllib.request.urlopen("http://api.wolframalpha.com/v2/query?input=sqrt+2&appid=APLTT9-9WG78GYE65").read()
root = ET.fromstring(xml_data)
for child in root:
print (child.get("title"))
print (child.attrib)
I know It's only getting the attributes of everything in the title portion of
the code but it's a start.
Here's a snippet of the output:
<pod title="Input" scanner="Identity" id="Input" position="100" error="false" numsubpods="1">
<subpod title="">
<plaintext>sqrt(2)</plaintext>
I'm trying to get it to only print out what is in the tags. Does anyone know
how to edit the code to get that?
Answer: Only the `<plaintext>` elements contain text:
for pt in root.findall('.//plaintext'):
if pt.text:
print(pt.text)
The `.text` attribute holds the text of an element.
For your URL, that prints:
sqrt(2)
1.4142135623730950488016887242096980785696718753769480...
[1; 2^_]
Pythagoras's constant
sqrt(2)~~1.4142 (real, principal root)
-sqrt(2)~~-1.4142 (real root)
It looks like the `<pod>` tags have interesting titles too:
for pod in root.findall('.//pod'):
print(pod.attrib['title'])
for pt in pod.findall('.//plaintext'):
if pt.text:
print('-', pt.text)
which then prints:
Input
- sqrt(2)
Decimal approximation
- 1.4142135623730950488016887242096980785696718753769480...
Number line
Continued fraction
- [1; 2^_]
Constant name
- Pythagoras's constant
All 2nd roots of 2
- sqrt(2)~~1.4142 (real, principal root)
- -sqrt(2)~~-1.4142 (real root)
Plot of all roots in the complex plane
|
Why does my contextmanager-function not work like my contextmanager class in python?
Question: In my code, I need to be able to open and close a device properly, and
therefore see the need to use a context manager. While a context manager is
usually defined as a class with `__enter__` and `__exit__` methods, there also
seem to be the possibility to decorate a function for use with the context
manager (see [a recent post](http://stackoverflow.com/questions/15427361/how-
to-use-the-context-manager-to-avoid-the-use-of-del-in-
python/15427892?noredirect=1#15427892) and [another nice example
here](http://preshing.com/20110920/the-python-with-statement-by-example)).
In the following (working) code snippet, I have implemented the two
possibilities; one just need to swap the commented line with the other one:
import time
import contextlib
def device():
return 42
@contextlib.contextmanager
def wrap():
print("open")
yield device
print("close")
return
class Wrap(object):
def __enter__(self):
print("open")
return device
def __exit__(self, type, value, traceback):
print("close")
#with wrap() as mydevice:
with Wrap() as mydevice:
while True:
time.sleep(1)
print mydevice()
What I try is to run the code and stop it with `CTRL-C`. When I use the `Wrap`
class in the context manager, the `__exit__` method is called as expeced (the
text 'close' is printed in the terminal), but when I try the same thing with
the `wrap` function, the text 'close' is not printed to the terminal.
My question: Is there a problem with the code snippet, am I missing something,
or why is the line `print("close")` not called with the decorated function?
Answer: The example in the documentation for `contextmanager` is somewhat misleading.
The portion of the function after `yield` does not really correspond to the
`__exit__` of the context manager protocol. The key point in the documentation
is this:
> If an unhandled exception occurs in the block, it is reraised inside the
> generator at the point where the yield occurred. Thus, you can use a
> `try...except...finally` statement to trap the error (if any), or ensure
> that some cleanup takes place.
So if you want to handle an exception in your contextmanager-decorated
function, you need to write your own `try` that wraps the `yield` and handle
the exceptions yourself, executing cleanup code in a `finally` (or just block
the exception in `except` and execute your cleanup after the `try/except`).
For example:
@contextlib.contextmanager
def cm():
print "before"
exc = None
try:
yield
except Exception, exc:
print "Exception was caught"
print "after"
if exc is not None:
raise exc
>>> with cm():
... print "Hi!"
before
Hi!
after
>>> with cm():
... print "Hi!"
... 1/0
before
Hi!
Exception was caught
after
[This page](http://pymotw.com/2/contextlib/index.html#from-generator-to-
context-manager) also shows an instructive example.
|
How to ensure all string literals are unicode in python
Question: I have a fairly large python code base to go through. It's got an issue where
some string literals are strings and others are unicode. And this causes bugs.
I am trying to convert everything to unicode. I was wondering if there is a
tool that can convert all literals to unicode. I.e. if it found something like
this:
print "result code %d" % result['code']
to:
print u"result code %d" % result[u'code']
If it helps I use PyCharm (in case there is an extension that does this),
however I am would be happy to use a command like too as well. Hopefully such
a tool exists.
Answer: You can use
[tokenize.generate_tokens](http://docs.python.org/2/library/tokenize.html#tokenize.generate_tokens)
break the string representation of Python code into tokens. `tokenize` also
classifies the tokens for you. Thus you can identify string literals in Python
code.
It is then not hard to manipulate the tokens, adding `'u'` where desired:
* * *
import tokenize
import token
import io
import collections
class Token(collections.namedtuple('Token', 'num val start end line')):
@property
def name(self):
return token.tok_name[self.num]
def change_str_to_unicode(text):
result = text.splitlines()
# Insert a dummy line into result so indexing result
# matches tokenize's 1-based indexing
result.insert(0, '')
changes = []
for tok in tokenize.generate_tokens(io.BytesIO(text).readline):
tok = Token(*tok)
if tok.name == 'STRING' and not tok.val.startswith('u'):
changes.append(tok.start)
for linenum, s in reversed(changes):
line = result[linenum]
result[linenum] = line[:s] + 'u' + line[s:]
return '\n'.join(result[1:])
text = '''print "result code %d" % result['code']
# doesn't touch 'strings' in comments
'handles multilines' + \
'okay'
u'Unicode is not touched'
'''
print(change_str_to_unicode(text))
yields
print u"result code %d" % result[u'code']
# doesn't touch 'strings' in comments
u'handles multilines' + u'okay'
u'Unicode is not touched'
|
PySide - PyQt4 - Draw on one table widget
Question: In the following code, I would like to draw fro exemple a circle on the cell
of coordinate (4,5). How could I achieve this ?
#! /usr/bin/env python2.7
# -*- coding: utf-8 -*-
import sys
from PySide import QtCore, QtGui
class MainWindow(QtGui.QWidget):
def __init__(
self,
parent = None
):
super(MainWindow, self).__init__(parent)
# General grid
self.table = QtGui.QTableWidget(self)
self.nbrow, self.nbcol = 9, 9
self.table.setRowCount(self.nbrow)
self.table.setColumnCount(self.nbcol)
# Each cell has dimension 50 pixels x 50 pixels
for row in range(0, self.nbrow):
self.table.setRowHeight(row, 50)
for col in range(0, self.nbcol):
self.table.setColumnWidth(col, 50)
# Each cell contains one single QTableWidgetItem
for row in range(0, self.nbrow):
for col in range(0, self.nbcol):
item = QtGui.QTableWidgetItem()
item.setTextAlignment(
QtCore.Qt.AlignHCenter | QtCore.Qt.AlignVCenter
)
self.table.setItem(row, col, item)
# Header formatting
font = QtGui.QFont()
font.setFamily(u"DejaVu Sans")
font.setPointSize(12)
self.table.horizontalHeader().setFont(font)
self.table.verticalHeader().setFont(font)
# Font used
font = QtGui.QFont()
font.setFamily(u"DejaVu Sans")
font.setPointSize(20)
self.table.setFont(font)
# Global Size
self.resize(60*9, 60*9 + 20)
# Layout of the table
layout = QtGui.QGridLayout()
layout.addWidget(self.table, 0, 0)
self.setLayout(layout)
# Set the focus in the first cell
self.table.setFocus()
self.table.setCurrentCell(0, 0)
if __name__ == "__main__":
app = QtGui.QApplication(sys.argv)
fen = MainWindow()
fen.show()
sys.exit(app.exec_())
Answer: I guess you can reimplement the paint method like in the following example
which captures a right-mouse click and places a little circle on the
corresponding coordinates.
#!/usr/bin/python
#-*- coding:utf-8 -*-
from PyQt4.QtCore import *
from PyQt4.QtGui import *
class PaintTable(QTableWidget):
def __init__(self, parent):
QTableWidget.__init__(self, parent)
self.setRowCount(10)
self.setColumnCount(10)
self.center = QPoint(-10,-10)
def paintEvent(self, event):
painter = QPainter(self.viewport()) #See: http://stackoverflow.com/questions/12226930/overriding-qpaintevents-in-pyqt
painter.drawEllipse(self.center,10,10)
QTableWidget.paintEvent(self,event)
def mousePressEvent(self, event):
if event.buttons() == Qt.RightButton:
self.center = QPoint(event.pos().x(), event.pos().y())
print self.center
self.viewport().repaint()
elif event.buttons() == Qt.LeftButton:
QTableWidget.mousePressEvent(self,event)
class mainWindow(QMainWindow):
def __init__(self, parent=None):
super(mainWindow, self).__init__(parent)
self.table = PaintTable(self)
self.setCentralWidget(self.table)
if __name__ == "__main__":
import sys
app = QApplication(sys.argv)
main = mainWindow()
main.show()
sys.exit(app.exec_())
Applied to your minimal working example this would look like this:
#! /usr/bin/env python2.7
# -*- coding: utf-8 -*-
import sys
#from PyQt4 import QtCore, QtGui
from PySide import QtCore, QtGui #Just tested it for PyQt4 since I don't have PySide installed...
class PaintTable(QtGui.QTableWidget):
def __init__(self, parent):
QtGui.QTableWidget.__init__(self, parent)
self.center = QtCore.QPoint(-10,-10)
def paintEvent(self, event):
painter = QtGui.QPainter(self.viewport()) #See: http://stackoverflow.com/questions/12226930/overriding-qpaintevents-in-pyqt
painter.drawEllipse(self.center,10,10)
QtGui.QTableWidget.paintEvent(self,event)
def mousePressEvent(self, event):
if event.buttons() == QtCore.Qt.RightButton:
self.center = QtCore.QPoint(event.pos().x(), event.pos().y())
print self.center
self.viewport().repaint()
elif event.buttons() == QtCore.Qt.LeftButton:
QtGui.QTableWidget.mousePressEvent(self,event)
class MainWindow(PaintTable):
def __init__(
self,
parent = None
):
super(MainWindow, self).__init__(parent)
# General grid
self.table = PaintTable(self)
self.nbrow, self.nbcol = 9, 9
self.table.setRowCount(self.nbrow)
self.table.setColumnCount(self.nbcol)
for row in range(0, self.nbrow):
self.table.setRowHeight(row, 50)
for col in range(0, self.nbcol):
self.table.setColumnWidth(col, 50)
# Each cell contains one single QTableWidgetItem
for row in range(0, self.nbrow):
for col in range(0, self.nbcol):
item = QtGui.QTableWidgetItem()
item.setTextAlignment(
QtCore.Qt.AlignHCenter | QtCore.Qt.AlignVCenter
)
self.table.setItem(row, col, item)
# Header formatting
font = QtGui.QFont()
font.setFamily(u"DejaVu Sans")
font.setPointSize(12)
self.table.horizontalHeader().setFont(font)
self.table.verticalHeader().setFont(font)
# Font used
font = QtGui.QFont()
font.setFamily(u"DejaVu Sans")
font.setPointSize(20)
self.table.setFont(font)
# Global Size
self.resize(60*9, 60*9 + 20)
# Layout of the table
layout = QtGui.QGridLayout()
layout.addWidget(self.table, 0, 0)
self.setLayout(layout)
# Set the focus in the first cell
self.table.setFocus()
self.table.setCurrentCell(0, 0)
if __name__ == "__main__":
app = QtGui.QApplication(sys.argv)
fen = MainWindow()
fen.show()
sys.exit(app.exec_())
|
Trouble authenticating Tor with python
Question: Probably doing something very silly here, but I'm having some trouble
authenticating automatically through Tor.
I'm using 32 bit ubuntu 12.04 with obfuscated bridges.
This should be all the relevant code, but let me know if there's something
else that would be useful in debugging this issue:
import socket
import socks
import httplib
def connectTor():
socks.setdefaultproxy(socks.PROXY_TYPE_SOCKS5, "127.0.0.1", 9050, True)
#9050 is the Tor proxy port
socket.socket = socks.socksocket
def newIdentity():
socks.setdefaultproxy() #Disconnect from Tor network
s = socket.socket(socket.AF_INET, socket.SOCK_STREAM)
s.connect(("127.0.0.1", 46594))
s.send("AUTHENTICATE\r\n")
response = s.recv(128)
#128 bytes of data for now, just to see how Tor responds
print response
if response.startswith("250"): #250 is the code for a positive response from Tor
s.send("SIGNAL NEWNYM\r\n") #Use a new identity
s.close()
connectTor() #Just to make sure we're still connected to Tor
Whenever I run this I get the following error:
515 Authentication failed: Password did not match HashedControlPassword value from configuration. Maybe you tried a plain text password
I tried using the --hash-password option and pasting that in the place of the
AUTHENTICATE string, but that just caused the script to hang. Thoughts?
Answer: That error means that you set the HashedControlPassword option in your torrc.
I would suggest option for `CookieAuthentication 1` instead then using a
controller library rather than doing this from scratch.
What you're trying to do here (issue a NEWNYM) is a very, very common request
([1](http://stackoverflow.com/questions/17013707/how-can-i-change-my-tor-
process-endpoint-in-stem),
[2](http://stackoverflow.com/questions/16987518/how-to-request-new-tor-
identity-in-terminal)) so I just added a [FAQ
entry](https://stem.torproject.org/faq.html#how-do-i-request-a-new-identity-
from-tor) for it. Here's an example using
[stem](https://stem.torproject.org/)...
from stem import Signal
from stem.control import Controller
with Controller.from_port(port = 9051) as controller:
controller.authenticate()
controller.signal(Signal.NEWNYM)
|
Befuddling Python string index out of range error
Question: I looked through the other questions on this topic, but couldn't find
something that really addresses what I'm trying to figure out.
The problem is this: I'm trying to create a program that looks for palindromes
in two complementary strands of DNA, returning the position and length of each
palindrome identified.
For instance, if given the sequence TTGATATCTT, the program should find the
complement (AACTATAGAA), and then identify the second index as being the start
of a 6-character palindrome.
I'm brand new to programming, so it might look totally goofy, but the code I
came up with looks like this:
'''This first part imports the sequence (usually consisting of multiple lines of text)
from a file. I have a feeling there's an easier way of doing this, but I just don't
know what that would be.'''
length = 4
li = []
for line in open("C:/Python33/Stuff/Rosalind/rosalind_revp.txt"):
if line[0] != ">":
li.append(line)
seq = (''.join(li))
'''The complement() function takes the starting sequence and creates its complement'''
def complement(seq):
li = []
t = int(len(seq))
for i in range(0, t):
n = (seq[i])
if n == "A":
li.append(n.replace("A", "T"))
if n == "T":
li.append(n.replace("T", "A"))
if n == "C":
li.append(n.replace("C", "G"))
if n == "G":
li.append(n.replace("G", "C"))
answer = (''.join(li))
return(answer)
'''the ip() function goes letter by letter, testing to see if it matches with the letter
x spaces in front of it on the complementary strand(x being specified by length). If the
letter doesn't match, it continues to the next one. After checking all possibilities for
one length, the function runs again with the argument length+1.'''
def ip(length, seq):
n = 0
comp = complement(seq)
while length + n <= (len(seq)):
for i in range(0, length-1):
if seq[n + i] != comp[n + length - 1 - i]:
n += 1
break
if (n + i) > (n + length - 1 - i):
print(n + 1, length)
n += 1
if length <= 12:
ip(length + 1, seq)
ip(length, seq)
The thing runs absolutely perfectly when starting with short sequences
(TCAATGCATGCGGGTCTATATGCAT, for example), but with longer sequences, I
invariably get this error message:
Traceback (most recent call last):
File "C:/Python33/Stuff/Ongoing/palindrome.py", line 48, in <module>
ip(length, seq)
File "C:/Python33/Stuff/Ongoing/palindrome.py", line 39, in ip
if seq[n + i] != comp[n + length - 1 - i]:
IndexError: string index out of range
The message is given after the program finishes checking the possible
4-character palindromes, before starting the function for length + 1.
I understand what the message is saying, but I don't understand why I'm
getting it. Why would this work for some strings and not others? I've been
checking for the past hour to see if it makes a difference whether the
sequence has an odd number of characters or an even number of characters, is a
multiple of 4, is just shy of a multiple of 4, etc. I'm stumped. What am I
missing?
Any help would be appreciated.
P.S. The problem comes from the Rosalind Website (Rosalind.info), which uses
1-based numbering. Hence the print(n+1, length) at the end.
Answer: The`IndexError`can be avoided by changing the last line of:
if line[0] != ">":
li.append(line)
to
if line[0] != ">":
li.append(line.rstrip())
near the beginning of your code. This prevents any trailing whitespace,
especially newlines, read from the file from becoming part of the`seq`string.
Having them in it is a problem because the`complement()`function ignores and
thus removes them, so the`answer`string it returns isn't necessarily the same
length as the input argument. This causes `comp` and `seq` to not be the same
length in the in`ip()`function.
You didn't ask, but here's how I'd shorten your code and make it more
"Pythonic":
COMPLEMENT = str.maketrans("ATCG", "TAGC")
LENGTH = 4
with open("palindrome.txt") as input:
seq = ''.join(line.rstrip() for line in input if line[0] != ">")
def complement(seq): return seq.translate(COMPLEMENT)
def ip(length, seq):
n = 0
comp = complement(seq)
while length + n <= len(seq):
for i in range(0, length-1):
if seq[n + i] != comp[n + length - 1 - i]:
n += 1
break
if n + i > n + length - 1 - i:
print(n + 1, length)
n += 1
if length <= 12:
ip(length + 1, seq)
print(repr(seq))
print(repr(complement(seq)))
ip(LENGTH, seq)
BTW, those two `print()` function calls added near the end are what gave me
the clue about what was wrong.
|
Python "for" loop, division error
Question: I'm using python 2.7.3 When I try
a = [1,2,3,4]
b = []
for i in a:
b.append(1/i)
I'm getting an unexpected output as b = [1,0,0,0]. But if I print the value of
i loop works fine.
for i in a:
b.append(i)
will give b =[1, 2, 3, 4] What is the reason for this. Also how I can do the
same in correct way?
Answer: In python 2, `/` means integer divison when both operands are integers. Try
`1.0 / i`.
In [2]: 1 / 2
Out[2]: 0
In [3]: 1.0 / 2
Out[3]: 0.5
In [4]: 1 / 2.0
Out[4]: 0.5
To make the `/` operator behave like it does in python 3, use `from __future__
import division`:
In [11]: from __future__ import division
In [12]: 1 / 2
Out[12]: 0.5
|
Matching line number with string in a table.
Question: I have a file with a list of columns describing particular parameters:
size magnitude luminosity
I need only particular data (in particular lines, and columns) from this file.
So far I have a code in python, where I have appended the necessary line
numbers. I just need to know how i can match it to get the right string in the
text file along with just the variables in columns (magnitude) and
(luminosity.) Any suggestions on how I could approach this?
Here is a sample of my code (#comments describe what I have done and what I
want to do):
temp_ListMatch = (point[5]).strip()
if temp_ListMatch:
ListMatchaddress = (point[5]).strip()
ListMatchaddress = re.sub(r'\s', '_', ListMatchaddress)
ListMatch_dirname = '/projects/XRB_Web/apmanuel/499/Lists/' + ListMatchaddress
#print ListMatch_dirname+"\n"
try:
file5 = open(ListMatch_dirname, 'r')
except IOError:
print 'Cannot open: '+ListMatch_dirname
Optparline = []
for line in file5:
point5 = line.split()
j = int(point5[1])
Optparline.append(j)
#Basically file5 contains the line numbers I need,
#and I have appended these numbers to the variable j.
temp_others = (point[4]).strip()
if temp_others:
othersaddress = (point[4]).strip()
othersaddress =re.sub(r'\s', '_', othersaddress)
othersbase_dirname = '/projects/XRB_Web/apmanuel/499/Lists/' + othersaddress
try:
file6 = open(othersbase_dirname, 'r')
except IOError:
print 'Cannot open: '+othersbase_dirname
gmag = []
z = []
rh = []
gz = []
for line in file6:
point6 = line.split()
f = float(point6[2])
g = float(point6[4])
h = float(point6[6])
i = float(point6[9])
# So now I have opened file 6 where this list of data is, and have
# identified the columns of elements that I need.
# I only need the particular rows (provided by line number)
# with these elements chosen. That is where I'm stuck!
Answer: Load the whole data file in to a pandas DataFrame (assuming that the data file
has a header from which we can get the column names)
import pandas as pd
df = pd.read_csv('/path/to/file')
Load the file of line numbers into a pandas Series (assuming there's one per
line):
# squeeze = True makes the function return a series
row_numbers = pd.read_csv('/path/to/rows_file', squeeze = True)
Return only those lines which are in the row number file, and the columns
magnitude and luminosity (this assumes that the first row is numbered 0):
relevant_rows = df.ix[row_numbers][['magnitude', 'luminosity']
|
IndentationError in my python script
Question: my python version is 2.7.2, and my OS is win XP.
this is my script:
import sqlite3
import os
from flask import Flask, request, session, g, redirect, url_for, \
abort, render_template, flash
DATABASE = 'C:\Python27\flaskr.db'
DEBUG = True
SECRET_KEY = 'development key'
USERNAME = 'admin'
PASSWORD = 'default'
app = Flask(__name__)
app.config.from_object(__name__)
def connect_db(): return sqlie3.connect(app.config['DATABASE']
if __name__ == '__main__':
app.run()
The error came up when I was running it as a module with python shell.
if __name__ == '__main__':
app.run()
Right at the “：” is the place where the idle gave the error message that
there's a invalid syntax. But I can hardly find out any syntax error.
Answer: You have missed to close one parenthesis at:
def connect_db(): return sqlie3.connect(app.config['DATABASE']
It should be:
def connect_db(): return sqlie3.connect(app.config['DATABASE'])
And the reason it goes all the way to the `:` is that Python tries to
interpret this as a [conditional
expression](http://docs.python.org/2/reference/expressions.html#conditional-
expressions):
def connect_db(): return sqlie3.connect(app.config['DATABASE'] if __name__ == '__main__': ...
But because `:` cannot be a part of a valid [boolean
operation](http://docs.python.org/2/reference/expressions.html#boolean-
operations) it gives you this lovely syntax error.
|
How to speed up python starting up and/or reduce file search while loading libraries?
Question: I have a framework composed of different tools written in python in a multi-
user environment.
The first time I log to the system and start one command it takes 6 seconds
just to show a few line of help. If I immediately issue the same command again
it takes 0.1s. After a couple of minutes it gets back to 6s. (proof of short-
lived cache)
The system sits on a GPFS so disk throughput should be ok, though access might
be low because of the amount of files in the system.
strace -e open python tool | wc -l
shows 2154 files being accessed when starting the tool.
strace -e open python tool | grep ENOENT | wc -l
shows 1945 missing files being looked for. (A very bad hit/miss ratio is you
ask me :-)
I have a hunch that the excessive time involved in loading the tool is
consumed by querying the GPFS about all those files, and these are cached for
the next call (at either system or GPFS level), though I don't know how to
test/prove it. I have no root access to the system and I can only write to
GPFS and /tmp.
Is it possible to improve this `python quest for missing files`?
Any idea on how to test this in a simple way? (Reinstalling everything on /tmp
is not simple, as there are many packages involved, virtualenv will not help
either (I think), since it's just linking the files on the gpfs system).
An option would be of course to have a daemon that forks, but that's far from
"simple" and would be a last resort solution.
Thanks for reading.
Answer: Python 2 looks for modules as relative to the current package first. If your
library code has a lot of imports for a lot of top-level modules those are all
looked up as relative first. So, if package `foo.bar` import `os`, then Python
_first_ looks for `foo/bar/os.py`. This miss is cached by Python itself too.
In Python 3, the default has moved to absolute imports instead; you can switch
Python 2.5 and up to use absolute imports _per module_ with:
from __future__ import absolute_import
Another source of file lookup misses is loading `.pyc` bytecode cache files;
if those are missing for some reason (filesystem not writable for the current
Python process) then Python will continue to look for those on every run. You
can create these caches with the [`compileall`
module](http://docs.python.org/2/library/compileall.html):
python -m compileall /path/to/directory/with/pythoncode
provided you run that with the correct write permissions.
|
pack a software in Python using py2exe with 'libiomp5md.dll' not found
Question: I have Python 2.7 on Window 7 OS. I wish to pack my project.py in an
Executable using py2exe. Following the instruction i wrote a setup.py file
from distutils.core import setup
import py2exe
setup(console=["project.py"])
and I got this message
i tried to exclude '**libiomp5md.dll** '
from distutils.core import setup
import py2exe
setup(console=["SegmentationAccuracy.py"])
dll_excludes = ['libiomp5md.dll']
but always i got the same error message **"error: libiomo5md.dll: No such file
or directory"**
my executable contains:
import math
import os
import numpy as np
import sys
import ogr
from progressbar import ProgressBar
from shapely.geometry import Polygon
nan = np.nan
Answer: I had the same problem, but calling `import numpy` within `setup.py` resolved
the issue
|
Calculating the Fisher criterion in Python
Question: Is there a python module that when given two vectors x and y, where y is a
two-class (0,1), it calculates the Fisher criterion, as shown in the formula
here <http://compbio.soe.ucsc.edu/genex/genexTR2html/node12.html>
Please note that I am not looking to apply Fisher's linear discriminant, only
the Fisher criterion :).
Thanks in advance!
Answer: Not as far as I can tell, but you could write your own (please test that this
result is correct, I'm only going by my understanding of the formula).
import numpy as np
def fisher_criterion(v1, v2):
return abs(np.mean(v1) - np.mean(v2)) / (np.var(v1) + np.var(v2))
Which gives, for example,
>>> fisher_criterion([0, 1, 2], [0, 1])
0.54545454545454553
|
saving constructor arguments automatically
Question: Frequently the constructor of a class will take it's arguments and save them
on the instance. For example:
class Example(object):
def __init__(self, title='',backtitle='', height=20, width=50):
self.title = title
self.backtitle = backtitle
self.height = height
self.width = width
This is repetitious so I made a helper function to do this automatically:
from inspect import getargspec
def save_args(values):
for i in getargspec(values['self'].__init__).args[1:]:
values['self'].__dict__[i] = values[i]
class Example(object):
def __init__(self, title='',backtitle='', height=20, width=50):
save_args(vars())
My questions are as follows:
* Will this fail with certain classes or agruments
* Is it portable, will it work on Jython, etc.. It worked for me on python 2.7 and 3.2
* Is there a simpler alternative?
* Is there a python package out there that already does this?
Answer: It'll fail when your class uses
[`__slots__`](http://docs.python.org/3/reference/datamodel.html#slots). You
could use
[`setattr()`](http://docs.python.org/3/library/functions.html#setattr)
instead:
from inspect import getargspec
def save_args(values):
for i in getargspec(values['self'].__init__).args[1:]:
setattr(values['self'], i, values[i])
provided the arguments keyword arguments to `__init__` are all declared slots
of course.
Otherwise this should work on any Python implementation.
You may be interested in a [previous discussion of the
topic](http://stackoverflow.com/q/1389180), which sparked a [Python-ideas list
thread](http://mail.python.org/pipermail/python-
ideas/2011-April/thread.html#9930).
|
Bluetooth communication between Arduino and PyBluez
Question: I am trying to establish bluetooth communication between an Arduino Uno board
(with a bluetooth shield) and my Linux OS, using Python PyBluez.
I've successfully paired my laptop to the Uno. I'm able to connect to the
board, however the board is not reading the data being sent nor is it able to
send data.
Here is the Arduino Sketch
#include <SoftwareSerial.h>
#define RxD 0 //receive data on digital 0
#define TxD 1 //transmit on digital 1
SoftwareSerial blueToothSerial(RxD, TxD);
int counter = 0;
int incoming;
void setup(void){
Serial.begin(9600);
//pinMode(RxD,INPUT);
//pinMode(TxD,OUTPUT);
setupBlueToothConnection();
}
void setupBlueToothConnection(){
blueToothSerial.begin(19200);
blueToothSerial.print("\r\n+STWMOD=0\r\n"); //set the bluetooth work in slave mode
blueToothSerial.print("\r\n+STNA=SeeedBTSlave\r\n"); //set the bluetooth name as "SeeedBTSlave"
blueToothSerial.print("\r\n+STOAUT=1\r\n"); // Permit Paired device to connect me
//blueToothSerial.print("\r\n+STAUTO=0\r\n"); // Auto-connection should be forbidden here
delay(2000); // This delay is required.
blueToothSerial.print("\r\n+INQ=1\r\n"); //make the slave bluetooth inquirable
Serial.println("The slave bluetooth is inquirable!");
delay(2000); // This delay is required.
blueToothSerial.flush();
}
void loop(){
if(blueToothSerial.available())
Serial.println(blueToothSerial.read());
blueToothSerial.write('x');
}
And my Python Module:
import bluetooth
import sys
bd_addr = "00:12:10:23:10:18" #itade address
port = 1
sock=bluetooth.BluetoothSocket( bluetooth.RFCOMM )
sock.connect((bd_addr, port))
print 'Connected'
sock.settimeout(1.0)
sock.send("x")
print 'Sent data'
data = sock.recv(1)
print 'received [%s]'%data
sock.close()
I have Arduino IDE 1.0.4, my laptop is running Ubuntu 11.10
Answer: Using the Itade Studio Bluetooth Shield, you have to upload the code without
the shield attached, and then attach the shield. I'm curious if this is so
with other bluetooth units.
For the sake of completion, to establish communication between your laptop and
Arduino Uno w/BT shield:
1. Pair your laptop with the bluetooth shield
2. Upload Arduino code with shield detached.
3. Attach the shield
4. Run python module.
On the itade shield, you know when connection is established when the D1 led
turns solid green, as oppose to flickering green.
|
Python: TypeError: an integer is required
Question: I am trying to get the md5 checksum of some files and write them into a temp
file.
import os
import hashlib
PID = str(os.getpid())
manifest = open('/temp/tmp/MANIFEST.'+ PID + '.tmp','w') #e.g. MANIFEST.48938.tmp
for elmt in files_input:
input = open(elmt['file'], "r", 'us-ascii') #'us-ascii' when I ran "file --mime"
manifest.write(hashlib.md5(input.read()).hexdigest())
From this I get a Python error that I haven't able to resolve:
Traceback (most recent call last):
File "etpatch.py", line 131, in <module>
input = open(elmt['file'], "r", 'us-ascii')
TypeError: an integer is required
Some people have had this error from doing "from os import *" but I am not
doing this nor am I using import * on any other module.
Answer: The third argument to
[`open()`](http://docs.python.org/2/library/functions.html#open) is expected
to be an integer:
>
> open(name[, mode[, buffering]])
>
>
> The optional buffering argument specifies the file’s desired buffer size: 0
> means unbuffered, 1 means line buffered, any other positive value means use
> a buffer of (approximately) that size (in bytes). A negative buffering means
> to use the system default, which is usually line buffered for tty devices
> and fully buffered for other files. If omitted, the system default is used.
> [2]
|
multi-threading of a matrix multiplication in python
Question: I want to create n threads and that each thread computes an entire row of the
result matrix. I have tried the following code,
import numpy
import random
import threading
class MatrixMult(threading.Thread):
"""A thread which computes the i,j entry of A * B"""
def __init__(self, A, B, i):
super(MatrixMult, self).__init__()
self.A = A
self.B = B
self.i = i
#self.j = j
def run(self):
print "Computing %i, %i" % (self.i, self.i)
x = 0
result=[]
for k in range(self.A.shape[0])
x += self.A[self.i,k] * self.B[k,self.i
self.result=x
print "Completed %i, %i" % (self.i, self.j)
def mult(n):
"""A function to randomly create two n x n matrices and multiply them"""
# Create two random matrices
A = numpy.zeros((n,n))
B = numpy.zeros((n,n))
for i in range(n):
for j in range(n):
A[i,j] = random.randrange(0, 100)
B[i,j] = random.randrange(0, 100)
# Create and start the threads
threads = []
for i in range(n):
# for j in range(n):
t = MatrixMult(A, B, i)
threads.append(t)
t.start()
for t in threads: t.join()
C = numpy.zeros((n,n))
for t in threads:
C[t.i] = t.result
return C
print multi(30)
however it prints out many weird matrices:
[ 66695. 66695. 66695. 66695. 66695. 66695. 66695. 66695. 66695.
66695. 66695. 66695. 66695. 66695. 66695. 66695. 66695. 66695.
66695. 66695. 66695. 66695. 66695. 66695. 66695. 66695. 66695.
66695. 66695. 66695.]
[ 88468. 88468. 88468. 88468. 88468. 88468. 88468. 88468. 88468.
88468. 88468. 88468. 88468. 88468. 88468. 88468. 88468. 88468.
88468. 88468. 88468. 88468. 88468. 88468. 88468. 88468. 88468.
88468. 88468. 88468.]]
anyone see a problem in my code? I don't see what i am doing wrong.
Answer: Your code sets
C[t.i] = t.result
which sets an entire row of `C` to the value `t.result`, which is a scalar. I
see some commented stuff about `j` in there; you presumably want to account
for that, and also fix
x += self.A[self.i,k] * self.B[k,self.i
to use `j` (and also not be a syntax error). As-is, it seems like you're
computing `C[i, i]` and then assigning that value to the whole row.
Also: you know this code is guaranteed to be much, much, much slower than
`np.dot`, right? Between doing tight loops in python, distributing
computational work across threads despite the
[GIL](http://wiki.python.org/moin/GlobalInterpreterLock), and also being [an
inefficient algorithm for matrix
multiplication](http://en.wikipedia.org/wiki/Matrix_multiplication#Algorithms_for_efficient_matrix_multiplication)
in the first place. If your goal is actually to speed up matrix multiplies
using multiple cores, link your numpy to MKL, OpenBLAS, or ACML, use `np.dot`,
and call it a day.
|
quickfix : how to get Symbol ( flag 55 ) from messages?
Question: I'm running QuickFix with the Python API and connecting to a TT FIX Adapter
using FIX4.2
I am logging on and sending a market data request for two instruments. That
works fine and data from the instruments comes in as expected. I can get all
kinds of information from the messages.
However, I am having trouble getting the Symbol (flag 55) field.
import quickfix as fix
def fromApp(self, message, sessionID):
ID = fix.Symbol()
message.getField(ID)
print ID
This works for the very first message [the initial Market Data Snapshot (flag
35 = W)] that comes to me. Once I start getting incremental refreshes (flag 35
= X), I can no longer get the Symbol field. Every message that arrives results
in a Field Not Found error.
This is confusing me because in the logs, the Symbol field is always present,
whether the message type is W or X.
Thinking the Symbol is in the header of refresh messages, I tried
`get.Field(ID)` when 35 = W and `get.Header().getField(ID)` when 35 = X,
however this did not work.
Can somebody help me figure out what is going on here? I would like to be able
to explicitly tell my computer what instruments it is looking at.
Thanks
Answer: Your question is pretty simple, but you've mixed in some misconceptions as
well.
1) Symbol will **never** be in the header. It is a body field.
2) In X messages, the symbol is in a repeating group. You first have to get a
group object with `msg.GetGroup()`, then get the symbol from _that_. See [this
example
code](http://quickfixengine.org/quickfix/doc/html/python/repeating_groups_2.html),
from the [repeating groups doc
page](http://quickfixengine.org/quickfix/doc/html/repeating_groups.html).
3) In W messages, the symbol is not in a group. That's why it works for you
there.
It seems clear you are pretty new to QuickFIX and FIX in general. I think you
should take few minutes and skim through the "Working with Messages" section
of [the docs](http://quickfixengine.org/quickfix/doc/html/).
Also, the [FIXimate](http://fixprotocol.org/FIXimate3.0/) website can be your
best friend.
|
Python: cut equivalent in Python?
Question: I want to parse a path (not filename) by the forward slash. Below takes the
full path "filename" and reads up to the 7th "/".
**EDIT: I realized the above was confusing when I stated filename. I meant, I
needed to parse the full path. e.g. I could need the first 7 "/"s to the left
and remove 5 trailing "/"s.**
Python:
"/".join(filename.split("/")[:7])
Bash:
some command that prints filename | cut -d'/' -f1-7`
It looks so much cleaner with the cut tool. Is there a better/ more efficient
way to write this in Python?
Answer: Usually I would recommend using functions from the
[`os.path`](http://docs.python.org/3/library/os.path.html) module for handling
paths. I prefer to let the library handle all of the edge cases that can occur
with valid paths.
As was you pointed out in the comments,
[`os.path.split()`](http://docs.python.org/3/library/os.path.html#os.path.split)
splits just the last path element. To use it, one could write:
l = []
while True:
head, tail = os.path.split(filename)
l.insert(0, tail)
if head == "/":
l.insert(0, "")
break
filename = head
"/".join(l[:7])
Although more verbose, this will correctly normalize artifacts such as
duplicate slashes.
On the other hand, your use of `string.split()` matches the semantics of
`cut(1)`.
* * *
Sample test cases:
$ echo '/a/b/c/d/e/f/g/h' | cut -d'/' -f1-7
/a/b/c/d/e/f
$ echo '/a/b/c/d/e/f/g/h/' | cut -d'/' -f1-7
/a/b/c/d/e/f
$ echo '/a//b///c/d/e/f/g/h' | cut -d'/' -f1-7
/a//b///c
* * *
# Tests and comparison to string.split()
import os.path
def cut_path(filename):
l = []
while True:
head, tail = os.path.split(filename)
l.insert(0, tail)
if head == "/":
l.insert(0, "")
break
filename = head
return "/".join(l[:7])
def cut_string(filename):
return "/".join( filename.split("/")[:7] )
def test(filename):
print("input:", filename)
print("string.split:", cut_string(filename))
print("os.path.split:", cut_path(filename))
print()
test("/a/b/c/d/e/f/g/h")
test("/a/b/c/d/e/f/g/h/")
test("/a//b///c/d/e/f/g/h")
# input: /a/b/c/d/e/f/g/h
# string.split: /a/b/c/d/e/f
# os.path.split: /a/b/c/d/e/f
#
# input: /a/b/c/d/e/f/g/h/
# string.split: /a/b/c/d/e/f
# os.path.split: /a/b/c/d/e/f
#
# input: /a//b///c/d/e/f/g/h
# string.split: /a//b///c
# os.path.split: /a/b/c/d/e/f
|
Python not displaying simplified Chinese properly in dos window
Question: I have a python script that prints chinese output on command line. It works
fine in eclipse. However, when I run it in dos window, it prints ? (question
marks) and garbage characters. Could it be because of big-5 vs gb encoding? if
so, how do I control it?
btw, I already installed the Asian character sets, which is why it works in
Eclipse
edit:combining chcp, encode('utf-8'), and setting the non-unicode handler, I
can now see the character, but a simple print results in a exception:
chcp 65001
Active code page: 65001
Z:\src>c:\Python27\python.exe mobTest.py
Traceback (most recent call last):
File "mobTest.py", line 94, in <module>
print u'哈哈'.encode('utf-8')
IOError: [Errno 13] Permission denied
Answer: What is your system locale? `English (United States)`, for example, uses code
page 437 for the console, which doesn't support Chinese characters. `Chinese
(Simplified, PRC)` makes it possible to print Chinese to the console.
You can change the setting in `Region and Language` in Control Panel (Windows
7), `Administrative` tab and rebooting. After that, printing a _Unicode_
Chinese string to the console will work. You can even type in Chinese as an
IME will be available.
Changing the system locale will only affect the console and non-Unicode
programs. Most modern programs won't notice.
**Edit** : Example using Chinese PRC region and running in the Windows
console:
Python 2.7.3 (default, Apr 10 2012, 23:24:47) [MSC v.1500 64 bit (AMD64)] on win32
Type "help", "copyright", "credits" or "license" for more information.
>>> print u'哈哈'
哈哈
>>> import sys
>>> sys.stdout.encoding
'cp936'
Example script using UTF-8 source encoding. Make sure to _save_ the source in
UTF-8, as declared by the `#coding` comment:
# coding: utf-8
print u'哈哈'
print '哈哈' # this will be UTF-8 encoded, and NOT work
Execution:
C:\>python x.py
哈哈
鍝堝搱
|
Producing PDFs in landscape orientation with ReportLab
Question: I am working on a Python script that produces a PDF report using ReportLab. I
need to produce the pages in landscape orientation and I have already looked
through the ReportLab manual but I can't find a way of doing this. Any ideas
or suggestions?
Answer: Make sure you've imported
from reportlab.lib.pagesizes import letter, landscape
And then:
canvas.setPageSize(landscape(letter))
Or more generally,
canvas.setPageSize(width, height)
and you can set it to be any size you like. Remember reportlab uses points,
where 1 point is 1/72 of an inch. You can also import:
from reportlab.lib.units import inch
Which lets you do things like:
canvas.setPageSize(11*inch, 8.5*inch)
EDIT: Added all the built in page sizes inspired by yentsun.
Diving into the `reportlab.lib.pagesizes` source code, we find in all:
A0,A1,A2,A3,A4,A5,A6
B0,B1,B2,B3,B4,B5,B6
LETTER, LEGAL, ELEVENSEVENTEEN
The comments claims that the lowercase `letter` has been deprecated since
2001, but is still available. Additionally, two functions are avaialable,
`portrait` and `landscape` that each take in a tuple pagesize, and portrait
returns the tuple with the smaller dimension first, and landscape returns the
tuple with the larger dimension first.
|
Is it possible to call a C Function by reference from python??
Question: I am a beginner in python and I need to test a C function which is being
called by reference.
Here is my C File : myfile.c
#include<stdio.h>
int my_function(int *x)
{
int A;
printf("enter value of A");
scanf("%d",&A);
*x = 10 * A; // this sets the value to the address x is referencing to
return 0;
}
now, my python script should call my_function() and pass the argument so that
I can check and verify the result.
something like :
`result = self.loaded_class.my_function(addressOf(some_variable))`
`self.assertEqual(some_variable,10)`
Is this possible ?? how can i achieve this. And I am writing scripts in python
for auto tests , not using interactive python.
Answer: If you compile your file as a shared library or dll (I don't know how to do
that), you can use [ctypes](http://docs.python.org/2/library/ctypes.html) like
this (assuming it's a dll for this example):
import ctypes as ct
mylib = ct.cdll.myfile
c_int = ct.c_int(0)
mylib.my_function(ct.byref(c_int))
print c_int.value
|
PyQt4-PySide - Formatting a table widget
Question: In the following code, I would like to use thicker rule separator between the
column 2 and 3 for example. How can I achieve this ?
#! /usr/bin/env python2.7
# -*- coding: utf-8 -*-
import sys
from PySide import QtCore, QtGui
class MainWindow(QtGui.QWidget):
def __init__(
self,
parent = None
):
super(MainWindow, self).__init__(parent)
# General grid
self.table = QtGui.QTableWidget(self)
self.nbrow, self.nbcol = 9, 9
self.table.setRowCount(self.nbrow)
self.table.setColumnCount(self.nbcol)
# Each cell has dimension 50 pixels x 50 pixels
for row in range(0, self.nbrow):
self.table.setRowHeight(row, 50)
for col in range(0, self.nbcol):
self.table.setColumnWidth(col, 50)
# Each cell contains one single QTableWidgetItem
for row in range(0, self.nbrow):
for col in range(0, self.nbcol):
item = QtGui.QTableWidgetItem()
item.setTextAlignment(
QtCore.Qt.AlignHCenter | QtCore.Qt.AlignVCenter
)
self.table.setItem(row, col, item)
# Header formatting
font = QtGui.QFont()
font.setFamily(u"DejaVu Sans")
font.setPointSize(12)
self.table.horizontalHeader().setFont(font)
self.table.verticalHeader().setFont(font)
# Font used
font = QtGui.QFont()
font.setFamily(u"DejaVu Sans")
font.setPointSize(20)
self.table.setFont(font)
# Global Size
self.resize(60*9, 60*9 + 20)
# Layout of the table
layout = QtGui.QGridLayout()
layout.addWidget(self.table, 0, 0)
self.setLayout(layout)
# Set the focus in the first cell
self.table.setFocus()
self.table.setCurrentCell(0, 0)
if __name__ == "__main__":
app = QtGui.QApplication(sys.argv)
fen = MainWindow()
fen.show()
sys.exit(app.exec_())
Answer: You can use stylesheets to change the style of the cell borders. See examples:
* <http://www.qtcentre.org/threads/27195-Border-around-selected-cell-in-qtablewidget>
* [Set QTableWidget cell's borders to 0px](http://stackoverflow.com/questions/7341007/set-qtablewidget-cells-borders-to-0px)
|
Maximum value of first column
Question: I have an array like this:
elements=[['1', '1', '2'], ['2', '2', '3'], ['3', '3', '4'], ['4', '4', '5'], ['5', '5', '6'], ['6', '6', '7'], ['7', '7', '8'], ['8', '8', '9'], ['9', '9', '10'], ['10', '10', '11'], ['11', '11', '12'], ['12', '12', '13'], ['13', '13', '14'], ['14', '14', '15'], ['15', '15', '16'], ['16', '16', '17'], ['17', '17', '18'], ['18', '18', '19'], ['19', '19', '20'], ['20', '20', '21'], ['21', '21', '22'], ['22', '22', '23'], ['23', '23', '24'], ['24', '24', '25'], ['25', '25', '26'], ['26', '26', '27'], ['27', '27', '28'], ['28', '28', '29'], ['29', '29', '30'], ['30', '30', '31'], ['31', '32', '33'], ['32', '33', '34'], ['33', '34', '35'], ['34', '35', '36'], ['35', '36', '37'], ['36', '37', '38'], ['37', '38', '39'], ['38', '39', '40'], ['39', '40', '41'], ['40', '41', '42'], ['41', '42', '43'], ['42', '43', '44'], ['43', '44', '45'], ['44', '45', '46'], ['45', '46', '47'], ['46', '47', '48'], ['47', '48', '49'], ['48', '49', '50'], ['49', '50', '51'], ['50', '51', '52'], ['51', '52', '53'], ['52', '53', '54'], ['53', '54', '55'], ['54', '55', '56'], ['55', '56', '57'], ['56', '57', '58'], ['57', '58', '59'], ['58', '59', '60'], ['59', '60', '61'], ['60', '61', '62'], ['61', '63', '64'], ['62', '64', '65'], ['63', '65', '66'], ['64', '66', '67'], ['65', '67', '68'], ['66', '68', '69'], ['67', '69', '70'], ['68', '70', '71'], ['69', '71', '72'], ['70', '72', '73'], ['71', '73', '74'], ['72', '74', '75'], ['73', '75', '76'], ['74', '76', '77'], ['75', '77', '78'], ['76', '78', '79'], ['77', '79', '80'], ['78', '80', '81'], ['79', '81', '82'], ['80', '82', '83'], ['81', '83', '84'], ['82', '84', '85'], ['83', '85', '86'], ['84', '86', '87'], ['85', '87', '88'], ['86', '88', '89'], ['87', '89', '90'], ['88', '90', '91'], ['89', '91', '92'], ['90', '92', '93'], ['91', '94', '95'], ['92', '95', '96'], ['93', '96', '97'], ['94', '97', '98'], ['95', '98', '99'], ['96', '99', '100'], ['97', '100', '101'], ['98', '101', '102'], ['99', '102', '103'], ['100', '103', '104'], ['101', '104', '105'], ['102', '105', '106'], ['103', '106', '107'], ['104', '107', '108'], ['105', '108', '109'], ['106', '109', '110'], ['107', '110', '111'], ['108', '111', '112'], ['109', '112', '113'], ['110', '113', '114'], ['111', '114', '115'], ['112', '115', '116'], ['113', '116', '117'], ['114', '117', '118'], ['115', '118', '119'], ['116', '119', '120'], ['117', '120', '121'], ['118', '121', '122'], ['119', '122', '123'], ['120', '123', '124'], ['121', '125', '126'], ['122', '126', '127'], ['123', '127', '128'], ['124', '128', '129'], ['125', '129', '130'], ['126', '130', '131'], ['127', '131', '132'], ['128', '132', '133'], ['129', '133', '134'], ['130', '134', '135'], ['131', '135', '136'], ['132', '136', '137'], ['133', '137', '138'], ['134', '138', '139'], ['135', '139', '140'], ['136', '141', '142'], ['137', '142', '143'], ['138', '143', '144'], ['139', '144', '145'], ['140', '145', '146'], ['141', '146', '147'], ['142', '147', '148'], ['143', '148', '149'], ['144', '149', '150'], ['145', '150', '151'], ['146', '151', '152'], ['147', '152', '153'], ['148', '153', '154'], ['149', '154', '155'], ['150', '155', '156'], ['151', '157', '158'], ['152', '158', '159'], ['153', '159', '160'], ['154', '160', '161'], ['155', '161', '162'], ['156', '162', '163'], ['157', '163', '164'], ['158', '164', '165'], ['159', '165', '166'], ['160', '166', '167'], ['161', '167', '168'], ['162', '168', '169'], ['163', '169', '170'], ['164', '170', '171'], ['165', '171', '172'], ['166', '172', '173'], ['167', '173', '174'], ['168', '174', '175'], ['169', '175', '176'], ['170', '176', '177'], ['171', '177', '178'], ['172', '178', '179'], ['173', '179', '180'], ['174', '180', '181'], ['175', '181', '182'], ['176', '182', '183'], ['177', '183', '184'], ['178', '184', '185'], ['179', '185', '186'], ['180', '186', '187'], ['181', '188', '189'], ['182', '189', '190'], ['183', '190', '191'], ['184', '191', '192'], ['185', '192', '193'], ['186', '193', '194'], ['187', '194', '195'], ['188', '195', '196'], ['189', '196', '197'], ['190', '197', '198'], ['191', '198', '199'], ['192', '199', '200'], ['193', '200', '201'], ['194', '201', '202'], ['195', '202', '203'], ['196', '203', '204'], ['197', '204', '205'], ['198', '205', '206'], ['199', '206', '207'], ['200', '207', '208'], ['201', '208', '209'], ['202', '209', '210'], ['203', '210', '211'], ['204', '211', '212'], ['205', '212', '213'], ['206', '213', '214'], ['207', '214', '215'], ['208', '215', '216'], ['209', '216', '217'], ['210', '217', '218'], ['211', '219', '220'], ['212', '220', '221'], ['213', '221', '222'], ['214', '222', '223'], ['215', '223', '224'], ['216', '224', '225'], ['217', '225', '226'], ['218', '226', '227'], ['219', '227', '228'], ['220', '228', '229'], ['221', '229', '230'], ['222', '230', '231'], ['223', '231', '232'], ['224', '232', '233'], ['225', '233', '234'], ['226', '235', '236'], ['227', '236', '237'], ['228', '237', '238'], ['229', '238', '239'], ['230', '239', '240'], ['231', '240', '241'], ['232', '241', '242'], ['233', '242', '243'], ['234', '243', '244'], ['235', '244', '245'], ['236', '245', '246'], ['237', '246', '247'], ['238', '247', '248'], ['239', '248', '249'], ['240', '249', '250'], ['241', '251', '252'], ['242', '252', '253'], ['243', '253', '254'], ['244', '254', '255'], ['245', '255', '256'], ['246', '256', '257'], ['247', '257', '258'], ['248', '258', '259'], ['249', '259', '260'], ['250', '260', '261'], ['251', '261', '262'], ['252', '262', '263'], ['253', '263', '264'], ['254', '264', '265'], ['255', '265', '266'], ['256', '267', '268'], ['257', '268', '269'], ['258', '269', '270'], ['259', '270', '271'], ['260', '271', '272'], ['261', '272', '273'], ['262', '273', '274'], ['263', '274', '275'], ['264', '275', '276'], ['265', '276', '277'], ['266', '277', '278'], ['267', '278', '279'], ['268', '279', '280'], ['269', '280', '281'], ['270', '281', '282'], ['271', '283', '284'], ['272', '284', '285'], ['273', '285', '286'], ['274', '286', '287'], ['275', '287', '288'], ['276', '288', '289'], ['277', '289', '290'], ['278', '290', '291'], ['279', '291', '292'], ['280', '292', '293'], ['281', '293', '294'], ['282', '294', '295'], ['283', '295', '296'], ['284', '296', '297'], ['285', '297', '298'], ['286', '298', '299'], ['287', '299', '300'], ['288', '300', '301'], ['289', '301', '302'], ['290', '302', '303'], ['291', '303', '304'], ['292', '304', '305'], ['293', '305', '306'], ['294', '306', '307'], ['295', '307', '308'], ['296', '308', '309'], ['297', '309', '310'], ['298', '310', '311'], ['299', '311', '312'], ['300', '312', '313'], ['301', '314', '315'], ['302', '315', '316'], ['303', '316', '317'], ['304', '317', '318'], ['305', '318', '319'], ['306', '319', '320'], ['307', '320', '321'], ['308', '321', '322'], ['309', '322', '323'], ['310', '323', '324'], ['311', '324', '325'], ['312', '325', '326'], ['313', '326', '327'], ['314', '327', '328'], ['315', '328', '329'], ['316', '329', '330'], ['317', '330', '331'], ['318', '331', '332'], ['319', '332', '333'], ['320', '333', '334'], ['321', '334', '335'], ['322', '335', '336'], ['323', '336', '337'], ['324', '337', '338'], ['325', '338', '339'], ['326', '339', '340'], ['327', '340', '341'], ['328', '341', '342'], ['329', '342', '343'], ['330', '343', '344'], ['331', '345', '346'], ['332', '346', '347'], ['333', '347', '348'], ['334', '348', '349'], ['335', '349', '350'], ['336', '350', '351'], ['337', '351', '352'], ['338', '352', '353'], ['339', '353', '354'], ['340', '354', '355'], ['341', '355', '356'], ['342', '356', '357'], ['343', '357', '358'], ['344', '358', '359'], ['345', '359', '360'], ['346', '361', '362'], ['347', '362', '363'], ['348', '363', '364'], ['349', '364', '365'], ['350', '365', '366'], ['351', '366', '367'], ['352', '367', '368'], ['353', '368', '369'], ['354', '369', '370'], ['355', '370', '371'], ['356', '371', '372'], ['357', '372', '373'], ['358', '373', '374'], ['359', '374', '375'], ['360', '375', '376']]
I'd like to know the maximum value of the first column of this array. However
I've found that problematic since I'm not used to python.
I've tried:
import numpy as np
a = np.array(elements)
numEL = a[np.argmax(a)][0]
but I get a wrong result. I know it is 360 but it returns 285...
Any ideas?
Answer: Your elements are strings, and therefore the comparisons are lexicographic.
You want to work with integers:
>>> elements=[['1', '1', '2'], ['99', '2', '3'],['360', '10', '11']]
>>> a = np.array(elements,dtype=int)
>>> a
array([[ 1, 1, 2],
[ 99, 2, 3],
[360, 10, 11]])
>>> a.max(axis=0)
array([360, 10, 11])
>>> a.max(axis=0)[0]
360
or simply
>>> a[:,0]
array([ 1, 99, 360])
>>> a[:,0].max()
360
[Note: this is how to get it to work. As for why the code was returning a
strange answer in the first place, @mgilson explains that in the comments to
this answer.]
|
Python is printing everything form module when imported into another module
Question: I have a 2 files.
1. `funcattrib.py`
2. `test_import.py`
**funcattrib.py**
import sys
def sum(a,b=5):
"Adds two numbers"
a = int(a)
b = int(b)
return a+b
sum.version = "1.0"
sum.author = "Prasad"
k = sum(1,2)
print(k)
print("Function attributes: - ")
print("Documentation string:",sum.__doc__)
print("Function name:",sum.__name__)
print("Default values:",sum.__defaults__)
print("Code object for the function is:",sum.__code__)
print("Dictionary of the function is:",sum.__dict__)
#writing the same information to a file
f = open('test.txt','w')
f.write(sum.__doc__)
f.close()
print("\n\nthe file is successfully written with the documentation string")
**test_import.py**
import sys
from funcattrib import sum
input("press <enter> to continue")
a = input("Enter a:")
b = input("Enter b:")
f = open('test.txt','a')
matter_tuple = "Entered numbers are",a,b
print(matter_tuple)
print("Type of matter:",type(matter_tuple))
matter_list = list(matter_tuple)
print(list(matter_list))
finalmatter = " ".join(matter_list)
print(finalmatter)
f.write(finalmatter)
f.close()
print("\n\nwriting done successfully from test_import.py")
I imported `sum` function from `funcattrib.py`. when I try to execute
test_import.py, I am seeing the output of the whole `funcattrib.py`. I just
wanted to use the `sum` function.
Please advise, what wrong I am doing, or is there another way of importing
module without actually executing it?
Answer: All statements in the 'top level' of a module are executed when imported.
You you _don't_ want that to happen, you need to distinguish between the
module being used as a script and a module. Use the following test for that:
if __name__ == '__main__':
# put code here to be run when this file is executed as a script
Applying that to your module:
import sys
def sum(a,b=5):
"Adds two numbers"
a = int(a)
b = int(b)
return a+b
sum.version = "1.0"
sum.author = "Prasad"
if __name__ == '__main__':
k = sum(1,2)
print(k)
print("Function attributes: - ")
print("Documentation string:",sum.__doc__)
print("Function name:",sum.__name__)
print("Default values:",sum.__defaults__)
print("Code object for the function is:",sum.__code__)
print("Dictionary of the function is:",sum.__dict__)
#writing the same information to a file
f = open('test.txt','w')
f.write(sum.__doc__)
f.close()
print("\n\nthe file is successfully written with the documentation string")
|
DistributionNotFound error after upgrading pip
Question: In reading about virtualenv
[here](http://www.virtualenv.org/en/latest/index.html) I realized I didn't
have pip 1.3+, so I ran `pip install --upgrade pip` and now when I run `pip
--version` i get the following:
Traceback (most recent call last):
File "/usr/local/bin/pip", line 5, in <module>
from pkg_resources import load_entry_point
File "/usr/local/Cellar/python/2.7.3/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/distribute-0.6.34-py2.7.egg/pkg_resources.py", line 2807, in <module>
parse_requirements(__requires__), Environment()
File "/usr/local/Cellar/python/2.7.3/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/distribute-0.6.34-py2.7.egg/pkg_resources.py", line 594, in resolve
raise DistributionNotFound(req)
pkg_resources.DistributionNotFound: pip==1.2.1
If it helps, or is at all relevant, my `$PATH` looks like this:
/usr/local/bin:/usr/local/share/python:/usr/bin:/bin:/usr/sbin:/sbin:/usr/local/bin:/usr/local/git/bin
Also, `which pip` gives me `/usr/local/bin/pip`.
Not sure what to do about the error. Thanks.
Answer: ### The brutal way:
Assuming you are using homebrew for Mac (because I see /usr/local/Cellar), I
suggest to
* remove (or backup) `/usr/local/lib/python2.7`, and
* `brew rm python && brew install python`.
This will definitely install pip 1.3.3 alongside of python. Your distribute
will also be 0.6.35.
### The soft way:
From `/usr/local/lib/python2.7/site-packages` just remove:
* `easy-install.pth`
* `pip-1.2.1-py2.7.egg` _or other versions of pip you have._
* `distribute-0.6.34-py2.7.egg` _or other versions_
Then, `brew rm python && brew install python`. This will leave all your other
bindings from brew and installed stuff intact. Python, pip and distribute will
be replaced with up-to-date versions.
### additionally:
Please check that you don't have a distribute or setuptools or pip located in
`/Library/Python/2.7/site-packages`. That dir is re-used by all python 2.7
versions (brewed or from OS X) and will interferre with the pip/distribute
already installed by Homebrew.
|
openssl not decrypted files encrypted by pycrypto
Question: i encrypt file in python:
from Crypto.Cipher import AES
from Crypto import Random
key = Random.new().read(16)
iv = Random.new().read(AES.block_size)
encryptor = AES.new(key, AES.MODE_CBC, iv)
with open(in_file, 'rb') as fin, open(out_file, 'wb') as fout:
fout.write(iv)
while True:
chunk = fin.read(16*1024)
if len(chunk) == 0:
break
elif len(chunk) % 16 != 0:
chunk += b' ' * (16 - len(chunk) % 16)
fout.write(encryptor.encrypt(chunk)
print base64.b32encode(key)
but when after what i try decrypt it with openssl: `openssl aes-256-cbc -d -in
enc -out new.zip` it returns bag magic number what i doing wrong?
Answer: Program is using 128 bit AES key for encryption, as seen from the line:
key = Random.new().read(16)
So, instead of using
openssl aes-256-cbc -d -in enc -out new.zip
use this
openssl aes-128-cbc -d -in enc -out new.zip
|
Include bash script in python compilation
Question: I have a couple of bash scripts that I use in a Python program. The current
solution is to browse to the file in the GUI and then run the script(s) like
this (`pathToScript` is the String for the path to the script):
INPUT = [pathToScript, input1, input2, input3, input4, input5, input6, input7, input8, input9, input10]
subprocess.call(INPUT)
To avoid always browsing to the script or hard coding the path, I am looking
for a solution to somehow include the bash script in the compiled Python
program and then run it inside the program. Is this possible? I'd rather not
rewrite the bash scripts to Python if I can avoid it.
Answer: You can always bundle the bash script with the rest of your program (like I
suspect you are already doing), and reconstruct the path to these scripts at
runtime.
It is easy enough to get the location of any python module from within the
module itself, then create path to the bash script from there:
import os.path
LOCATION = os.path.dirname(os.path.abspath(__file__))
pathToScript = os.path.join(LOCATION, 'bashscript.sh')
and `pathToScript` would then be an absolute path to the file `bashscript.sh`
sitting in the same directory as the current Python module.
|
Python Interpreter Behavior?
Question: I am using Python 2.7.
This is what happened:
>>> 2+++2
4
I am not sure as to how the python interpreter interprets this expression.
The only reason I can come up with is that successive "+" after the first "+"
are considered as unary operators and the first "+" is considered as a binary
operator, but what is actually the mechanism that is happening I am not sure
of.
I would want someone to answer the question in terms of the grammar specifics
of Python programming language and also report some other ambiguous
expressions. I came up with some other expressions which are listed below
(with their results):
>>> 2------------2
4
>>> 2+-2+-2+-2+-2+-2-------------------------2
-10
Answer: You're right; Python is interpreting this as `2 + (++2)`, as you might expect.
You can see this by looking at the compiled bytecode for 2+2 and 2+++2, as
follows:
>>> dis.dis(lambda: 2+2)
1 0 LOAD_CONST 2 (4)
3 RETURN_VALUE
>>> dis.dis(lambda: 2+++2)
1 0 LOAD_CONST 1 (2)
3 LOAD_CONST 1 (2)
6 UNARY_POSITIVE
7 UNARY_POSITIVE
8 BINARY_ADD
9 RETURN_VALUE
* * *
You might want to know why Python parses 2+++2 like this. First, the code gets
split up into tokens:
>>> from cStringIO import StringIO
>>> import tokenize
>>> tokenize.generate_tokens(StringIO("2+++2").readline)
9 <generator object generate_tokens at 0x0000000007BC7480>
>>> list(tokenize.generate_tokens(StringIO("2+++2").readline))
10
[(2, '2', (1, 0), (1, 1), '2+++2'),
(51, '+', (1, 1), (1, 2), '2+++2'),
(51, '+', (1, 2), (1, 3), '2+++2'),
(51, '+', (1, 3), (1, 4), '2+++2'),
(2, '2', (1, 4), (1, 5), '2+++2'),
(0, '', (2, 0), (2, 0), '')]
It's the parser that then associates the list of tokens into a syntax tree:
>>> st = ast.parse("2+++2")
>>> st
36 <_ast.Module at 0x7d2acc0>
>>> ast.dump(st)
37 'Module(body=[Expr(value=BinOp(left=Num(n=2), op=Add(), right=UnaryOp(op=UAdd(), operand=UnaryOp(op=UAdd(), operand=Num(n=2)))))])'
This follows standard disambiguation rules.
|
Pipe Output to Python File
Question: How do a make a python script take input that has been piped to it. Is that a
`sys.argv` moment. To be clear I want to figure out how to code the python
side to receive input like this:
cat someFile | domeSomething.py
Can this be done? Again, to clarify, I'm not wanting to write this as passing
a filename to my script and then using `open(filename)` I want to get piped
input. Thanks for the help.
Answer: To get piped input, you need to read from `stdin`:
import sys
print sys.stdin.read()
`stdin` is a file, so feel free to use any of the [methods of a file
object](http://docs.python.org/2/library/stdtypes.html#file-objects).
|
pythoninterpreter import error
Question: I have problem with importing package in python module. That's what I do:
from mega.mega import Mega
if __name__ == "__main__":
m = Mega()
and from java I run:
interpreter.execfile("api.py");
But I still get error:
Exception in thread "main" Traceback (most recent call last):
File "<string>", line 1, in <module>
ImportError: No module named mega
In mega folder I have mega.py file and `__init__.py` file to mark this folder
as package.
* * *
Now I get:
from mega.mega import Mega
SyntaxError: ("'import *' not allowed with 'from .'", ...path...
Answer: You'll need to add the parent directory of `mega` to `sys.path`:
import sys
import os
PATH = os.path.dirname(os.path.abspath(__file__))
sys.path.insert(0, PATH)
from mega.mega import Mega
`__file__` is the filename of the `api.py` module (can be relative).
|
Garbage collect a class with a reference to its instance?
Question: Consider this code snippet:
import gc
from weakref import ref
def leak_class(create_ref):
class Foo(object):
# make cycle non-garbage collectable
def __del__(self):
pass
if create_ref:
# create a strong reference cycle
Foo.bar = Foo()
return ref(Foo)
# without reference cycle
r = leak_class(False)
gc.collect()
print r() # prints None
# with reference cycle
r = leak_class(True)
gc.collect()
print r() # prints <class '__main__.Foo'>
It creates a reference cycle that cannot be collected, because the referenced
instance has a `__del__` method. The cycle is created here:
# create a strong reference cycle
Foo.bar = Foo()
This is just a proof of concept, the reference could be added by some external
code, a descriptor or anything. If that's not clear to you, remember that each
objects mantains a reference to its class:
+-------------+ +--------------------+
| | Foo.bar | |
| Foo (class) +------------>| foo (Foo instance) |
| | | |
+-------------+ +----------+---------+
^ |
| foo.__class__ |
+--------------------------------+
If I could guarantee that `Foo.bar` is only accessed from `Foo`, the cycle
wouldn't be necessary, as theoretically the instance could hold only a weak
reference to its class.
Can you think of a practical way to make this work without a leak?
* * *
As some are asking why would external code modify a class but can't control
its lifecycle, consider this example, similar to the real-life example I was
working to:
class Descriptor(object):
def __get__(self, obj, kls=None):
if obj is None:
try:
obj = kls._my_instance
except AttributeError:
obj = kls()
kls._my_instance = obj
return obj.something()
# usage example #
class Example(object):
foo = Descriptor()
def something(self):
return 100
print Example.foo
In this code only `Descriptor` (a [non-data
descriptor](http://docs.python.org/2/reference/datamodel.html#invoking-
descriptors)) is part of the API I'm implementing. `Example` class is an
example of how the descriptor would be used.
Why does the descriptor store a reference to an instance inside the class
itself? Basically for caching purposes. `Descriptor` required this contract
with the implementor: it would be used in any class assuming that
1. The class has a constructor with no args, that gives an "anonymous instance" (my definition)
2. The class has some behavior-specific methods (`something` here).
3. An instance of the class can stay alive for an undefined amount of time.
It doesn't assume anything about:
1. How long it takes to construct an object
2. Whether the class implements **del** or other magic methods
3. How long the class is expected to live
Moreover the API was designed to avoid any extra load on the class
implementor. I could have moved the responsibility for caching the object to
the implementor, but I wanted a standard behavior.
There actually is a simple solution to this problem: make the default behavior
to cache the instance (like it does in this code) but allow the implementor to
override it if they have to implement `__del__`.
Of course this wouldn't be as simple if we assumed that the class state _had_
to be preserved between calls.
* * *
As a starting point, I was coding a "weak object", an implementation of
`object` that only kept a weak reference to its class:
from weakref import proxy
def make_proxy(strong_kls):
kls = proxy(strong_kls)
class WeakObject(object):
def __getattribute__(self, name):
try:
attr = kls.__dict__[name]
except KeyError:
raise AttributeError(name)
try:
return attr.__get__(self, kls)
except AttributeError:
return attr
def __setattr__(self, name, value):
# TODO: implement...
pass
return WeakObject
Foo.bar = make_proxy(Foo)()
It appears to work for a limited number of use cases, but I'd have to
reimplement the whole set of `object` methods, and I don't know how to deal
with classes that override `__new__`.
Answer: For your example, why don't you store `_my_instance` in a dict on the
descriptor class, rather than on the class holding the descriptor? You could
use a weakref or WeakValueDictionary in that dict, so that when the object
disappears the dict will just lose its reference and the descriptor will
create a new one on the next access.
Edit: I think you have a misunderstanding about the possibility of collecting
the class while the instance lives on. Methods in Python are stored on the
class, not the instance (barring peculiar tricks). If you have an object `obj`
of class `Class`, and you allowed `Class` to be garbage collected while `obj`
still exists, then calling a method `obj.meth()` on the object would fail,
because the method would have disappeared along with the class. That is why
your only option is to weaken your class->obj reference; even if you could
make objects weakly reference their class, all it would do is break the class
if the weakness ever "took effect" (i.e., if the class were collected while an
instance still existed).
|
Networkx Dataset Creation
Question: I have data for a directed graph in the form of
Node1 Node2
A B
A C
C A
D A
Which means, a directed edge/link between A --> B, A --> C and so on. I want
to create this data into dataset supported by Networkx for modelling in
Python. I want keep the file size as minimum as possible. I have edges/links
of about 1 Million.
Answer:
import networkx as nx
import matplotlib.pyplot as plt
content = '''\
Node1 Node2
A B
A C
C A
D A'''
lines = content.splitlines()
G = nx.DiGraph()
for line in lines[1:]: # skip the first (header) line
a, b = map(str.strip, line.split())
G.add_edge(a, b)
nx.draw(G)
plt.savefig('/tmp/graph.png')
# plt.show()
|
Data handling for matplotlib histogram with error bars
Question: I've got a data set which is a list of tuples in python like this:
dataSet = [(6.1248199999999997, 27), (6.4400500000000003, 4), (5.9150600000000004, 1), (5.5388400000000004, 38), (5.82559, 1), (7.6892199999999997, 2), (6.9047799999999997, 1), (6.3516300000000001, 76), (6.5168699999999999, 1), (7.4382099999999998, 1), (5.4493299999999998, 1), (5.6254099999999996, 1), (6.3227700000000002, 1), (5.3321899999999998, 11), (6.7402300000000004, 4), (7.6701499999999996, 1), (5.4589400000000001, 3), (6.3089700000000004, 1), (6.5926099999999996, 2), (6.0003000000000002, 5), (5.9845800000000002, 1), (6.4967499999999996, 2), (6.51227, 6), (7.0302600000000002, 1), (5.7271200000000002, 49), (7.5311300000000001, 7), (5.9495800000000001, 2), (5.1487299999999996, 18), (5.7637099999999997, 6), (5.5144500000000001, 44), (6.7988499999999998, 1), (5.2578399999999998, 1)]
Where the first element of the tuple is an energy and the second a counter,
how many sensor where affected.
I want to create a histogram to study the relation between the number of
affected sensors and the energy. I'm pretty new to matplotlib (and python),
but this is what I've done so far:
import math
import matplotlib.pyplot as plt
dataSet = [(6.1248199999999997, 27), (6.4400500000000003, 4), (5.9150600000000004, 1), (5.5388400000000004, 38), (5.82559, 1), (7.6892199999999997, 2), (6.9047799999999997, 1), (6.3516300000000001, 76), (6.5168699999999999, 1), (7.4382099999999998, 1), (5.4493299999999998, 1), (5.6254099999999996, 1), (6.3227700000000002, 1), (5.3321899999999998, 11), (6.7402300000000004, 4), (7.6701499999999996, 1), (5.4589400000000001, 3), (6.3089700000000004, 1), (6.5926099999999996, 2), (6.0003000000000002, 5), (5.9845800000000002, 1), (6.4967499999999996, 2), (6.51227, 6), (7.0302600000000002, 1), (5.7271200000000002, 49), (7.5311300000000001, 7), (5.9495800000000001, 2), (5.1487299999999996, 18), (5.7637099999999997, 6), (5.5144500000000001, 44), (6.7988499999999998, 1), (5.2578399999999998, 1)]
binWidth = .2
binnedDataSet = []
#create another list and append the "binning-value"
for item in dataSet:
binnedDataSet.append((item[0], item[1], math.floor(item[0]/binWidth)*binWidth))
energies, sensorHits, binnedEnergy = [[q[i] for q in binnedDataSet] for i in (0,1,2)]
plt.plot(binnedEnergy, sensorHits, 'ro')
plt.show()
This works so far (although it doesn't even look like a histogram ;-) but OK),
but now I want to calculate the mean value for each bin and append some error
bars.
What's the way to do it? I looked at histogram examples for matplotlib, but
they all use one-dimensional data which will be counted, so you get a
frequency spectrum… That's not really what I want.
Answer: I am somewhat confused by exactly what you are trying to do, but I think this
(to first order) will do what I think you want:
bin_width = .2
bottom = 5.0
top = 8.0
binned_data = [0.0] * int(math.ceil(((top - bottom) / bin_width)))
binned_count = [0] * int(math.ceil(((top - bottom) / bin_width)))
n_bins = len(binned_data)
for E, cnt in dataSet:
if E < bottom or E > top:
print 'out of range'
continue
bin_id = int(math.floor(n_bins * (E - bottom) / (top - bottom)))
binned_data[bin_id] += cnt
binned_count[bin_id] += 1
binned_avergaed_data = [C_sum / hits if hits > 0 else 0 for C_sum, hits in zip(binned_data, binned_count)]
bin_edges = [bottom + j * bin_width for j in range(len(binned_data))]
plt.bar(bin_edges, binned_avergaed_data, width=bin_width)
I would also suggest looking into `numpy`, it would make this much simpler to
write.
|
My first Google App Engine/Python app
Question: I am trying to write my first GAE/Python application that does the following
three things:
1. Displays a form where the user can enter details about themself (index.html)
2. Stores the submitted form data in the datastore
3. Retrieves all data from datastore and displays all results above the form (index.html)
However, I'm getting the following error
> line 15, in MainPage 'people' : people NameError: name 'people' is not
> defined
Any advice on how to resolve this and get my app working will be appreciated!
**main.py**
import webapp2
import jinja2
import os
jinja_environment = jinja2.Environment(
loader=jinja2.FileSystemLoader(os.path.dirname(__file__)))
class MainPage(webapp2.RequestHandler):
def get(self):
people_query = Person.all()
people = people_query.fetch(10)
template_values = {
'people': people
}
template = jinja_environment.get_template('index.html')
self.response.out.write(template.render(template_values))
# retrieve the submitted form data and store in datastore
class PeopleStore(webapp2.RequestHandler):
def post(self):
person = Person()
person.first_name = self.request.get('first_name')
person.last_name = self.request.get('last_name')
person.city = self.request.get('city')
person.birth_year = self.request.get('birth_year')
person.birth_year = self.request.get('height')
person.put()
# models a person class
class Person(db.Model):
first_name = db.StringProperty()
last_name = db.StringProperty()
city = db.StringProperty()
birth_year = db.IntegerProperty()
height = db.IntegerProperty()
app = webapp2.WSGIApplication([('/', MainPage),
('/new_person')], debug=True)
**index.html**
<html>
<body>
{% for person in people %}
{% if person %}
<b>{{ person.first_name }}</b>
<b>{{ person.last_name }}</b>
<b>{{ person.city }}</b>
<b>{{ person.birth_year }}</b>
<b>{{ person.height }}</b>
<hr></hr>
{% else %}
No people found
{% endfor %}
<form action="/new_person" method="post">
<div><textarea name="first_name" rows="3" cols="60"></textarea></div>
<div><textarea name="last_name" rows="3" cols="60"></textarea></div>
<div><textarea name="city" rows="3" cols="60"></textarea></div>
<div><textarea name="birth_year" rows="3" cols="60"></textarea></div>
<div><textarea name="height" rows="3" cols="60"></textarea></div>
<div><input type="submit" value="Submit"></div>
</form>
</body>
</html>
**app.yaml**
application: some_name
version: 1
runtime: python27
api_version: 1
threadsafe: true
handlers:
- url: /.*
script: main.app
libraries:
- name: jinja2
version: latest
* * *
**EDIT 1** *_main.py_ *
import webapp2
import jinja2
import os
from google.appengine.ext import db
jinja_environment = jinja2.Environment(
loader=jinja2.FileSystemLoader(os.path.dirname(__file__)))
class MainPage(webapp2.RequestHandler):
def get(self):
people_query = Person.all()
people = people_query.fetch(10)
template_values = {
'people': people
}
template = jinja_environment.get_template('index.html')
self.response.out.write(template.render(template_values))
class PeopleStore(webapp2.RequestHandler):
def post(self):
person = Person()
person.first_name = self.request.get('first_name')
person.last_name = self.request.get('last_name')
person.city = self.request.get('city')
person.birth_year = self.request.get('birth_year')
person.height = self.request.get('height')
person.put()
class Person(db.Model):
first_name = db.StringProperty()
last_name = db.StringProperty()
city = db.StringProperty()
birth_year = db.IntegerProperty()
height = db.IntegerProperty()
app = webapp2.WSGIApplication([('/', MainPage),
('/new_person')], debug=True)
* * *
**EDIT 2** *_main.py_ *
The following edit fixed this error
> AttributeError: 'str' object has no attribute 'get_match_routes'
app = webapp2.WSGIApplication([('/', MainPage),('/new_person',PeopleStore)], debug=True)
Ok great, the form displays in the browser, but when I submit the data, I get
this error:
> BadValueError: Property birth_year must be an int or long, not a unicode
* * *
**EDIT 3 main.py**
person.birth_year = int(self.request.get('birth_year'))
person.height = int(self.request.get('height'))
resolved this error:
> badvalueerror property must be an int or long, not a unicode
Ok, good so far. The data stores in the data store. However, my page comes up
blank...
Answer: You have an indentation problem. Lines 3 and onwards of your `get` method
should be indented at the same level as the first two lines. Otherwise, they
are not part of the method, but the class definition itself, and will be
executed when the class is defined - at which point there is no variable
`people` in scope.
|
Disable automatic printing in Python interactive session
Question: I am going to be holding a Python workshop to teach some beginner level
programmers at my college Python.
I am looking for a way to modify the default behavior of Python interactive
sessions so that expressions do not automatically print out results. For
example, take this following interactive session:
wil@calcifer:~$ python
Python 2.7.3 (default, Aug 1 2012, 05:16:07)
[GCC 4.6.3] on linux2
Type "help", "copyright", "credits" or "license" for more information.
>>> x = 5
>>> y = 7
>>> x + y
12
>>> first_name = "Test"
>>> last_name = "Person"
>>> first_name + last_name
'TestPerson'
>>>
This would enforce the use of the `print` statement to avoid confusion later
on. This isn't crucial, but I was surprised that I was unable to find any
settings for this anywhere.
I would be able to preconfigure the machine beforehand, so any solutions would
work. Does anyone know if this is possible, or what change to the interactive
sessions creates this effect?
Answer: The expression printing in interactive sessions is mediated via a call to
`sys.displayhook`. Just override it to a NOP:
>>> import sys
>>> sys.displayhook = lambda x: None
>>> 2 + 3
>>> print 2 + 3
5
>>>
In a plain Python session it is wired to sys.stdout. Applications that offer a
Python shell on a GUI are expcted to use it to print the expression values
back to the user.
You can write your pythonrc.py ( ~/.pythonrc.py file) to do this by default,
each time the interpreter is called. Further documentation on sys.displayhook
can be found here: <http://docs.python.org/3/library/sys.html#sys.displayhook>
|
Python Popen: Write to stdout AND log file simultaneously
Question: I am using Popen to call a shell script that is continuously writing its
stdout and stderr to a log file. Is there any way to simultaneously output the
log file continuously (to the screen), or alternatively, make the shell script
write to both the log file and stdout at the same time?
I basically want to do something like this in Python:
cat file 2>&1 | tee -a logfile #"cat file" will be replaced with some script
Again, this pipes stderr/stdout together to tee, which writes it both to
stdout and my logfile.
I know how to write stdout and stderr to a logfile in Python. Where I'm stuck
is how to duplicate these back to the screen:
subprocess.Popen("cat file", shell=True, stdout=logfile, stderr=logfile)
Of course I could just do something like this, but is there any way to do this
without tee and shell file descriptor redirection?:
subprocess.Popen("cat file 2>&1 | tee -a logfile", shell=True)
Answer: You can use a pipe to read the data from the program's stdout and write it to
all the places you want:
import sys
import subprocess
logfile = open('logfile', 'w')
proc=subprocess.Popen(['cat', 'file'], stdout=subprocess.PIPE, stderr=subprocess.STDOUT)
for line in proc.stdout:
sys.stdout.write(line)
logfile.write(line)
proc.wait()
_UPDATE_
In python 3, the `universal_newlines` parameter controls how pipes are used.
If `False`, pipe reads return `bytes` objects and may need to be decoded
(e.g., `line.decode('utf-8')`) to get a string. If `True`, python does the
decode for you
> Changed in version 3.3: When universal_newlines is True, the class uses the
> encoding locale.getpreferredencoding(False) instead of
> locale.getpreferredencoding(). See the io.TextIOWrapper class for more
> information on this change.
|
How to write a whole string to a file in Python and where does the file go?
Question: I am doing an assignment on text formatting and alignment (text wrapping) and
I need to write my formatted string to new file. But once I have written to
the file (or think I've written) where does that file go? Does it actually
create a file on my desktop or am I being stupid?
This is my code:
txtFile = open("Output.txt", "w")
txtFile.write(string)
txtFile.close()
return txtFile
Cheers,
JT
Answer: The text is written to a file called "Output.txt" in your working directory
(which is usually the directory from which the script has been executed).
To display the working directory, you can use:
>>> import os
>>> os.getcwd()
'/home/adam'
|
How to Radix Sort using Queues?
Question: How do you properly radix sort a list using queues?
I'm using Python 3x.
This is my attempt using queues as bins since queues are a first-in-first-out
data structure.
from my_queue import Queue
def rsort(n):
'''(list of int) -> list of int
'''
list_length = len(n)
val = 0
mod = 10
k = 1
bin_list = []
alist = n
for bins in range(0,10):
bin_list.append(Queue())
while val == 0:
for num in alist:
sig_dig = num % mod
sig_dig = int(sig_dig / k)
bin_list[sig_dig].enqueue(num)
if bin_list[0].size() == list_length:
alist.append(bin_list[0].dequeue())
else:
mod = mod * 10
k = k * 10
new_list = []
for bins in bin_list:
if not bins.is_empty():
new_list.append(bins.dequeue())
alist = new_list
return alist
My code works perfectly fine with small numbers such as: `[3,2,6,5,8,7]`
but when values in the list become large like: `[240, 28, 5, 18, 140, 2]`
my program no longer sorts the list, numbers end up missing and unordered.
I've been playing around with my program a lot but I just can't fix it :(
Answer: There are a couple of things that seem wrong in your code. I'm not sure
exactly which of these is causing the issues you're seeing, but probably all
of them need to be fixed before you will get the right results.
First, a quick note: You can simplify the logic a bit by only using a single
integer to find the right digit in each of your numbers. I suggest a value
that starts at zero and goes up to some value (the number of digits you want
to sort on). You can find that digit's value for a given list item with
`sig_dig = num // 10**k % 10`. The `//` operator forces Python to use "floor
division", truncating off the non-integer part of normal division.
Anyway, the first issue is that you're looping on `val == 0`, but you never
modify `val`, and you return a value before the end of the loop (so you'll
never do it more than once anyway). You can fix this by calculating the number
of digits in the longest value of your list with something like `max_digits =
int(math.ceil(math.log(max(lst), 10)))`. Then you can make your loop much
simpler: `for k in range(max_digits):`
The next issue I see is that you're probably not getting the values from the
bins back into a list properly. You're only calling `dequeue` once, but you
should probably be calling it repeatedly until the queue is empty. Or, if I'm
misunderstanding the `Queue` API you're using and `dequeue` returns all the
queue's values, you need to use `extend` to add them all to the list at once.
Here's what I think you want to have, in the end:
import math
from my_queue import Queue
def rsort(n):
'''(list of int) -> list of int
'''
bin_list = [Queue for _ in range(10)]
max_digits = int(math.ceil(math.log(max(lst), 10))) # calculate # of digits
for k in range(max_digits):
for num in alist:
sig_dig = num / 10**k % 10 # find digit's value
bin_list[sig_dig].enqueue(num)
n = [] # we can reuse the name `n`, rather than using a different name
for bins in bin_list:
while not bins.is_empty(): # loop to dequeue all values
n.append(bins.dequeue())
return n # the return statement is outside the loop!
|
Using own code in pyhook pumpmessages
Question: i want to check if the file in which i am writing the keys is more than 2Kb .
If it is more than 2KB then i need to make another file and stop writing in
this one. I am a beginer in python please help me this. Please indicate where
can i use the code for checking if file is more than 2kb.
import win32api , win32console , win32gui , pythoncom , pyHook , sys, time ,os
import datetime
now = datetime.datetime.now()
p = now.strftime("%Y-%m-%d %H-%M")
temp_path = p
fil = temp_path + '.txt'
sys.stdout = open(fil,'w')
lastWindow = None
lastWindow=win32gui.GetWindowText (win32gui.GetForegroundWindow())
while True:
def OnKeyboardEvent(event):
global lastWindow
window = event.WindowName
key = chr(event.Ascii)
if window != lastWindow:
print window
lastWindow = window
print key
hm = pyHook.HookManager()
hm.KeyDown = OnKeyboardEvent
hm.HookKeyboard()
pythoncom.PumpMessages()
Hope you can help
Answer: you could use `.getsize`.
>>> import os
>>> b = os.path.getsize("/path/isa_005.mp3")
>>> b
2071611L
|
Soappy error: Fault SOAP-ENV:Server: Cannot use object of type stdClass as array
Question: I wanted to access with soappy a webservices of my internet provider.
here is a example in php from the provider of the Soap Services:
<http://kasapi.kasserver.com/dokumentation/?open=soap>
but I am not getting smart, to get it to run in python. I always get this
error message: "Cannot use object of type stdClass as array"
Any ideas how to solve that?! My program has 34 lines....
Here is the code:
from SOAPpy import WSDL
from SOAPpy.Errors import HTTPError as SoapHTTPError
from SOAPpy.Types import faultType
import hashlib
from array import array
class KASSystem(object):
def __init__(self):
WSDL_AUTH = 'https://kasapi.kasserver.com/soap/wsdl/KasAuth.wsdl'
WSDL_API = 'https://kasapi.kasserver.com/soap/wsdl/KasApi.wsdl'
userpass = ['mylogin','mypassword']
m = hashlib.sha1()
m.update(userpass[1])
userpass[1] = m.hexdigest()
loginData = {'user':userpass[0],'pass':userpass[1]}
self.__SoapServer = WSDL.Proxy(WSDL_AUTH)
try:
self.__CredentialToken = self.__SoapServer.KasAuth({
'KasUser':loginData['user'],
'KasAuthType':'sha1',
'KasPassword':loginData['pass'],
'SessionLifeTime':1800,'SessionUpdateLifeTime':'Y'})
except (SoapHTTPError), e:
print "Fehlermeldung:", e.code,e.msg
KasObj = KASSystem()
I got this error message:
Traceback (most recent call last):
File "/storage/PyProjects/toolsAPP/KASUpdate.py", line 33, in <module>
KasObj = KASSystem()
File "/storage/PyProjects/toolsAPP/KASUpdate.py", line 28, in __init__
'SessionLifeTime':1800,'SessionUpdateLifeTime':'Y'})
File "build/bdist.linux-x86_64/egg/SOAPpy/Client.py", line 540, in __call__
File "build/bdist.linux-x86_64/egg/SOAPpy/Client.py", line 562, in __r_call
File "build/bdist.linux-x86_64/egg/SOAPpy/Client.py", line 475, in __call
SOAPpy.Types.faultType: <Fault SOAP-ENV:Server: Cannot use object of type stdClass as array>
Answer: 1st paramter of method MUST be the message name, 2nd parameter the Dict with
all it's parameters......
|
Shell Script Error | Works in Command Line - Not in Script
Question: Background:
I'm using NMAP, shell script, and a python script to run a scan on a list of
IPs. The python portion parses the XML output of nmap to generate two lists, a
list of alive hosts and down hosts. The python then re-executes the shell
script(starting point) on the list of down hosts over and over until one
becomes alive and the info gets appended onto the xml and the two lists of
hosts gets corrected.
Problem: This was once working but now I'm getting strange behavior(syntax
error) when running the shell script on the list of down hosts.
Script:
# Grap Complete Info in XML file
sudo nmap -v -sS -oX full-scan.xml --append-output --no-stylesheet -iL $1
# Set permissions of xml for python script to write
sudo chmod a+rw full-scan.xml
# Clean NMAP XML Root Appends
sed '/<?xml/s/.*//' full-scan.xml > scan.tmp && mv scan.tmp full-scan.xml
sed 's/<\/nmaprun>//g' full-scan.xml > scan.tmp && mv scan.tmp full-scan.xml
sed '/<nmaprun/d' full-scan.xml > scan.tmp && mv scan.tmp full-scan.xml
echo "<nmaprun>" | cat - full-scan.xml > temp && echo "</nmaprun>" >> temp
mv temp full-scan.xml
# Run python parser here
./parseXMLnmap.py full-scan.xml
* * *
Error:
./scanIPlist.sh ip.list.down
Starting Nmap 5.00 ( http://nmap.org ) at 2013-03-21 11:55 EDT
....
Nmap done: 8 IP addresses (0 hosts up) scanned in 0.59 seconds
Raw packets sent: 16 (672B) | Rcvd: 0 (0B)
de????@????:~/workspace/nmap-script$ File "./scanIPlist.sh", line 6
sudo nmap -v -sS -oX full-scan.xml --append-output --no-stylesheet -iL $1
^
SyntaxError: invalid syntax
I'm confused at pinpointing where the problem is... when I use this command:
"sudo nmap -v -sS -oX full-scan.xml --append-output --no-stylesheet -iL
ip.list.down"
in the command line.. it works perfectly fine. You can see nmap doing the
command so where is the error coming from that's stopping the rest of my
script from continuing?
If I comment out every line after the nmap command it works so I thought maybe
a permission issue but I tried executing the sed and mv commands with sudo but
that didn't fix the issue.
Permissions are as follows after the first run on the ORIGINAL IP list:
ls -l
total 32
-rw------- 1 user user 11469 2013-03-21 12:03 full-scan.xml
-rw------- 1 user user 110 2013-03-21 12:03 ip.list.down
-rw------- 1 user user 238 2013-03-20 14:44 ip.list.orig
-rw------- 1 user user 128 2013-03-21 12:03 ip.list.up
-rwx--x--x 1 user user 1528 2013-03-21 10:26 parseXMLnmap.py
-rwx--x--x 1 user user 676 2013-03-21 12:02 scanIPlist.sh
So the problem is that I need a loop that never ends, but does not keep
creating more and more processes.
User Input Start -> Shell Script -> Python Script -> Shell Script -> .... and
so on until interrupted by the user.
Previously, In my python code I was using:
subprocess.call(['./scanIPList.sh', 'ip.list.down'])
This was no good because the processes would stay open and it would just keep
creating them over and over until the computer would eventually crash. I
needed it to detach from the child process and exit when it executes the next
script.
I tried using this:
subprocess.Popen([sys.executable, './scanIPlist.sh', 'ip.list.down'])
this must be the cause of issue I am getting now.
any help appreciated.
Answer: `SyntaxError: invalid syntax` is a `python` error. Looks like you are trying
to run shell commands in a python program. You probably need `import
subprocess`.
Or maybe you have `#!/usr/bin/python` at the top of your shell script?
|
Python unzip AES-128 encrypted file
Question: Is there a way to decompress an AES-128 encrypte file directly with python,
since ZipFile throws a Bad Password error. If i use 7zip it works, so the
password is correct, but then again 7zip needs to be installed as a
dependency.
What i tried:
from ZipFile import ZipFile
zip = ZipFile('test.zip')
zip.extractall(pwd='password')
This throws the Bad Password exception.
Checking the file with 7zip
7z l -slt test.zip
This returns:
Encrypted = +
Method = pkAES-128 Deflate
Answer: The zipfile module from the Python standard library supports only CRC32
encrypted zip files (see here:
<http://hg.python.org/cpython/file/71adf21421d9/Lib/zipfile.py#l420> ). So,
there is no way around some 3rd party dependency.
The easiest way would be to just install 7zip and call the commandline utility
`7z` using the `subprocess` module from the standard lib:
import subprocess
subprocess.call(["7z", "x", "-ppassword", "test.zip"])
Another option would be the python module "PyLzma" which can also handle AES
encrypted 7zip archives: <https://github.com/fancycode/pylzma> . It doesn't
directly support decrypting classic zip files but you could use its routines
to write your own decompressor function.
|
Pass enum to ndb.Model field in python
Question: I find [What's the best way to implement an 'enum' in
Python?](http://stackoverflow.com/questions/36932/whats-the-best-way-to-
implement-an-enum-in-python) for how to create enum in python. I have a field
in my `ndb.Model` that I want to accept one of my enum values. Do I simply set
the field to `StringProperty`? My enum is
def enum(**enums):
return type('Enum', (), enums)
ALPHA = enum(A="A", B="B", C="C", D="D")
Answer: This is fully supported in the [ProtoRPC Python
API](https://developers.google.com/appengine/docs/python/tools/protorpc/) and
it's not worth rolling your own.
A simple Enum would look like the following:
from protorpc import messages
class Alpha(messages.Enum):
A = 0
B = 1
C = 2
D = 3
As it turns out, `ndb` has `msgprop` module for storing `protorpc` objects and
this is
[documented](https://developers.google.com/appengine/docs/python/ndb/properties#msgprop).
So to store your `Alpha` enum, you'd do the following:
from google.appengine.ext import ndb
from google.appengine.ext.ndb import msgprop
class Part(ndb.Model):
alpha = msgprop.EnumProperty(Alpha, required=True)
...
**EDIT** : As pointed out by
[hadware](http://stackoverflow.com/users/1327143/hadware), a
`msgprop.EnumProperty` is not indexed by default. If you want to perform
queries over such properties you'd need to define the property as
alpha = msgprop.EnumProperty(Alpha, required=True, indexed=True)
and then perform queries
ndb.query(Part.alpha == Alpha.B)
or use any value other than `Alpha.B`.
|
turn scatter data into binned data with errors bars equal to standard deviation
Question: I have a bunch of data scattered x, y. If I want to bin these according to x
and put error bars equal to the standard deviation on them, how would I go
about doing that?
The only I know of in python is to loop over the data in x and group them
according to bins (max(X)-min(X)/nbins) then loop over those blocks to find
the std. I'm sure there are faster ways of doing this with numpy.
I want it to look similar to "vert symmetric" in:
<http://matplotlib.org/examples/pylab_examples/errorbar_demo.html>
Answer: You can bin your data with `np.histogram`. I'm reusing code from [this other
answer](http://stackoverflow.com/questions/15477857/mean-values-depending-on-
binning-with-respect-to-second-variable/15478137#15478137) to calculate the
mean and standard deviation of the binned `y`:
import numpy as np
import matplotlib.pyplot as plt
x = np.random.rand(100)
y = np.sin(2*np.pi*x) + 2 * x * (np.random.rand(100)-0.5)
nbins = 10
n, _ = np.histogram(x, bins=nbins)
sy, _ = np.histogram(x, bins=nbins, weights=y)
sy2, _ = np.histogram(x, bins=nbins, weights=y*y)
mean = sy / n
std = np.sqrt(sy2/n - mean*mean)
plt.plot(x, y, 'bo')
plt.errorbar((_[1:] + _[:-1])/2, mean, yerr=std, fmt='r-')
plt.show()
|
Python: Parse web content for lines containing a specific character and store into a file
Question: I am new to python. I have this webpage containing the contents:
<Response>
<Value type="ABC">107544</Value>
<Value type="EFG">10544</Value>
<Value type="ABC">77544</Value>
I would like to parse lines containing ABC and store only the numbers within a
temporary text file. How can I do this?
Currently I have
htmlpage = urllib2.urlopen(<URL>)
result = htmlpage.read()
Answer: Put your result into `BeautifulSoup`, and you will be able to extract any data
very easily without regex
# UPDATED:
from bs4 import BeautifulSoup
result = '''<div class="test">
<a href="example">Result 1</a>
</div>
<div class="test">
<a href="example2">Result 2</a>
</div>'''
soup = BeautifulSoup(result)
for div in soup.findAll('div', attrs={'class':'test'}):
print div.find('a').text
Result 1
Result 2
|
rpy2 / R issue in loess function via Python?
Question: I'm trying to call the R function `loess` via Rpy2 in Python on this datafile:
<http://filebin.ca/azuz9Piv0z8/test.data>
It works when I use a subset of the data (the first 1000 points) but when I
try to use the entire file, I get an error. My code:
import pandas
from rpy2.robjects import r
import rpy2.robjects as robjects
data = pandas.read_table(os.path.expanduser("~/test2.data"), sep="\t").values
small_data = data[0:1000, :]
print "small data loess:"
a, b = robjects.FloatVector(list(small_data[:, 0])), \
robjects.FloatVector(list(small_data[:, 1]))
df = robjects.DataFrame({"a": a, "b": b})
loess_fit = r.loess("b ~ a", data=df)
print loess_fit
print "large data loess:"
a, b = robjects.FloatVector(list(data[:, 0])), \
robjects.FloatVector(list(data[:, 1]))
df = robjects.DataFrame({"a": a, "b": b})
loess_fit = r.loess("b ~ a", data=df)
print loess_fit
Fitting on `small_data` works but not `data`. I get the error:
Error in simpleLoess(y, x, w, span, degree, parametric, drop.square, normalize, :
NA/NaN/Inf in foreign function call (arg 1)
loess_fit = r.loess("b ~ a", data=df)
File "/usr/local/lib/python2.7/dist-packages/rpy2-2.3.3-py2.7-linux-x86_64.egg/rpy2/robjects/functions.py", line 86, in __call__
return super(SignatureTranslatedFunction, self).__call__(*args, **kwargs)
File "/usr/local/lib/python2.7/dist-packages/rpy2-2.3.3-py2.7-linux-x86_64.egg/rpy2/robjects/functions.py", line 35, in __call__
res = super(Function, self).__call__(*new_args, **new_kwargs)
rpy2.rinterface.RRuntimeError: Error in simpleLoess(y, x, w, span, degree, parametric, drop.square, normalize, :
NA/NaN/Inf in foreign function call (arg 1)
How can this be fixed? I'm not sure if it's a problem with the R function
`loess` or with the Rpy2 interface to it? thanks.
Answer: The problem are `-Inf` values in your data:
DF <- read.table('http://filebin.ca/azuz9Piv0z8/test.data')
DF[!is.finite(DF[,1]) | !is.finite(DF[,2]),]
# V1 V2
# 5952 -Inf -Inf
|
Processing XML With Hadoop Streaming failed
Question: i did
bin/hadoop jar contrib/streaming/hadoop-streaming-1.0.4.jar -inputreader "StreamXmlRecordReader, begin=<metaData>,end=</metaData>" -input /user/root/xmlpytext/metaData.xml -mapper /Users/amrita/desktop/hadoop/pythonpractise/mapperxml.py -file /Users/amrita/desktop/hadoop/pythonpractise/mapperxml.py -reducer /Users/amrita/desktop/hadoop/pythonpractise/reducerxml.py -file /Users/amrita/desktop/hadoop/pythonpractise/mapperxml.py -output /user/root/xmlpytext-output1 -numReduceTasks 1
but it shows
13/03/22 09:38:48 INFO mapred.FileInputFormat: Total input paths to process : 1
13/03/22 09:38:49 INFO streaming.StreamJob: getLocalDirs(): [/Users/amrita/desktop/hadoop/temp/mapred/local]
13/03/22 09:38:49 INFO streaming.StreamJob: Running job: job_201303220919_0001
13/03/22 09:38:49 INFO streaming.StreamJob: To kill this job, run:
13/03/22 09:38:49 INFO streaming.StreamJob: /private/var/root/hadoop-1.0.4/libexec/../bin/hadoop job -Dmapred.job.tracker=-kill job_201303220919_0001
13/03/22 09:38:49 INFO streaming.StreamJob: Tracking URL: http://localhost:50030/jobdetails.jsp?jobid=job_201303220919_0001
13/03/22 09:38:50 INFO streaming.StreamJob: map 0% reduce 0%
13/03/22 09:39:26 INFO streaming.StreamJob: map 100% reduce 100%
13/03/22 09:39:26 INFO streaming.StreamJob: To kill this job, run:
13/03/22 09:39:26 INFO streaming.StreamJob: /private/var/root/hadoop-1.0.4/libexec/../bin/hadoop job -Dmapred.job.tracker=-kill job_201303220919_0001
13/03/22 09:39:26 INFO streaming.StreamJob: Tracking URL: http:///jobdetails.jsp?jobid=job_201303220919_0001
13/03/22 09:39:26 ERROR streaming.StreamJob: Job not successful. Error: # of failed Map Tasks exceeded allowed limit. FailedCount: 1. LastFailedTask: task_201303220919_0001_m_000000
13/03/22 09:39:26 INFO streaming.StreamJob: killJob...
Streaming Command Failed!
when i went through jobdetails.jsp there it shows
java.lang.RuntimeException: java.lang.reflect.InvocationTargetException
at org.apache.hadoop.streaming.StreamInputFormat.getRecordReader(StreamInputFormat.java:77)
at org.apache.hadoop.mapred.MapTask$TrackedRecordReader.<init>(MapTask.java:197)
at org.apache.hadoop.mapred.MapTask.runOldMapper(MapTask.java:418)
at org.apache.hadoop.mapred.MapTask.run(MapTask.java:372)
at org.apache.hadoop.mapred.Child$4.run(Child.java:255)
at java.security.AccessController.doPrivileged(Native Method)
at javax.security.auth.Subject.doAs(Subject.java:396)
at org.apache.hadoop.security.UserGroupInformation.doAs(UserGroupInformation.java:1121)
at org.apache.hadoop.mapred.Child.main(Child.java:249)
Caused by: java.lang.reflect.InvocationTargetException
at sun.reflect.NativeConstructorAccessorImpl.newInstance0(Native Method)
at sun.reflect.NativeConstructorAccessorImpl.newInstance(NativeConstructorAccessorImpl.java:39)
at sun.reflect.DelegatingConstructorAccessorImpl.newInstance(DelegatingConstructorAccessorImpl.java:27)
at java.lang.reflect.Constructor.newInstance(Constructor.java:513)
at org.apache.hadoop.streaming.StreamInputFormat.getRecordReader(StreamInputFormat.java:74)
... 8 more
Caused by: java.io.IOException: JobConf: missing required property: stream.recordreader.begin
at org.apache.hadoop.streaming.StreamXmlRecordReader.checkJobGet(StreamXmlRecordReader.java:278)
at org.apache.hadoop.streaming.StreamXmlRecordReader.<init>(StreamXmlRecordReader.java:52)
... 13 more
my mapper
#!/usr/bin/env python
import sys
import cStringIO
import xml.etree.ElementTree as xml
def cleanResult(element):
result = None
if element is not None:
result = element.text
result = result.strip()
else:
result = ""
return result
def process(val):
root = xml.fromstring(val)
sceneID = cleanResult(root.find('sceneID'))
cc = cleanResult(root.find('cloudCover'))
returnval = ("%s,%s") % (sceneID,cc)
return returnval.strip()
if __name__ == '__main__':
buff = None
intext = False
for line in sys.stdin:
line = line.strip()
if line.find("<metaData>") != -1:
intext = True
buff = cStringIO.StringIO()
buff.write(line)
elif line.find("</metaData>") != -1:
intext = False
buff.write(line)
val = buff.getvalue()
buff.close()
buff = None
print process(val)
else:
if intext:
buff.write(line)
and reducer
#!/usr/bin/env python
import sys
if __name__ == '__main__':
for line in sys.stdin:
print line.strip()
can anyone tell me why this happens. I am using hadoop-1.0.4 im mac. Is there
any thing wrong. Should i change any thing . pls help me out.
Answer: Remove space in between comma and begin `, begin=<`.
The correct format is :
hadoop jar hadoop-streaming.jar -inputreader
"StreamXmlRecord,begin=BEGIN_STRING,end=END_STRING" ..... (rest of the command)
This is due to the code surrounding the following lines in
`org.apache.hadoop.streaming.StreamJob`
for (int i = 1; i < args.length; i++) {
String[] nv = args[i].split("=", 2);
String k = "stream.recordreader." + nv[0];
String v = (nv.length > 1) ? nv[1] : "";
jobConf_.set(k, v);
}
|
scikit learn SVM, how to save/load support vectors?
Question: using python scikit svm, after running clf.fit(X, Y), you get your support
vectors. could I load these support vectors directly (passing them as
paramter) when instantiate a svm.SVC object? which means I do not need to
running fit() method each time to do predication
Answer: From the scikit manual: <http://scikit-
learn.org/stable/modules/model_persistence.html>
1.2.4 Model persistence It is possible to save a model in the scikit by using
Python’s built-in persistence model, namely pickle.
>>> from sklearn import svm
>>> from sklearn import datasets
>>> clf = svm.SVC()
>>> iris = datasets.load_iris()
>>> X, y = iris.data, iris.target
>>> clf.fit(X, y)
SVC(kernel=’rbf’, C=1.0, probability=False, degree=3, coef0=0.0, eps=0.001,
cache_size=100.0, shrinking=True, gamma=0.00666666666667)
>>> import pickle
>>> s = pickle.dumps(clf)
>>> clf2 = pickle.loads(s)
>>> clf2.predict(X[0])
array([ 0.])
>>> y[0]
0
In the specific case of the scikit, it may be more interesting to use joblib’s
replacement of pickle, which is more efficient on big data, but can only
pickle to the disk and not to a string:
>>> from sklearn.externals import joblib
>>> joblib.dump(clf, ’filename.pkl’)
|
Deploy Django project on Google App Engine
Question: I have developed one example project in django1.4 & python 2.7, I want to
deploy it on google app engine, but how to configure my project as per App
Engine we didn't get.
We have a site running on google app engine, but it is including with all
html,js.
How do we configure a database on google app engine to deploy our django
project?
Answer: Possibly the best option is to use Django Non-Rel. It's the only way (that I
know of) to use the Django ORM (the django database interface) on Google App
Engine without using Google's costly cloud SQL service. To do this, you'll
need to use a customized version of Django and import several more libraries.
It's a small project to get it up and running, but it's worth the effort. More
information can be found on this website:
<http://django-nonrel.org/>
Note, that even though django-nonrel allows you to use the Django database
interface, it will **not** allow you to use certain SQL features, such as
joins. If you need joins, then your best option would be to use Google App
Engine + Google Cloud SQL. [Documentation for that is
here](https://developers.google.com/appengine/docs/python/cloud-sql/django).
Regarding the comments:
* Yes, it can run on windows, I run it on Windows.
* Also, the site allbuttonspressed.com is old and out of date, use the one above for information.
|
ctypes reimplementation of rshift for c_ulong
Question: i am accessing a C library via ctypes and i am stuck with the following
problem:
I am generating a "wrapper" (ctypes commands to access the library with
ctypes) using ctypeslib. The C library contains macros which are converted to
python functions in this step. (To be independent of the libraries internals
as much as possible i want to use some of these macros in python.)
One of these macros looks like this:
# using the ctypes types
myuint16_t = c_ushort
myuint32_t = c_ulong
def mymacro(x): return (myuint16_t)((myuint32_t)(x) >> 16) # macro
I want to use the generated function in a seperate module in the following way
(inside a function):
return wrapper.mymacro(valueToBeConverted) # valueToBeConverted is an int
But using this line i got the following error:
....
def mymacro(x): return (myuint16_t)((myuint32_t)(x) >> 16) # macro
TypeError: unsupported operand type(s) for >>: 'c_ulong' and 'int'
(I know that the common way to shift a c_ulong is `c_ulongvar.value >> x` but
i would have to patch the generated wrapper every time something changes in
the C library. So i try to avoid this).
It seems that the `__rshift__` implementation of c_ulong can not be used here.
print c_ulong.__rshift__
# throws AttributeError: type object 'c_ulong' has no attribute '__rshift__'
Hm, seems strange... So i decided to reimplement the `__rshift__` method of
c_ulong to get it working:
from ctypes import *
from types import MethodType
def rshift(self, val):
print self.value >> val
# create an unbound method which applies to all (even existing) instances
c_ulong.__rshift__ = MethodType(rshift, None, c_ulong)
a = c_ulong(1)
a >> 16
But it does not fix the problem. I am still getting an error:
a >> 16
TypeError: unsupported operand type(s) for >>: 'c_ulong' and 'int'
Is it possible that the `__rshift__` method can be only used for two instances
of the same class? I tried the following:
def rshift(self, val):
print self.value >> int(val.value)
a = c_ulong(1)
a >> c_ulong(16)
and it works. But it would also mean i would still have to patch the generated
wrapper.
So: Does anybody know whats the trick here?
**UPDATE** :
The solution of @eryksun worked. I am using:
from ctypes import *
# from types import MethodType
def _rshift(self, other):
if hasattr(other, 'value'):
other = other.value
return c_ulong(self.value >> other)
def _lshift(self, other):
if hasattr(other, 'value'):
other = other.value
return c_ulong(self.value << other)
def _coerce(self, other):
try:
return self, self.__class__(other)
except TypeError:
return NotImplemented
# Add the functions to the type. A method is created when
# accessed as an attribute of an instance.
c_ulong.__lshift__ = _lshift
c_ulong.__rshift__ = _rshift
c_ulong.__coerce__ = _coerce
Answer: Since the `_ctypes._SimpleCData` type doesn't have the `Py_TPFLAGS_CHECKTYPES`
flag, 2.x subclasses are treated as old-style numbers that use `__coerce__` in
binary operations. See
[Objects/abstract.c](https://hg.python.org/cpython/file/v2.7.3/Objects/abstract.c#l900)
for the calling scheme and the implementation in the function `binary_op1`.
For demonstration purposes this flag can be toggled on the type object, which
you only need to define (vaguely with a lot of `void *`) up to the `tp_flags`
field.
## Hacking the `PyTypeObject`
from ctypes import *
import _ctypes
Py_TPFLAGS_CHECKTYPES = 1 << 4
class PyTypeObject(Structure):
_fields_ = (('ob_refcnt', c_ssize_t),
('ob_type', c_void_p),
('ob_size', c_ssize_t),
('tp_name', c_char_p),
('tp_basicsize', c_ssize_t),
('tp_itemsize', c_ssize_t),
('tp_dealloc', c_void_p),
('tp_print', c_void_p),
('tp_getattr', c_void_p),
('tp_setattr', c_void_p),
('tp_compare', c_void_p),
('tp_repr', c_void_p),
('tp_as_number', c_void_p),
('tp_as_sequence', c_void_p),
('tp_as_mapping', c_void_p),
('tp_hash', c_void_p),
('tp_call', c_void_p),
('tp_str', c_void_p),
('tp_getattro', c_void_p),
('tp_setattro', c_void_p),
('tp_as_buffer', c_void_p),
('tp_flags', c_long))
Next, create an `unsigned long` subclass, and use the `from_address` factory
to create a `PyTypeObject` for it. Get the address with built-in `id`, which
is an implementation detail specific to CPython:
class c_ulong(_ctypes._SimpleCData):
_type_ = "L"
def __rshift__(self, other):
print '__rshift__', self, other
if hasattr(other, 'value'):
other = other.value
return c_ulong(self.value >> other)
c_ulong_type = PyTypeObject.from_address(id(c_ulong))
## Demo
>>> a = c_ulong(16)
>>> b = c_ulong(2)
>>> a >> b
__rshift__ c_ulong(16L) c_ulong(2L)
c_ulong(4L)
>>> a >> 2
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
TypeError: unsupported operand type(s) for >>: 'c_ulong' and 'int'
The last step failed as expected. Now set the flag:
>>> c_ulong_type.tp_flags |= Py_TPFLAGS_CHECKTYPES
>>> a >> 2
__rshift__ c_ulong(16L) 2
c_ulong(4L)
Problem solved? But that's a hack. Try again with `__coerce__` implemented.
* * *
## Implement `__coerce__`
class c_ulong(_ctypes._SimpleCData):
_type_ = "L"
def __rshift__(self, other):
print '__rshift__', self, other
if hasattr(other, 'value'):
other = other.value
return c_ulong(self.value >> other)
def __coerce__(self, other):
print '__coerce__', self, other
try:
return self, self.__class__(other)
except TypeError:
return NotImplemented
## Demo
>>> a = c_ulong(16)
>>> b = c_ulong(2)
>>> a >> 2
__coerce__ c_ulong(16L) 2
__rshift__ c_ulong(16L) c_ulong(2L)
c_ulong(4L)
>>> 16 >> b
__coerce__ c_ulong(2L) 16
__rshift__ c_ulong(16L) c_ulong(2L)
c_ulong(4L)
Of course it fails if a `c_ulong` can't be created, such as for a `float`:
>>> a >> 2.0
__coerce__ c_ulong(16L) 2.0
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
TypeError: unsupported operand type(s) for >>: 'c_ulong' and 'float'
|
Simple indeterminate progress bar in Python
Question: Even when I am afraid to be a bit off-topic, but I am not sure where else to
ask this, sorry!
I wish to build a `**simple** indeterminate progress bar` in Python
there is a really valid p[rogression bar
module](https://code.google.com/p/python-progressbar/) in Python, but my
target is build a simple personal progress bar to add every time to my code
the following my code it's a simple progress bar when you know the `maxvalue`
of your data
from __future__ import division
import sys
class Progress(object):
def __init__(self, maxval):
self._pct = 0
self.maxval = maxval
def update(self, value):
pct = int((value / self.maxval) * 100.0)
if self._pct != pct:
self._pct = pct
self.display()
def start(self):
self.update(0)
def finish(self):
self.update(self.maxval)
def display(self):
sys.stdout.write("\r|%-73s| %d%%" % ('#' * int(self._pct*.73), self._pct))
sys.stdout.flush()
import time
toolbar_width = 300
pbar = Progress(toolbar_width)
pbar.start()
for i in xrange(toolbar_width):
time.sleep(0.1) # do real work here
pbar.update(i)
pbar.finish()
now i wish to create a new class IndeterminateProgress(object) in order to
create a simple indeterminate progress bar when the maxvalue of your data is
unknown.
the basic idea is print from 0 to 100 and back from 100 to 0 and again until
all data are all read or all processed (code update with the help of Ethan
Coon, see below)
class IndeterminateProgress(object):
def __init__(self):
self._pct = 0
self.maxval = 100
def update(self,value):
abs_pct = value % self.maxval # this gives the percentage change from maxval
phase = int(value / self.maxval) % 2 # this gives whether the bar is increasing or decreasing in size
if phase == 0:
rel_pct = abs_pct / self.maxval * 100
else:
rel_pct = (self.maxval - abs_pct) / self.maxval * 100
if (rel_pct != self._pct):
self._pct = rel_pct
self.display()
def start(self):
self.update(0)
def display(self):
sys.stdout.write("\r|%-73s| %d%%" % ('#' * int(self._pct*.73), self._pct))
sys.stdout.flush()
data_flush = 30000000
pbar = IndeterminateProgress()
for i in xrange(data_flush):
time.sleep(0.1) # do real work here
pbar.update(i)
Testing with the Command Prompt of windows, the progress bar after 100% back
to 0%, go to 100% but after this a new under progress bar is created.
The idea is print only one line of indeterminate progress bar
Answer: Basically you just want everything modulo the maxval. In python, modulo is
done with the % operator.
def update(self,value):
abs_pct = value % self.maxval # this gives the percentage change from maxval
phase = int(value / self.maxval) % 2 # this gives whether the bar is increasing or decreasing in size
if phase == 0:
rel_pct = abs_pct / self.maxval * 100
else:
rel_pct = (self.maxval - abs_pct) / self.maxval * 100
if (rel_pct != self._pct):
self._pct = rel_pct
self.display()
Note there is no requirement here that maxval is 100... you could set it to
whatever a "reasonable increment size" is for your data. If you have 1billion
data to read and do it at 1000 per second, maybe you don't want your increment
size to be 100 ;)
|
re.split() with special cases
Question: I am new to regular expression and have a problem with the re.split
functionality.
In my case the split has to care "special escapes".
The text should be seperated at `;`, except there is a leading `?`.
**Edit:** In that case the two parts shouldn't be splitted and the `?` has to
be removed.
Here an example and the result I wish:
import re
txt = 'abc;vwx?;yz;123'
re.split(r'magical pattern', txt)
['abc', 'vwx;yz', '123']
I tried so far these attempt:
re.split(r'(?<!\?);', txt)
and got:
['abc', 'vwx?;yz', '123']
Sadly causes the not consumed `?` trouble and the following list comprehension
is to performance critical:
[part.replace('?;', ';') for part in re.split(r'(?<!\?);', txt)]
['abc', 'vwx;yz', '123']
Is there a "fast" way to reproduce that behavior with re?
Could the re.findall function be the solution to take?
For example a extended version of this code:
re.findall(r'[^;]+', txt)
I am using python 2.7.3.
Thanking you in anticipation!
Answer: Regex is not the tool for the job. Use the `csv` module instead:
>>> txt = 'abc;vwx?;yz;123'
>>> r = csv.reader([txt], delimiter=';', escapechar='?')
>>> next(r)
['abc', 'vwx;yz', '123']
|
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.