text
stringlengths 226
34.5k
|
|---|
Why isn't my webapp2 import / Google App Engine "Hello, World" working?
Question: While I'm able to get my "Hello, World" program running on Google App Engine
(GAE), it only works when I create a version that doesn't rely on the webapp2
import. Why isn't the import working? What I need to do to fix it?
Version of helloworld.py that works:
print 'Content-Type: text/plain'
print ''
print 'Hello, World!!'
Version of helloworld.py that does not work:
import webapp2
class MainPage(webapp2.RequestHandler):
def get(self):
self.response.headers['Content-Type'] = 'text/plain'
self.response.out.write('Hello, World!')
app = webapp2.WSGIApplication([('/', MainPage)], debug=True)
This second version renders as a blank page.
I think the problem is that the webapp2 import isn't working. When I run
python from within the same directory as my hello world program from the
command line I get the following:
Brians-MacBook-Air-2:app_engine_hello_world brian$ python
Python 2.7.2 (v2.7.2:8527427914a2, Jun 11 2011, 15:22:34)
[GCC 4.2.1 (Apple Inc. build 5666) (dot 3)] on darwin
Type "help", "copyright", "credits" or "license" for more information.
>>> import webapp2
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
ImportError: No module named webapp2
However, I see webapp2.py in the following directory:
Brians-MacBook-Air-2:webapp2 brian$ pwd
/Users/brian/Repos/app_engine_hello_world/build/webapp2
Also, I'm running python 2.7 installed in the following location:
Brians-MacBook-Air-2:app_engine_hello_world brian$ which python
/Library/Frameworks/Python.framework/Versions/2.7/bin/python
EDIT: Adding my app.yaml file & some other potentially useful info...
application: hello-world-cs253
version: 1
runtime: python27
api_version: 1
threadsafe: no
handlers:
- url: /.*
script: helloworld.py
I'm using version 1.7.0 - 2012-06-26 of the SDK / GAE Launcher
Results are the same in Chrome, Firefox, and Safari
Answer: You don't have to install webapp2. When you run the dev_appserver.py with the
path to your project directory as the argument, it handles the importing of
`webapp2`.
Do you have a app.yaml in place, and is it correct?
For Python2.7 you need to specify that you're using Python2.7. Runtime should
be python27
application: your_app
version: 1
runtime: python27 #important
api_version: 1
threadsafe: true
handlers:
- url: /.*
script: your_app.py
What command are you running to run your program?
Do this -
you@your-computer:~/GAE_folder$ python dev_appserver.py /path/to/your/project/directory
And then open `localhost:8080` on your browser.
**EDIT -**
I think I know what the problem is. It happened to me too when I first tried
out the example given on the site.
Add this bit of code to your `helloworld.py` file at the end -
def main():
app.run()
if __name__=='__main__':
main()
|
python count number of ones in a binary image
Question: What is the python module to count number of ones in a binary image ?
to rephrase,
I have a matrix that has only ones and zeros, it's of numpy array type and I
want to know how many ones are there.
Answer: You can simply use `sum`:
>>> import numpy
>>> n = numpy.random.randint(0, 2, size=(3,3))
>>> n
array([[1, 0, 1],
[0, 1, 1],
[1, 1, 1]])
>>> n.sum()
7
Since bools have integer values of 0/1 for False/True, even if the array had
elements that weren't 0 or 1 you could use a variant of this trick:
>>> n = numpy.random.randint(0, 3, size=(3,3))
>>> n
array([[2, 2, 0],
[0, 2, 0],
[1, 1, 0]])
>>> n == 1
array([[False, False, False],
[False, False, False],
[ True, True, False]], dtype=bool)
>>> (n == 1).sum()
2
|
Quit function in python program
Question: I have a program that runs in Python, without the console present (which is to
say, I've compiled it using py2exe). I want people to be able to quit from the
main menu, or by a particular key-press in-game (say, Shift+Q). I'm running
it, for now, in Windows, though I am working on compiling Linux/Mac versions.
Pressing the X button works if there's no 'while' loop running, it seems, and
that closes it correctly, otherwise it seems to 'store' the close command wait
until the current loop is closed.
As for menu options, I've looked thoroughly through documentation and
Stackoverflow and tried quit(), exit(), sys.exit() and every combination I can
find, but every time I get:
Traceback (most recent call last):
File "alphatime.pyw", line 61177, in <module>
File "alphatime.pyw", line 53970, in place_menu
NameError: global name 'sys' is not defined
if I try sys.exit, and then:
Traceback (most recent call last):
File "alphatime.pyw", line 61177, in <module>
File "alphatime.pyw", line 53970, in place_menu
NameError: global name 'quit' is not defined
if I try just "quit()". I've heard about 'Raising' things like a need to close
the program, but I'm not clear what that means (I'm new to Python) and how I
would go about doing that.
So, my question is two-fold.
Firstly, is there something I can put in loops for recognizing keypresses
something that will recognize the 'X' being clicked, and close?
Secondly, is there an appropriate command that will just close the program? I
cannot figure out why these commands don't work, and I've had quite a few
complaints from people using the program that it crashes, or they have to
ctrl-alt-del it, or whatever. I believe
import os
try:
os._exit(return_code)
except:
pass
would work, but at this point, I'm not sure I'm competent enough at python to
deploy it appropriately. Thanks in advance!
Answer: did you by any chance
import sys
because that should work!
|
Django - consecutive dumpdata calls fail, even though work correctly when run separately
Question: I've run into an issue trying to set up automatic backups on my site. The
problem boils down to the following.
I open the Python shell and I call the dumpdata command twice. It **works**
for the first time and it returns **empty list** the second time. After that
all further dumpdata calls return empty list:
>>> python manage.py shell
>>> from django.core.management import call_command
>>> call_command("dumpdata")
[{"pk": 1, (...) // lots of data //
>>> call_command("dumpdata")
>>> []
To make it work again I need to restart the python shell.
Edit: I use Django 1.4 and Python 2.6
Edit2: My current hypothesis is that the problem is related to this issue:
<https://code.djangoproject.com/ticket/5423> \- identified 5 years ago and
according to Django 1.5 release notes, to-be resolved in the next release.
Does anybody have an idea how to workaround this issue without altering the
1.4 framework code being run on the machine?
Edit3: However sql dump of the whole database is only 0.5 MB, which makes it
rather unprobable that the serialization is running out of memory. And anyway,
wouldn't I get an explicit error in such case?
Edit4: Mystery solved. As Tomasz Gandor correctly determined, the problem was
that shell executes the commands in one transaction, and after one of the
commands causes DBError, further DB calls are ignored, as described here:
<https://code.djangoproject.com/ticket/10813> . Why the DB error during the
first dumpdata wasn't explicitely reported remains a mystery to me.
Answer: I see that django is messing something with transactions.
I executed a simple example under the debugger:
# test.py
from django.core.management import call_command
call_command("dumpdata")
print "\n---"
call_command("dumpdata")
print
And called it like:
DJANGO_SETTINGS_MODULE=settings python test.py > log.txt
My log.txt ended with "---\n[]\n"
After running it in the debugger i found, deep down in
`django.core.management.commands.dumpdata.handle()` that model.objects.all()
keeps returning [].
I called model.objects.iterator(), and got the exception:
(Pdb) list(model.objects.iterator())
*** Error in argument: '(model.objects.iterator())'
(Pdb) p list(model.objects.iterator())
*** DatabaseError: DatabaseError('current transaction is aborted, commands ignored until end of transaction block\n',)
(Pdb)
So, I hacked together code, which plays with the transaction itself:
# test.py version 2.0!
#!/usr/bin/env python
# from django.core.management import call_command
import django.core.management as mgmt
from django.db import transaction
'''
try:
import settings # Assumed to be in the same directory.
except ImportError:
import sys
sys.stderr.write("Error: Can't find the file 'settings.py' in the directory containing %r. It appears you've customized things.\nYou'll have to run django-admin.py, passing it your settings module.\n(If the file settings.py does indeed exist, it's causing an ImportError somehow.)\n" % __file__)
sys.exit(1)
'''
@transaction.commit_manually
def main():
# mgmt.call_command('dumpdata', use_base_manager=True)
mgmt.call_command('dumpdata')
transaction.rollback()
print
print '---'
print
"""
mgmt._commands = None
import sys
reload(sys.modules['django.core.management.commands.dumpdata'])
"""
mgmt.call_command('dumpdata')
transaction.rollback()
print
if __name__ == "__main__":
main()
This spits out the whole database - every time!
|
basic multiprocessing with python
Question: I have found information on multiprocessing and multithreading in python but I
don't understand the basic concepts and all the examples that I found are more
difficult than what I'm trying to do.
I have X independent programs that I need to run. I want to launch the first Y
programs (where Y is the number of cores of my computer and X>>Y). As soon as
one of the independent programs is done, I want the next program to run in the
next available core. I thought that this would be straightforward, but I keep
getting stuck on it. Any help in solving this problem would be much
appreciated.
Edit: Thanks a lot for your answers. I also found another solution using the
joblib module that I wanted to share. Suppose that you have a script called
'program.py' that you want to run with different combination of the input
parameters (a0,b0,c0) and you want to use all your cores. This is a solution.
import os
from joblib import Parallel, delayed
a0 = arange(0.1,1.1,0.1)
b0 = arange(-1.5,-0.4,0.1)
c0 = arange(1.,5.,0.1)
params = []
for i in range(len(a0)):
for j in range(len(b0)):
for k in range(len(c0)):
params.append((a0[i],b0[j],c0[k]))
def func(parameters):
s = 'python program.py %g %g %g' % parameters[0],parameters[1],parameters[2])
command = os.system(s)
return command
output = Parallel(n_jobs=-1,verbose=1000)(delayed(func)(i) for i in params)
Answer: You want to use
[`multiprocessing.Pool`](http://docs.python.org/library/multiprocessing.html#using-
a-pool-of-workers), which represents a "pool" of workers (default one per
core, though you can specify another number) that do your jobs. You then
submit jobs to the pool, and the workers handle them as they become available.
The easiest function to use is
[`Pool.map`](http://docs.python.org/library/multiprocessing.html#multiprocessing.pool.multiprocessing.Pool.map),
which runs a given function for each of the arguments in the passed sequence,
and returns the result for each argument. If you don't need return values, you
could also use `apply_async` in a loop.
def do_work(arg):
pass # do whatever you actually want to do
def run_battery(args):
# args should be like [arg1, arg2, ...]
pool = multiprocessing.Pool()
ret_vals = pool.map(do_work, arg_tuples)
pool.close()
pool.join()
return ret_vals
If you're trying to call external programs and not just Python functions, use
[`subprocess`](http://docs.python.org/library/subprocess.html). For example,
this will call `cmd_name` with the list of arguments passed, raise an
exception if the return code isn't 0, and return the output:
def do_work(subproc_args):
return subprocess.check_output(['cmd_name'] + list(subproc_args))
|
java.io.FileNotFoundException: C:\Program Files\Apache Software Foundation\Tomcat 7.0\logs\localhost_access_log.2012-07-12.txt (Access is denied)
Question: I'm trying to test my servlet by running it on Tomcat. However, I get the
above error (sometimes this error occurs, but earlier the servlet was running
fine). A few facts:
1. I've looked thoroughly at the explanations given by [this similar problem](http://stackoverflow.com/questions/10207033/http-status-404-description-the-requested-resource-is-not-available-apache-t), as well as in [here](http://stackoverflow.com/questions/4728110/the-requested-resource-is-not-available-when-running-tomcat-7-0-after-downl), and [here](http://stackoverflow.com/questions/2280064/tomcat-started-in-eclipse-but-unable-to-connect-to-link-to-http-localhost8085)
2. When I attempt to restart Tomcat (from within Eclipse's "Servers" tab), I get some error log from the console:
"SEVERE: Failed to open access log file [~\Tomcat
7.0\logs\localhost_access_log.2012-07-12.txt]" and at the very end of the log
output, there's "INFO: SessionListener:
sessionDestroyed('E9A6117FDF54752D80A1B9B72F2B83D3') -- see more info at the
bottom of this text
1. I've looked at my log files at " C:\Program Files\Apache Software Foundation\Tomcat 7.0\logs" and there is not file with contents similar to the ones in item (2) above
2. I 'deploy' my application through Eclipse (that is, during development, I depend on Eclipse to start Tomcat), only doing a real deployment when I have a stable version of my project by copying the appropriate java class files into Tomcat's /webapps/WEB-INF/classes folder and restarting Tomcat
and most importantly, 5\. Typing in "http://localhost:8080" leads me to the
Tomcat homepage (so I'm pretty sure the server is running), whereas
"http://localhost:8080/MyProjectName/MyServlet" in the browser leads to the
error shown this question's title.
Any ideas/help? Thank you very much!
See more of the error logs here
>!Jul 12, 2012 6:18:18 PM org.apache.catalina.core.AprLifecycleListener init
INFO: The APR based Apache Tomcat Native library which allows optimal performance in production environments was not found on the java.library.path: C:\Program Files\Java\jdk1.7.0\jre\bin;C:\Windows\Sun\Java\bin;C:\Windows\system32;C:\Windows;C:/Program Files/Java/jre7/bin/client;C:/Program Files/Java/jre7/bin;C:/Program Files/Java/jre7/lib/i386;C:\Users\Kiptoo\introcs\java\bin;C:\Windows\system32;C:\Windows;C:\Windows\system32\wbem;C:\Program Files\MiKTeX 2.8\miktex\bin;C:\Windows\System32\WindowsPowerShell\v1.0;C:\Program Files\Matlab\R2010a\runtime\win32;C:\Program Files\Matlab\R2010a\bin;C:\Program Files\TortoiseSVN\bin;C:\Program Files\QuickTime\QTSystem;C:\Users\Kiptoo\introcs\bin;C:\Users\Kiptoo\introcs\java\bin;C:\Python27;C:\Program Files\Eclipse;;.
Jul 12, 2012 6:18:20 PM org.apache.coyote.AbstractProtocol init
INFO: Initializing ProtocolHandler ["http-bio-8080"]
Jul 12, 2012 6:18:20 PM org.apache.coyote.AbstractProtocol init
INFO: Initializing ProtocolHandler ["ajp-bio-8009"]
Jul 12, 2012 6:18:20 PM org.apache.catalina.startup.Catalina load
INFO: Initialization processed in 2050 ms
Jul 12, 2012 6:18:20 PM org.apache.catalina.core.StandardService startInternal
INFO: Starting service Catalina
Jul 12, 2012 6:18:20 PM org.apache.catalina.core.StandardEngine startInternal
INFO: Starting Servlet Engine: Apache Tomcat/7.0.25
Jul 12, 2012 6:18:20 PM org.apache.catalina.valves.AccessLogValve open
SEVERE: Failed to open access log file [C:\Program Files\Apache Software Foundation\Tomcat 7.0\logs\localhost_access_log.2012-07-12.txt]
java.io.FileNotFoundException: C:\Program Files\Apache Software Foundation\Tomcat 7.0\logs\localhost_access_log.2012-07-12.txt (Access is denied)
at java.io.FileOutputStream.open(Native Method)
at java.io.FileOutputStream.<init>(FileOutputStream.java:212)
at org.apache.catalina.valves.AccessLogValve.open(AccessLogValve.java:1115)
at org.apache.catalina.valves.AccessLogValve.startInternal(AccessLogValve.java:1222)
at org.apache.catalina.util.LifecycleBase.start(LifecycleBase.java:150)
at org.apache.catalina.core.StandardPipeline.startInternal(StandardPipeline.java:185)
at org.apache.catalina.util.LifecycleBase.start(LifecycleBase.java:150)
at org.apache.catalina.core.ContainerBase.startInternal(ContainerBase.java:1144)
at org.apache.catalina.core.StandardHost.startInternal(StandardHost.java:782)
at org.apache.catalina.util.LifecycleBase.start(LifecycleBase.java:150)
at org.apache.catalina.core.ContainerBase$StartChild.call(ContainerBase.java:1568)
at org.apache.catalina.core.ContainerBase$StartChild.call(ContainerBase.java:1558)
at java.util.concurrent.FutureTask$Sync.innerRun(FutureTask.java:334)
at java.util.concurrent.FutureTask.run(FutureTask.java:166)
at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1110)
at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:603)
at java.lang.Thread.run(Thread.java:722)
Jul 12, 2012 6:18:20 PM org.apache.catalina.startup.HostConfig deployDirectory
INFO: Deploying web application directory C:\Program Files\Apache Software Foundation\Tomcat 7.0\webapps\AndroidTest
Jul 12, 2012 6:18:20 PM org.apache.catalina.core.StandardContext postWorkDirectory
WARNING: Failed to create work directory [C:\Program Files\Apache Software Foundation\Tomcat 7.0\work\Catalina\localhost\AndroidTest] for context [/AndroidTest]
Jul 12, 2012 6:18:21 PM org.apache.catalina.util.SessionIdGenerator createSecureRandom
INFO: Creation of SecureRandom instance for session ID generation using [SHA1PRNG] took [175] milliseconds.
Jul 12, 2012 6:18:21 PM org.apache.jasper.EmbeddedServletOptions <init>
SEVERE: The scratchDir you specified: C:\Program Files\Apache Software Foundation\Tomcat 7.0\work\Catalina\localhost\AndroidTest is unusable.
Jul 12, 2012 6:18:21 PM org.apache.catalina.startup.HostConfig deployDirectory
INFO: Deploying web application directory C:\Program Files\Apache Software Foundation\Tomcat 7.0\webapps\docs
Jul 12, 2012 6:18:21 PM org.apache.catalina.startup.HostConfig deployDirectory
INFO: Deploying web application directory C:\Program Files\Apache Software Foundation\Tomcat 7.0\webapps\examples
Jul 12, 2012 6:18:21 PM org.apache.catalina.core.ApplicationContext log
INFO: ContextListener: contextInitialized()
Jul 12, 2012 6:18:21 PM org.apache.catalina.core.ApplicationContext log
INFO: SessionListener: contextInitialized()
Jul 12, 2012 6:18:21 PM org.apache.catalina.core.ApplicationContext log
INFO: ContextListener: attributeAdded('org.apache.jasper.compiler.TldLocationsCache', 'org.apache.jasper.compiler.TldLocationsCache@ff8399')
Jul 12, 2012 6:18:21 PM org.apache.catalina.startup.HostConfig deployDirectory
INFO: Deploying web application directory C:\Program Files\Apache Software Foundation\Tomcat 7.0\webapps\host-manager
Jul 12, 2012 6:18:22 PM org.apache.catalina.startup.HostConfig deployDirectory
INFO: Deploying web application directory C:\Program Files\Apache Software Foundation\Tomcat 7.0\webapps\manager
Jul 12, 2012 6:18:22 PM org.apache.catalina.startup.HostConfig deployDirectory
INFO: Deploying web application directory C:\Program Files\Apache Software Foundation\Tomcat 7.0\webapps\ROOT
Jul 12, 2012 6:18:22 PM org.apache.coyote.AbstractProtocol start
INFO: Starting ProtocolHandler ["http-bio-8080"]
Jul 12, 2012 6:18:22 PM org.apache.coyote.AbstractProtocol start
INFO: Starting ProtocolHandler ["ajp-bio-8009"]
Jul 12, 2012 6:18:22 PM org.apache.catalina.startup.Catalina start
INFO: Server startup in 2225 ms
Jul 12, 2012 6:19:22 PM org.apache.catalina.core.ApplicationContext log
INFO: SessionListener: sessionDestroyed('E9A6117FDF54752D80A1B9B72F2B83D3')
Answer: > only doing a real deployment when I have a stable version of my project by
> copying the appropriate java class files into Tomcat's /webapps/WEB-
> INF/classes folder and restarting Tomcat
Stop right there: you should never put any files into `webapps/WEB-INF` and
expect anything good to come of it. Deploy your webapp properly, using a well-
accepted packaging such as a WAR file or an exploded-WAR structure into the
webapps directory.
Second, the problem is obvious: `java.io.FileNotFoundException: C:\Program
Files\Apache Software Foundation\Tomcat
7.0\logs\localhost_access_log.2012-07-12.txt (Access is denied)`. Your Tomcat
can't write to that file. Just because you are an admin doesn't mean that
Tomcat can write to that directory: Tomcat doesn't play well with UAC as far
as I know and you are trying to write to `Program Files` which generally
requires some ugly UI credentials-entry hack.
So, check your file (and directory) permissions. Check the uid of the Tomcat
process: make sure they are all good. Finally, consider using `CATALINA_HOME`
and `CATALINA_BASE` (read the documentation for how to do that) to fix all of
your permissions issues.
|
Python Multithreading missing data
Question: useI am working on a python script to check if the url is working. The script
will write the url and response code to a log file. To speed up the check, I
am using threading and queue.
The script works well if the number of url's to check is small but when
increasing the number of url's to hundreds, some url's just will miss from the
log file.
Is there anything I need to fix?
My script is
#!/usr/bin/env python
import Queue
import threading
import urllib2,urllib,sys,cx_Oracle,os
import time
from urllib2 import HTTPError, URLError
queue = Queue.Queue()
##print_queue = Queue.Queue()
class NoRedirectHandler(urllib2.HTTPRedirectHandler):
def http_error_302(self, req, fp, code, msg, headers):
infourl = urllib.addinfourl(fp, headers, req.get_full_url())
infourl.status = code
infourl.code = code
return infourl
http_error_300 = http_error_302
http_error_301 = http_error_302
http_error_303 = http_error_302
http_error_307 = http_error_302
class ThreadUrl(threading.Thread):
#Threaded Url Grab
## def __init__(self, queue, print_queue):
def __init__(self, queue,error_log):
threading.Thread.__init__(self)
self.queue = queue
## self.print_queue = print_queue
self.error_log = error_log
def do_something_with_exception(self,idx,url,error_log):
exc_type, exc_value = sys.exc_info()[:2]
## self.print_queue.put([idx,url,exc_type.__name__])
with open( error_log, 'a') as err_log_f:
err_log_f.write("{0},{1},{2}\n".format(idx,url,exc_type.__name__))
def openUrl(self,pair):
try:
idx = pair[1]
url = 'http://'+pair[2]
opener = urllib2.build_opener(NoRedirectHandler())
urllib2.install_opener(opener)
request = urllib2.Request(url)
request.add_header('User-Agent', 'Mozilla/5.0 (Windows NT 5.1; rv:13.0) Gecko/20100101 Firefox/13.0.1')
#open urls of hosts
resp = urllib2.urlopen(request, timeout=10)
## self.print_queue.put([idx,url,resp.code])
with open( self.error_log, 'a') as err_log_f:
err_log_f.write("{0},{1},{2}\n".format(idx,url,resp.code))
except:
self.do_something_with_exception(idx,url,self.error_log)
def run(self):
while True:
#grabs host from queue
pair = self.queue.get()
self.openUrl(pair)
#signals to queue job is done
self.queue.task_done()
def readUrlFromDB(queue,connect_string,column_name,table_name):
try:
connection = cx_Oracle.Connection(connect_string)
cursor = cx_Oracle.Cursor(connection)
query = 'select ' + column_name + ' from ' + table_name
cursor.execute(query)
#Count lines in the file
rows = cursor.fetchall()
total = cursor.rowcount
#Loop through returned urls
for row in rows:
#print row[1],row[2]
## url = 'http://'+row[2]
queue.put(row)
cursor.close()
connection.close()
return total
except cx_Oracle.DatabaseError, e:
print e[0].context
raise
def main():
start = time.time()
error_log = "D:\\chkWebsite_Error_Log.txt"
#Check if error_log file exists
#If exists then deletes it
if os.path.isfile(error_log):
os.remove(error_log)
#spawn a pool of threads, and pass them queue instance
for i in range(10):
t = ThreadUrl(queue,error_log)
t.setDaemon(True)
t.start()
connect_string,column_name,table_name = "user/pass@db","*","T_URL_TEST"
tn = readUrlFromDB(queue,connect_string,column_name,table_name)
#wait on the queue until everything has been processed
queue.join()
## print_queue.join()
print "Total retrived: {0}".format(tn)
print "Elapsed Time: %s" % (time.time() - start)
main()
Answer: Python's threading module isn't really multithreaded because of the global
interpreter lock, <http://wiki.python.org/moin/GlobalInterpreterLock> as such
you should really use `multiprocessing`
<http://docs.python.org/library/multiprocessing.html> if you really want to
take advantage of multiple cores.
Also you seem to be accessing a file simultatnously
with open( self.error_log, 'a') as err_log_f:
err_log_f.write("{0},{1},{2}\n".format(idx,url,resp.code))
This is really bad AFAIK, if two threads are trying to write to the same file
at the same time or almost at the same time, keep in mind, their not really
multithreaded, the behavior tends to be undefined, imagine one thread writing
while another just closed it...
Anyway you would need a third queue to handle writing to the file.
|
Python client won't reconnect to server
Question: I'm sorry for my English, but I've some problems with my software and I need
some help. But first of all, some code!
Client side:
if connessione.connect(host, port) == True:
connect = True
print 'connection granted'
else:
connect = False
print 'connection refused'
while 1:
do_some_stuff_with_socket
if connect == False:
if connessione.connect(host, port) == True:
connect = True
Server side:(_found on the internet_)
import socket
port = 4000
host = '127.0.0.1'
server_socket = socket.socket(socket.AF_INET, socket.SOCK_STREAM)
server_socket.bind((host, port))
server_socket.listen(5)
print "Type 'Q' or 'q' to QUIT"
print "Server Waiting for client on port ", port
while 1:
client_socket, address = server_socket.accept()
print "Connection from ", address
while 1:
server_data = raw_input("--> server: ")
if server_data.lower() == 'q':
client_socket.send(server_data)
client_socket.close()
break
else:
client_socket.send(server_data)
client_data = client_socket.recv(1024)
if client_data.lower() == 'q':
print "Quit from client"
client_socket.close()
break
else:
print "<-- client: ", client_data
break
If I reboot/disconnect the server, the client does not reconnect. I used the
`.terminate()` and `.close()` methods to close the socket.
Answer: i have solved my problem by calling `.__init__()` method before the
`.connect(host, port)`
It is not elegant, but it works.
Thanks to all
|
itertools functions not showing up in pydev quick fix
Question: Using python 2.7.2 and pydev 2.5.0 and I can't seem to get eclipse to ever
suggest any functions from itertools as suggestion.
For example quick fixing the given the following: chain([1, 2, 3], [4, 5, 6])
Only gives logilab.common.compat as an option for quick fixing.
Answer: This is a known issue: PyDev will currently only discover functions it has the
source for (and as itertools is a builtin module which PyDev can't analyze, it
won't give you auto-import completions for it... note: it does work though if
you try to find the module 'itertools' and complete from it).
|
DrawingPanel.py Drawing a rubik's cube
Question: using python i'd like to draw a rubik's cube based on this picture
<http://vixra.files.wordpress.com/2010/0> ... s-cube.jpg
this is my current code <http://pastebin.com/MfF07ze4>
but i'd like the code to have at least 5 for loops and 5 functions that will
aid in the creation of the cube. also i need help with the algorithms in
creating the 3 points for the 1x1 cubes of the rubik's cube.
Answer: I don't have the `drawingpanel` module, so this is untested:
from drawingpanel import *
panel = DrawingPanel(600, 600)
from math import *
import numpy as np
class Projection(object):
def __init__(self, origin, dx, dy, dz):
self.o = np.matrix([origin[0], origin[1], 0.])
self.p = np.matrix([
[dx[0], dx[1], 0.],
[dy[0], dy[1], 0.],
[dz[0], dz[1], 0.]
])
def proj(self, x, y, z):
res = self.o + np.matrix([x, y, z]) * self.p
return (res[0,0], res[0,1])
This is a simple isometric 3d-to-2d projection - it takes a 3d coordinate and
returns the corresponding 2d screen coordinate.
proj = Projection((175,130), ( 50, -24), (-50, -24), ( 0, 70)).proj
I create a specific projection - based on your image, I make the front corner
of the cube the origin at (175,130). +X runs to the top right corner of the
cube, and I make that corner point (3,0,0) to make it easy to subdivide the
cube, which means that the screen projection of (1,0,0) is (215, 106), making
dx (50, -24); then similarly for +Y to the top left corner and +Z to the
bottom front corner.
def make_poly_pts(*args):
return [coord for pt in args for coord in proj(*pt)]
This is a utility function - it takes a list of 3d points and returns a list
of [x1, y1, x2, y2, ... xN, yN] coordinates to feed to create_polygon.
# allow for a gap between stickers
offs = 0.05
ooffs = 1. - offs
# draw top face (XY)
panel.canvas.create_polygon(*make_poly_pts((0,0,0), (3,0,0), (3,3,0), (0,3,0)), outline='black', fill='black')
for i in xrange(3):
for j in xrange(3):
panel.canvas.create_polygon(*make_poly_pts((i+offs,j+offs,0), (i+ooffs,j+offs,0), (i+ooffs,j+ooffs,0), (i+offs,j+ooffs,0)), outline='black', fill='yellow')
... then the other two faces can be created similarly by swapping axes.
|
Billing aliens via POS printer and image print
Question: I am trying to create a prototype to print bitmap data for a text file to my
LAN enabled epson pos printer TM-T88V.
While I have no problems to send text and text formatting instructions, I dont
understand, what I have to do, to make my printer print the data of the
[Arecibo message](http://en.wikipedia.org/wiki/Arecibo_message).
first few lines:
00000010101010000000000
00101000001010000000100
10001000100010010110010
10101010101010100100100
00000000000000000000000
00000000000011000000000
00000000001101000000000
00000000001101000000000
00000000010101000000000
00000000011111000000000
00000000000000000000000
11000011100011000011000
10000000000000110010000
11010001100011000011010
11111011111011111011111
00000000000000000000000
00010000000000000000010
00000000000000000000000
00001000000000000000001
The message has 73 rows and 23 columns resulting in 1679 picture elements.
Each of this elements is defined by either a 1 for black or a 0 as white and
should be printed as a square of 8x8 (or 16x16) dots. the result would result
in
From the printer's specifications:
[](http://i.stack.imgur.com/AvZUp.jpg)
While — as I said — the connecting and sending to the printer is no problem, I
just dont get, what this instruction want to tell me. What would in the case
of the Arecibo message be
**What numbers do I have to send to the printer? Do I need to send every dot?
What does`nL, nH specify the number of dots of the image data in the
horizontal direction as (nL + nH × 256).` mean?**
Here is my simple Python program I use for prototyping:
# -*- coding: utf-8 -*-
import struct
import socket
def sendInstructions(mySocket,l):
for x in l:
mySocket.send(struct.pack('h', *[x]),1)
def emphasizeOn(mySocket):
sendInstructions(mySocket,[27,33,48])
def emphasizeOff(mySocket):
sendInstructions(mySocket,[27,33,0])
def lineFeed(mySocket,number):
for i in range(number):
sendInstructions(mySocket,[0x0a,])
def paperCut(mySocket):
sendInstructions(mySocket,[29,86,0])
def sendText(mySocket,string):
mySocket.send(string.encode('UTF-8'))
def main():
mySocket = socket.socket ( socket.AF_INET, socket.SOCK_STREAM )
mySocket.connect(('192.168.1.15',9100))
lines = ["Hello,","World!"]
emphasizeOff(mySocket)
lineFeed(mySocket,2)
for l in lines:
if lines.index(l) == 0:
emphasizeOn(mySocket)
else:
emphasizeOff(mySocket)
sendText(mySocket,l)
lineFeed(mySocket,2)
lineFeed(mySocket,4)
paperCut(mySocket)
mySocket.close()
if __name__=="__main__":
main()
Answer: This command generates one horizontal strip of the image at a time. The strip
is either 8 or 24 dots tall, depending on the value of m.
nL and nH are the low and high bytes of an integer that specifies the width in
dots of the horizontal strip of image. That width is computed as nL + nH *
256, so if you wanted the image to be 550 dots wide, then nH=2 and nL=38.
The argument d is the bitmap data; if the image strip is 8 dots tall, then
each byte represents one column in the strip. If the strip is 24 dots tall,
then three bytes represent one column.
So let's say you have arecibo in a WxH numpy array of ints, 1 or 0. You would:
data = np.zeros((W, H), dtype=np.ubyte)
## (fill in data here)
## Use m=33 since this is apparently the only mode with
## square pixels and also the highest resolution
## (unless it prints too slowly for your liking)
m = 33
nH = W // 256 ## note this is integer division, but SO's
## syntax hilighting thinks it looks like a comment.
nL = W % 256
## Divide the array into sections with shape Wx24:
for n in range(data.shape[1] // 24):
## Note that if the image height is not a multiple of 24,
## you'll have to pad it with zeros somehow.
strip = data[:, n*24:(n+1)*24]
## Convert each strip into a string of bytes:
strip = strip.reshape(W, 3, 8)
bytes = (strip * (2**np.arange(8)[np.newaxis, np.newaxis, :])).sum(axis=2) # magic
byteString = bytes.astype(np.ubyte).tostring()
## Send the command to POS
|
How to run an xpath over html page in python?
Question: I think using lxml library in python can help, but not able to find out how to
do this??
Answer: A simple starting point...
import lxml.html
page = lxml.html.parse('http://www.google.com').getroot()
print page.xpath('//a/@href')
|
Why can urlopen download a Google search page but not a Google Scholar search page?
Question: I'm using **Python 3.2.3's** `urllib.request` module to download Google search
results, but I'm getting an odd error in that `urlopen` works with links to
Google search results, but not Google Scholar. In this example, I'm searching
for `"JOHN SMITH"`. This code successfully prints HTML:
from urllib.request import urlopen, Request
from urllib.error import URLError
# Google
try:
page_google = '''http://www.google.com/#hl=en&sclient=psy-ab&q=%22JOHN+SMITH%22&oq=%22JOHN+SMITH%22&gs_l=hp.3..0l4.129.2348.0.2492.12.10.0.0.0.0.154.890.6j3.9.0...0.0...1c.gjDBcVcGXaw&pbx=1&bav=on.2,or.r_gc.r_pw.r_qf.,cf.osb&fp=dffb3b4a4179ca7c&biw=1366&bih=649'''
req_google = Request(page_google)
req_google.add_header('User Agent', 'Mozilla/5.0 (Windows NT 6.1; WOW64; rv:15.0) Gecko/20120427 Firefox/15.0a1')
html_google = urlopen(req_google).read()
print(html_google[0:10])
except URLError as e:
print(e)
but this code, doing the same for Google Scholar, raises a `URLError`
exception:
from urllib.request import urlopen, Request
from urllib.error import URLError
# Google Scholar
try:
page_scholar = '''http://scholar.google.com/scholar?hl=en&q=%22JOHN+SMITH%22&btnG=&as_sdt=1%2C14'''
req_scholar = Request(page_scholar)
req_scholar.add_header('User Agent', 'Mozilla/5.0 (Windows NT 6.1; WOW64; rv:15.0) Gecko/20120427 Firefox/15.0a1')
html_scholar = urlopen(req_scholar).read()
print(html_scholar[0:10])
except URLError as e:
print(e)
Traceback:
Traceback (most recent call last):
File "/home/ak5791/Desktop/code-sandbox/scholar/crawler.py", line 6, in <module>
html = urlopen(page).read()
File "/usr/lib/python3.2/urllib/request.py", line 138, in urlopen
return opener.open(url, data, timeout)
File "/usr/lib/python3.2/urllib/request.py", line 369, in open
response = self._open(req, data)
File "/usr/lib/python3.2/urllib/request.py", line 387, in _open
'_open', req)
File "/usr/lib/python3.2/urllib/request.py", line 347, in _call_chain
result = func(*args)
File "/usr/lib/python3.2/urllib/request.py", line 1155, in http_open
return self.do_open(http.client.HTTPConnection, req)
File "/usr/lib/python3.2/urllib/request.py", line 1138, in do_open
raise URLError(err)
urllib.error.URLError: <urlopen error [Errno -5] No address associated with hostname>
I obtained these links by searching in Chrome and copying the link from there.
One commenter reported a 403 error, which I sometimes get as well. I presume
this is because Google doesn't support scraping of Scholar. However, changing
the User Agent string doesn't fix this _or the original problem_ , since I get
`URLErrors` most of the time.
Answer: [This PHP
script](https://code.google.com/p/bioguid/source/browse/trunk/www/scholar_ris.php)
seems to indicate you'll need to set some cookies before Google gives you
results:
/*
Need a cookie file (scholar_cookie.txt) like this:
# Netscape HTTP Cookie File
# http://curlm.haxx.se/rfc/cookie_spec.html
# This file was generated by libcurl! Edit at your own risk.
.scholar.google.com TRUE / FALSE 2147483647 GSP ID=353e8f974d766dcd:CF=2
.google.com TRUE / FALSE 1317124758 PREF ID=353e8f974d766dcd:TM=1254052758:LM=1254052758:S=_biVh02e4scrJT1H
.scholar.google.co.uk TRUE / FALSE 2147483647 GSP ID=f3f18b3b5a7c2647:CF=2
.google.co.uk TRUE / FALSE 1317125123 PREF ID=f3f18b3b5a7c2647:TM=1254053123:LM=1254053123:S=UqjRcTObh7_sARkN
*/
This is corroborated by [Python recipe for Google Scholar
comment](http://code.activestate.com/recipes/523047-search-google-
scholar/#c2), which includes a warning that Google detects scripts and will
disable you if you use it too prolifically.
|
python example for reading multiple protobuf messages from a stream
Question: I'm working with data from spinn3r, which consists of multiple different
protobuf messages serialized into a byte stream:
<http://code.google.com/p/spinn3r-client/wiki/Protostream>
"A protostream is a stream of protocol buffer messages, encoded on the wire as
length prefixed varints according to the Google protocol buffer specification.
The stream has three parts: a header, the payload, and a tail marker."
This seems like a pretty standard use case for protobufs. In fact, protobuf
core distribution provides CodedInputStream for both C++ and Java. But, it
appears that protobuf does not provide such a tool for python -- the
'internal' tools are not setup for this kind of external use:
<https://groups.google.com/forum/?fromgroups#!topic/protobuf/xgmUqXVsK-o>
So... before I go and cobble together a python varint parser and tools for
parsing a stream of different message types: does anyone know of any tools for
this?
Why is it missing from protobuf? (Or am I just failing to find it?)
This seems like a big gap for protobuf, especially when compared to thrift's
equivalent tools for both 'transport' and 'protocol'. Am I viewing that
correctly?
Answer: I looks like the code in the other answer is potentially lifted from
[here](https://code.google.com/r/avenka-
co1/source/browse/src/python/varint.py?spec=svn2b97a552eb2c39cfe62b62dbc303b6e86c47ec4b&name=series34&r=2b97a552eb2c39cfe62b62dbc303b6e86c47ec4b).
Check the licence before using this file but I managed to get it to read
`varint32`s using code such as this:
import sys
import myprotocol_pb2 as proto
import varint # (this is the varint.py file)
data = open("filename.bin", "rb").read() # read file as string
decoder = varint.decodeVarint32 # get a varint32 decoder
# others are available in varint.py
next_pos, pos = 0, 0
while 1:
msg = proto.Msg() # your message type
next_pos, pos = decoder(data, pos)
msg.ParseFromString(data[pos:pos + next_pos])
if msg.type == proto.Msg.END: # example check for end
break
# use parsed message
pos += next_pos
print "done!"
This is very simple code designed to load messages of a single type delimited
by `varint32`s which describe the next message's size. Watch for the infinite
loop and add error handling.
|
Transform filter function to Python code
Question: I'm trying to understand how to transform a filter, in this case a
Notch(stopband) filter, to Python but I don't know how.
x(n)=-2*x(n)/(-0.9*x(n) -0.9*x(n-1))
Can anyone help me please?
Thanks in advance.
Answer: If you're using numpy arrays, this should work:
x[1:]=-2*x[1:]/(-0.9*x[1:]-0.9*x[:-1])
this changes your array in place, but you could just as easily assign it to a
new array.
y=-2*x[1:]/(-0.9*x[1:]-0.9*x[:-1])
Note that your algorithm isn't really well defined for the 0th element, so my
translation leaves `x[0]` unchanged.
**EDIT**
To change an iterable to a numpy array:
import numpy as np
x=np.array(iterable) #pretty easy :) although there could be more efficient ways depending on where "iterable" comes from.
|
How should I get Open Graph JSON object to pass in facepy class
Question: I am trying to configure Open Graph in my app such that, when ever a person
click a "link" in it, the app should "post" it on his feeds/ timeline/
activity. (_`I created open graph actions for these features and successfully
added meta tags in the page`_).
So, I am using `fandjango` and `facepy` to do this job.
This is how my code looks..
from facepy import GraphAPI
@csrf_exempt
@facebook_authorization_required(permissions=["publish_actions"])
def ViewPage (request):
access_token = request.facebook.user.oauth_token
profile_id = request.facebook.user.facebook_id
path = "/%d/feed" %profile_id
# How should I get the OpenGraph JSON obj
og_data = ??
graph = GraphAPI(access_token)
graph.post(path, og_data)
...
return render_to_response("view.html", context)
How should I get the open graph JSON obj to pass in the above `graph` object
as parameter so as to post data in feeds/ timeline/ activity?
If this is not the way, how should I do it?
**Edit 1:**
when I tried
graph = GraphAPI(request.facebook.user.oauth_token)
graph.post("me/namespace:action")
It showed me `OAuthError`
Error Loc: C:\Python27\lib\site-packages\facepy\graph_api.py in _parse, line 274
graph = GraphAPI(request.facebook.user.oauth_token)
graph.post("me/namespace:action", "object type")
It showed me `TypeError`
loc: same as previous
**Edit 2:**
Instead to using `request.facebook.user.oauth_token`, I directly used my
[`access token`](https://developers.facebook.com/tools/access_token/) and the
code worked..
graph = GraphAPI (my-hard-coded-access-token)
graph.post("me/feed", message = "working!")
However, when I tried
graph.post("me/news.reads", article="working")
It showed me error.
Answer: > I created open graph actions
You shouldn't be using `me/feed` then
The OpenGraph calls are as follows
me/[app_namespace]:[action_type]?[object_type]=[OBJECT_URL]
So, to achieve the same just set the path to
`me/[app_namespace]:[action_type]`
graph.post(
path = 'me/[app_namespace]:[action_type]',
[object_type] = '[OBJECT_URL]'
)
`og_data` is not a parameter in the call. So if your `object_type` is `recipe`
then it would be
graph.post(path, recipe)
If you want to continue to use `me/feed` then it should be
graph.post(path, link)
as described at
<http://developers.facebook.com/docs/reference/api/user/#posts>
* * *
You cannot do customs read actions like that, the proper call should be
graph.post(
path = 'me/news.reads',
article = 'http://yourobjecturl/article.html'
)
Please read the documentation
<http://developers.facebook.com/docs/opengraph/actions/builtin/#read>
|
error when importing ijson module python
Question: I need to parse some large (2 Gb+) files into python. I have tried it with the
json module but I get a memory error as its methods all load the files at
once. I then moved on into installing ijson which suposedly implements a
iterator-based way of parsing the file. However when I run:
import ijson
I get exception : YAJL shared object not found.
Has anyone found a similar issue? any help would be greatly appreciated
Regards
Answer: Thats an easy one, that is because you haven't installed the YAJL C library!
ijson is a wrapper around the YAJL without it won't work.
|
Why is the unittest's assert methods slower than raw assertion?
Question: unittest comes with many assert methods. I did a timeit test on using built-in
Python `assert` and comparison operator vs built-in simple unittest assertion.
#!/usr/bin/python
import timeit
s = """\
import unittest
class TestRepomanManExtFunctions(unittest.TestCase):
def test1(self):
someObj = object()
newObj = someObj
self.assertEqual(someObj, newObj)
def test2(self):
str1 = '11111111111111111111111111111111111111'
str2 = '33333333333333333333333333333333333333'
self.assertNotEqual(str1, str2)
if __name__ == '__main__':
unittest.main()
"""
t = timeit.Timer(stmt=s)
print "%.2f usec/pass" % (1000000 * t.timeit(number=100000)/100000)
s2 = """\
import unittest
class TestRepomanManExtFunctions(unittest.TestCase):
def test1(self):
someObj = object()
newObj = someObj
assert someObj == newObj
def test2(self):
str1 = '11111111111111111111111111111111111111'
str2 = '33333333333333333333333333333333333333'
assert str1 != str2
if __name__ == '__main__':
unittest.main()
"""
t = timeit.Timer(stmt=s2)
print "%.2f usec/pass" % (1000000 * t.timeit(number=100000)/100000)
The results are
yeukhon@yeukhon-P5E-VM-DO:/tests$ python t.py
1203.46 usec/pass
873.06 usec/pass
yeukhon@yeukhon-P5E-VM-DO:tests$ vim t.py
yeukhon@yeukhon-P5E-VM-DO:tests$ python t.py
1300.33 usec/pass
956.35 usec/pass
yeukhon@yeukhon-P5E-VM-DO:tests$ python t.py
1208.82 usec/pass
865.18 usec/pass
One advantage of using the unittest's built-in assert methods is that it tells
the user what is actually being compared. An example from of my actual tests:
======================================================================
FAIL: test_000_write_to_file_directory_not_exist (__main__.TestRepomanManExtFunctions)
Test writing content to a new file whose parent directory
----------------------------------------------------------------------
Traceback (most recent call last):
File "/usr/local/lib/python2.7/dist-packages/mock.py", line 1224, in patched
return func(*args, **keywargs)
File "test_ext.py", line 71, in test_000_write_to_file_directory_not_exist
self.assertNotEqual(mk_exists.call_args_list, exists_call_list)
AssertionError: [call('/tmp/test/fake/')] == [call('/tmp/test/fake/')]
Here is using simple `assert X = Y`
======================================================================
FAIL: test_000_write_to_file_directory_not_exist (__main__.TestRepomanManExtFunctions)
Test writing content to a new file whose parent directory
----------------------------------------------------------------------
Traceback (most recent call last):
File "/usr/local/lib/python2.7/dist-packages/mock.py", line 1224, in patched
return func(*args, **keywargs)
File "test_ext.py", line 72, in test_000_write_to_file_directory_not_exist
assert exists_call_list != mk_exists.call_args_list
AssertionError
Besides this advantage, what other nice things can we do by utilising the
built-in `self.assert_*(...)`?
Why is the raw faster? I know accessing attribute and checking against a class
is generally slower. But I want to know what's going on too? I hope this is a
valid question.
Thanks
Answer: Probably the assert* function is slower because there is overhead in calling
it (pushing parameters to stack, calling, popping return address from stack
etc.), compared to the assert keyword which is executed inline. The assert*
functions have some other nice properties as you have mentioned, like printing
the expected and actual value.
Are you asking out of curiosity or is this an actual problem? I'd be surprised
to see any situation where the speed of asserts is a bottleneck.
|
Import Local module over global python
Question: I have a 2 python files. One is trying to import the second. My problem is
that the second is named math.py. I can not rename it. When I attempt to call
a function that is located inside math.py, I can not because I end up with the
global math module. How would I import my local file instead of the global. I
am using Python 2.7, and this is(roughly) my import statment:
cstr = "math"
command = __import__(cstr)
Later I try:
command.in_math_py_not_global()
**Edit:** a more complete example:
def parse(self,string):
clist = string.split(" ")
cstr= clist[0]
args = clist[1:len(clist)]
rvals = []
try:
command = __import__(cstr)
try:
rvals.extend(command.main(args))
except:
print sys.exc_info()
except ImportError:
print "Command not valid"
Answer: Python processes have a single namespace of loaded modules. If you (or _any
other module_) has already loaded the standard `math` module for any reason,
then trying to load it again with `import` or `__import__()` will simply
return a reference to the already-loaded module. You should be able to verify
this using `print id(math)` and comparing with `print id(command)`.
Although you've stated that you are unable to change the name of `math.py`, I
suggest you can. You are getting the name of the module to load from the user.
You can modify this before actually using the `__import__()` function to add a
prefix. For example:
command = __import__("cmd_" + cstr)
Then, rename `math.py` to `cmd_math.py` and you will avoid this conflict.
|
No autoincrement for Integer Primary key in sqlite3
Question: In the sqlite3 [faq](http://www.sqlite.org/faq.html#q1), it is mentioned that
an integer primary key being fed a null value would autoincrement. But this is
not happening for me.
to replicate, a table in sqlite3, `CREATE TABLE dummy( serial_num INTEGER
PRIMARY KEY, name TEXT);` and fill it using python,
import sqlite3 as lite
con = lite.connect('some.db')
cur=con.cursor()
data = "someone's name"
cur.execute("INSERT INTO dummy VALUES(NULL, ?)", data)
con.commit()
The first attribute serial_num is being shown blank while the name attribute
is fine. When I do `SELECT serial_num FROM dummy` I just get a bunch of blank
spaces. What am I doing wrong?
Answer: This is one of SQLite's quirks. From the [fine
manual](http://www.sqlite.org/lang_createtable.html#primkeyconst):
> According to the SQL standard, PRIMARY KEY should always imply NOT NULL.
> Unfortunately, due to a long-standing coding oversight, this is not the case
> in SQLite. Unless the column is an INTEGER PRIMARY KEY SQLite allows NULL
> values in a PRIMARY KEY column. We could change SQLite to conform to the
> standard (and we might do so in the future), but by the time the oversight
> was discovered, SQLite was in such wide use that we feared breaking legacy
> code if we fixed the problem.
The documentation on [INTEGER PRIMARY
KEY](http://www.sqlite.org/lang_createtable.html#rowid) is a little unclear
about what precisely is required for a column to be this special INTEGER
PRIMARY KEY that auto-increments but the reality is that the column needs to
be NOT NULL if you want to use the NULL value to mean "give me the next auto-
incrementing value" when inserting:
create table dummy (
serial_num integer primary key not null,
name text
);
If you leave out the `not null`, you need to do your inserts like this:
insert into dummy (name) values (?)
to get the auto-increment value for `serial_num`. Otherwise, SQLite has no way
of telling the difference between a NULL meaning "give me the next auto-
increment value" and a NULL meaning "put a NULL value in `serial_num` because
the column allows NULLs".
|
How do I check lists of numeric data for a certain number using an "if" statement in Python?
Question: Currently, I am attempting to retrieve numeric data from different CSV files.
I then place that data in lists in Python. However, I'm struggling to get
Python to determine if there is a value in each separate list of data that is
greater than a certain number. I need to be able to search each list
separately for some value at which point Python should return some text of my
choice. I'm not sure what I'm missing, but Python doesn't seem to be handling
my syntax as I was hoping.
import csv
stocks = ['JPM','PG','KO','GOOG']
for stock in stocks:
Data = open("%sMin.csv" % (stock), 'r')
Ticker = []
for row in Data:
Ticker.append(row.strip().split(','))
if Ticker > 735:
print "%s Minimum" % (stock)
I modified the code the other stock became Ticker to remove the confusion.
Answer: There are three things wrong, preventing you from getting the result.
1. `stock` is a list of values, so you aren't able to directly do a numeric comparison to the list itself.
2. You are appending lists to the list. So even if you were operating on each value you will be comparing a list to an int. Either figure out which element to append, or add them all appropriately.
3. Find the max value in that list to compare to you int.
First, append floats to your list:
float(stock_value)
Second, figure out which index of your split row is the numeric value. If they
are all numeric values, then add them all to the list by extending:
# only convert items to float that are not empty strings
stock.extend(float(val) for val in row.strip().split(',') if val.strip())
If its say, the first column, add just that one:
stock.append(float(row.strip().split(',')[0]))
Third, if you simply want to know if a value greater than 735 is in your list,
you can simply ask it for the max value of the list:
if max(stock) > 735:
print "%s Minimum" % (stock)
|
Python repeating CSV file
Question: I'm attempting to load numerical data from CSV files in order to loop through
the calculated data of each stock(file) separately and determine if the
calculated value is greater than a specific number (731 in this case).
However, the method I am using seems to make Python repeat the list as well as
add quotation marks around the numbers ('500'), as an example, making them
strings. Unfortunately, I think the final "if" statement can't handle this and
as a result it doesn't seem to function appropriately. I'm not sure what's
going on and why Python what I need to do to get this code running properly.
import csv
stocks = ['JPM','PG','GOOG','KO']
for stock in stocks:
Data = open("%sMin.csv" % (stock), 'r')
stockdata = []
for row in Data:
stockdata.extend(map(float, row.strip().split(',')))
stockdata.append(row.strip().split(',')[0])
if any(x > 731 for x in stockdata):
print "%s Minimum" % (stock)
Answer: Currently you're adding all columns of each row to a list, then adding to the
end of that, the first column of the row again? So are all columns
significant, or just the first?
You're also loading all data from the file before the comparison but don't
appear to be using it anywhere, so I guess you can shortcut earlier...
If I understand correctly, your code should be this (or amend to only compare
first column).
Are you basically writing this?
import csv
STOCKS = ['JPM', 'PG', 'GOOG', 'KO']
for stock in STOCKS:
with open('{}Min.csv'.format(stock)) as csvin:
for row in csv.reader(csvin):
if any(col > 731 for col in map(float, row)):
print '{} minimum'.format(stock)
break
|
Importing from sub-folder hierarchy in python
Question: i am trying to import specified modules from test_file hierarchy
something like :
test_case1.py
test_subsuite_2
test_sub_2.1.1.py
test_suite2
is it possible to do a run import on this hierarchy
/project/main.py
/project/test_files
test_files folder hierarchy is like this :
test_files
test_suite1
test_case1.py
test_subsuite_1
test_sub1_1.py
test_sub1_2.py
test_subsuite_2
test_subsuite_2_1
test_sub_2.1.1.py
test_sub2_1.py
test_sub3_2.py
test_suite2
test_case2.py
test_subsuite2_1
test_sub21_1.py
test_sub21_2.py
test_subsuite2_2
test_sub22_1.py
test_sub23_2.py
Answer: Create an empty file called `__init__.py` in all you folders. Then you can
import using `.` as a folder separator. [Documentation
here.](http://docs.python.org/tutorial/modules.html#packages)
|
Python: Put values of variables into a new dictionary
Question: I am looking for a solution to put the content of 2 variables into a
dictionary. One variable should serve as the key, the other as the value.
Here's my code:
dom = parseString(data)
macro=dom.getElementsByTagName('macro')
for node in macro:
d={}
id_name=node.getElementsByTagName('id')[0].toxml()
id_data=id_name.replace('<id>','').replace('</id>','')
print (id_data)
cl_name=node.getElementsByTagName('cl2')[0].toxml()
cl_data=cl_name.replace('<cl2>','').replace('</cl2>','')
print (cl_data)
I would like to have a dictionary with id_data as the keys, and cl_data as the
values without overwriting the old data when appending. How do I go on about
this?
Thanks in advance for any help!
Answer:
from collections import defaultdict
d=defaultdict(list)
dom = parseString(data)
macro=dom.getElementsByTagName('macro')
for node in macro:
id_name=node.getElementsByTagName('id')[0].toxml()
id_data=id_name.replace('<id>','').replace('</id>','')
print (id_data)
cl_name=node.getElementsByTagName('cl2')[0].toxml()
cl_data=cl_name.replace('<cl2>','').replace('</cl2>','')
print (cl_data)
d[id_data].append(cl_data)
The keys of `d` are the various `id_data`s, and the elements are lists with
elements corresponding to each `id_data` found, in order. Of course, if you
can be sure that all the `id_data`s are unique, you can use a regular
dictionay:
d={}
for node in macro:
...
d[id_data]=cl_data
This differs from your original code in that I pulled the dictionary
constructor out of the loop (You don't want to replace your dictionary each
time in the loop) and actually I actually insert the elements into the `dict`
although I'm guessing you did that too, you just don't show it.
|
django.core.exceptions.ImproperlyConfigured: App with label test could not be found?
Question: I have a project structure as
myApp/
apps/
tests/
__init__.py
tests.py
The `tests.py` looks as follows
from django.test import TestCase
class VideoTest(TestCase):
def test_video_insert(self):
self.assertTrue(true)
When I try to test this from command-line, I do
dirBeforeMyApp$python manage.py test test.VideoTest --settings=myApp.settings.dev
I see the following error
File "/Users/user/code/p/virtualenv/myApp/lib/python2.7/site-packages/django/db/models/loading.py", line 152, in get_app
raise ImproperlyConfigured("App with label %s could not be found" % app_label)
django.core.exceptions.ImproperlyConfigured: App with label test could not be found
What is that I am not doing right here?
Answer: well your app is called tests, plural.. You might want to avoid that name for
obvious reasons anyway
|
Python: script to clean windows disk after % usage
Question: I created a python script for cleaning old files on a windows disk. Now I want
to improve that script and check if I went over a predefined disk usage and
then delete files ... how I can do it? Here's my code:
import os, time
path = r"f:\backup"
now = time.time()
for f in os.listdir(path):
if os.stat(f).st_mtime < now - 180 * 86400:
if os.path.isfile(f):
os.remove(os.path.join(path, f))
I need it because I've configured a backup of my computer on external disk and
sometimes it can't do the backup because disk is full.
Answer: I would recommend checking out this answer:
[Cross-platform space remaining on volume using
python](http://stackoverflow.com/questions/51658/cross-platform-space-
remaining-on-volume-using-python)
The nt implementation of the os module does not include the statvfs attribute,
so you'd need to recreate that functionality using c_types.
|
python: display elapsed time on shell
Question: When I run my Python script, there is some function that takes up to a few
minutes to complete, so I want to display on the shell some kind of timer that
informs the user on the time elapsed.
Is there any such thing already ready to use in Python?
Answer: One simplistic way is to include a clock in your
[`sys.ps1`](http://docs.python.org/2/library/sys.html?highlight=sys.ps1#sys.ps1)
prompt (the thing that normally defines the `>>>` prompt)
From the documentation for
[`sys.ps1`](http://docs.python.org/2/library/sys.html?highlight=sys.ps1#sys.ps1):
> If a non-string object is assigned to either variable, its `str()` is re-
> evaluated each time the interpreter prepares to read a new interactive
> command; this can be used to implement a dynamic prompt.
In [`~/.local/usercustomize.py`](http://www.doughellmann.com/PyMOTW/site/) (or
more accurately, in whatever folder `python -c 'import site; print
site.USER_BASE'` displays), you can add:
import sys
import datetime
class ClockPS1(object):
def __repr__(self):
now = datetime.datetime.now()
return str(now.strftime("%H:%M:%S >>> "))
sys.ps1 = ClockPS1()
Then your prompt will look like this:
16:26:24 >>> import time
16:26:27 >>> time.sleep(10)
16:26:40 >>>
It's not perfect, as the last time will be when the prompt appeared, not when
the line was executed, but it might be of help. You could easily make this
display the time in seconds between `__repr__` invokations, and show that in
the prompt.
|
Python MemoryError when storing saved lists
Question: I am new to python, so I apologize if this example is trivial.
I am trying to write a simple script that will pase and extract parts of two
large datafiles (~40gb each) into one resulting file with a slightly altered
format. I originally tried to use readlines(), but that reads all of the files
into memory, and our instance only has 28gb of memory. Using the sizehint
parameter only parses a portion of the file.
I am now iterating over the file. The problem is that I store the output of
the text parsing in three lists that grow to be rather large, eclipsing the
available memory. I thought this would just switch to using the swap, which
would be fine, but it instead just exits with a "MemoryError".
This works fine with small sample files, but chokes on our actual data.
The script:
import sys
a = []
b = []
c = []
file1 = open(sys.argv[1],"r")
for line in file1:
if '@' in line:
a.append(line.lstrip('@').rstrip('\n'))
b.append(file1.next().rstrip('\n'))
file1.close()
file2 = open(sys.argv[2],"r")
for line in file2:
if '@' in line:
c.append(file2.next().rstrip('\n'))
file2.close()
file3 = open(sys.argv[3],"w")
for i in xrange(len(a)):
file3.write("".join([">",a[i],'\n',b[i],":",c[i],"\n"]))
What I have found online suggests creating some sort of database to store the
variables, but that shouldn't be required. Do you have any ideas how I should
deal with this?
For completeness, this is what I'm trying to do (from our example test-data:
file1:
@Read.Salmonella_paratyphi_A_chromosome.29004.4835/1
TCGTGTACAGCATTCTTTATAGTGGAACGGTGACCGTACCGCAAAGCTGCGAAATCAACGCCGGACKIPPTCGTAG
+
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
file2:
@Read.Salmonella_paratyphi_A_chromosome.29004.4835/1
TCGTGTACAGCATTCTTTATAGTGGAACGGTGACCGTACCGCAAAGCTGCGAAATCAACGCCGGACAAACGATTCT
+
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
file3 (output):
>Read.Salmonella_paratyphi_A_chromosome.29004.4835/1
TCGTGTACAGCATTCTTTATAGTGGAACGGTGACCGTACCGCAAAGCTGCGAAATCAACGCCGGACKIPPTCGTAG:TCGTGTACAGCATTCTTTATAGTGGAACGGTGACCGTACCGCAAAGCTGCGAAATCAACGCCGGACAAACGATTCT
Answer: Instead of parsing the files into the arrays (`a`, `b` and `c`), can you write
into the file as you parse the files?
Something like this pseudo'ish code:
def get_line_with_at(a):
while a:
line = a.readline()
if "@" in line:
return line.strip()
# Open all file handles
a, b, c = [open(sys.argv[x + 1]) for x in range(3)]
out = open(sys.argv[4])
while a and b and c:
# Repeat until a, b, and file handles are exhausted
chunk1 = get_line_with_at(a)
chunk2 = b.next().strip()
chunk3 = get_line_with_at(c)
out.write(
">%s\n%s:%s\n" % (chunk1, chunk2, chunk3))
That way you should only have to load very little into memory (theoretically 4
file handles and the contents of the current lines)
|
Python - Facebook API - Need a working example
Question: Ok, so i've googled around, i've found threads here on stackoverflow and i've
checked the official Facebook wiki and.. and what not..
I now hope that one of you guys sits on a Facebook API sample code for Python.
This is what i've got so far and all i get is "Invalid Signature" via
PyFacebook which appears to be a dead project:
from facebook import Facebook
api_key = '123456789______'
secret = '<proper secret key>'
OTK = 'XXXXX' # <-- You get this from: https://www.facebook.com/code_gen.php?v=1.0&api_key=123456789______
long_term_key = None
fb = Facebook(api_key, secret)
def generate_session_from_onetime_code(fb, code):
fb.auth_token = code
return fb.auth.getSession()
if not long_term_key:
long_term_key = generate_session_from_onetime_code(fb, OTK)['session_key']
print 'Replace None with this in the .py file for long_term_key:'
print long_term_key
fb.session_key = long_term_key
fb.uid = 000000001 # <-- Your user-id
fb.signature = api_key # <-- This doesn't work at all, MD5 of what?
#fb.validate_signature(fb) # <-- doesn't work either, prob need to pass MD5 handle?
print fb.friends.get() # <-- Generates "Invalid Signature"
"all" i want, is to retrieve my friends list for now, if there's a better API
point me in the right direction but Facebook has officially declared their own
Python SDK dead and pyfacebook is almost working for me but not quite..
So, please help.
Answer: The [unofficial fork of the python
sdk](https://github.com/pythonforfacebook/facebook-sdk) is still working fine
for me.
To retrieve your friends, generate an access token here:
<https://developers.facebook.com/tools/access_token/>
Limitations:
* A user access token with user_friends permission is required to view the current person's friends.
* This will only return any friends who have used (via Facebook Login) the app making the request.
* If a friend of the person declines the user_friends permission, that friend will not show up in the friend list for this person.
Code
>
> import facebook
>
> token = 'your token'
>
> graph = facebook.GraphAPI(token)
> profile = graph.get_object("me")
> friends = graph.get_connections("me", "friends")
>
> friend_list = [friend['name'] for friend in friends['data']]
>
> print friend_list
>
|
matching headers in fasta files with python
Question: I have two files: the first is a fasta file with a header and sequence and the
second is composed of only headers.
File_1:
>DF94KKQ1|265|D0M1LACXX|3|2103|4637|10742|1|N|0|TGACCA
TTCCAAAGAAACATGGAAGACCCAGGACTTGGAGGCACCAGGCACCAGCACACAGGGGTA
GGCACATGGCATGGTGTTGGTTGAAGTCTACTTTTCCCACC
>DF94KKQ1|265|D0M1LACXX|3|2103|4565|10742|1|N|0|TGACCA
TTAATTTTTTCAGGCAAGTTTTGTGGATTTCAGTGTGTAAGTCTTTCACCTCTTTGGTTA
AATTTATTCCTATGTATTTTATTCCTTTAGATGCTATTATG
>DF94KKQ1|265|D0M1LACXX|3|2103|4565|10742|2|N|0|TGACCA
TTAATTTTTTCAGGCAAGTTTTGTGGATTTCAGTGTGTAAGTCTTTCACCTCTTTGGTTA
AATTTATTCCTATGTATTTTATTCCTTTAGATGCTATTATG
File_2:
>DF94KKQ1|265|D0M1LACXX|3|2103|4565|10742|2|N|0|TGACCA
>DF94KKQ1|265|D0M1LACXX|3|2103|4668|10746|1|N|0|TGACCA
>DF94KKQ1|265|D0M1LACXX|3|2103|4668|10746|2|N|0|TGACCA
>DF94KKQ1|265|D0M1LACXX|1|2207|10852|3331|2|N|0|TGACCA
I want to match the header in File_2 with anything in File_1 that has the same
exact characters up until the 7th '|'.
I split the items in File_1 (each section of the header is indexed into a
list). Anyline that begins with a '>' is placed into a variable:
#!/usr/bin/env python
import sys
from Bio import SeqIO
#Function, split header line into a list
def getHeaderInfo(blastLine):
myFields = blastLine.strip("\n").split("|")
HeaderInfo = myFields[:6]
return HeaderInfo
input_file = sys.argv[1]
#Get input file from the command line
inFileName = sys.argv[1]
#open the input file
inFileHandle = open(inFileName)
#loop over the input file line by line
for thisLine in inFileHandle.readlines():
if thisLine [0] == '>':
print getHeaderInfo(thisLine)
HeaderInfo = getHeaderInfo(thisLine)
I have been trying to find a method in which I can compare these same indexes
in File_2 to return the following output:
>DF94KKQ1|265|D0M1LACXX|3|2103|4565|10742|1|N|0|TGACCA
TTAATTTTTTCAGGCAAGTTTTGTGGATTTCAGTGTGTAAGTCTTTCACCTCTTTGGTTA
AATTTATTCCTATGTATTTTATTCCTTTAGATGCTATTATG
>DF94KKQ1|265|D0M1LACXX|3|2103|4565|10742|2|N|0|TGACCA
TTAATTTTTTCAGGCAAGTTTTGTGGATTTCAGTGTGTAAGTCTTTCACCTCTTTGGTTA
AATTTATTCCTATGTATTTTATTCCTTTAGATGCTATTATG
Several of the methods I have tried use an index, however, my key is not
unique. How can I take the first six elements and make them my key or is there
a better method than the current one I am attempting? Thank you.
Answer: Does this do what you want?
def make_key(line):
return "|".join(line.split("|", 7)[ : 7]) + "|"
header_set = set()
with open("file_2.txt") as in_f:
for line in in_f:
header_set.add(make_key(line))
with open("file_1.txt") as in_f, open("file_3.txt", "w") as out_f:
accept = False
for line in in_f:
if line.startswith(">"):
key = make_key(line)
accept = key in header_set
if accept:
out_f.write(line)
|
Problems with Hangman in Pygame
Question: I'm trying to find out what is wrong with the folowing code:
import pygame, sys, random, linecache
from pygame.locals import *
#Start Pygame, define Pygame objects
pygame.init()
hangmanSurfaceObj = pygame.display.set_mode((640,480), 0)
clock = pygame.time.Clock()
#Define colors
redColor = pygame.Color(255,0,0)
greenColor = pygame.Color(0,255,0)
blueColor = pygame.Color(0,0,255)
whiteColor = pygame.Color(255,255,255)
blackColor = pygame.Color(0,0,0)
tardisBlueColor = pygame.Color(16,35,114)
bgColor = whiteColor
#Import Images
hangmanImage = pygame.image.load('hangmanResources/hangman.png')
#Import sounds
sadTromboneSound = pygame.mixer.music.load('hangmanResources/sadTrombone.mp3')
#Import Font
fontObj = pygame.font.Font('hangmanResources/Avenir_95_Black.ttf', 18)
#Define global variables
currentWord = 0
usrWord = ''
screenWord = []
i = 0
currentChar = ''
guesses = 0
def terminate():
pygame.quit()
sys.exit()
def drawRects(tries):
if tries<=0:
hangmanSurfaceObj.fill(bgColor, pygame.Rect(242,65,65,65))
if tries<=1:
hangmanSurfaceObj.fill(bgColor, pygame.Rect(257,90,35,4))
if tries<=2:
hangmanSurfaceObj.fill(bgColor, pygame.Rect(261,110,27,1))
if tries<=3:
hangmanSurfaceObj.fill(bgColor, pygame.Rect(274,130,1,114))
if tries<=4:
hangmanSurfaceObj.fill(bgColor, pygame.Rect(198,160,76,1))
if tries<=5:
hangmanSurfaceObj.fill(bgColor, pygame.Rect(275,160,75,1))
if tries<=6:
hangmanSurfaceObj.fill(bgColor, pygame.Rect(210,244,64,85))
if tries<=7:
hangmanSurfaceObj.fill(bgColor, pygame.Rect(274,244,51,87))
def newGame(players):
if players == 1:
line_number = random.randint(0, 2283)
usrWord = linecache.getline('hangmanResources/words.txt', line_number)
usrWord = list(usrWord)
del usrWord[-1]
print(usrWord)
screenWord = ['_']*len(usrWord)
print(screenWord)
def checkChar(usrWord):
print('hi')
i=0
addGuess = 1
print(len(usrWord))
while i <= (len(usrWord)-1):
print('hi2')
if currentChar.lower == usrWord[i]:
print('hi3')
screenWord[i] = currentChar
addGuess = 0
return addGuess
newGame(1)
while True:
gameRunning = 1
while gameRunning==1:
for event in pygame.event.get(QUIT):
terminate()
for event in pygame.event.get(KEYDOWN):
if event.key==K_ESCAPE:
terminate()
else:
currentChar = event.unicode
guesses +=checkChar(usrWord)
print(currentChar)
print(screenWord)
msg = ''.join(screenWord)
msgSurfaceObj = fontObj.render(msg, False, blackColor)
msgRectObj = msgSurfaceObj.get_rect()
msgRectObj.topleft = (10, 20)
hangmanSurfaceObj.blit(msgSurfaceObj, msgRectObj)
hangmanSurfaceObj.fill(bgColor)
hangmanSurfaceObj.fill(blueColor, pygame.Rect(400,0,640,480))
hangmanSurfaceObj.blit(hangmanImage, (0,0))
if guesses<=7:
drawRects(guesses)
else:
won=0
gameRunning = 0
pygame.display.update()
clock.tick(30)
newGame(1)
It is supposed to be a hangman game with a hanging post showing, letter blanks
showing, and a blue rectangle on the right (where game controls will
eventually go).
When I go to run it the hanging post appears, the blue rectangle on the left
appears, and although no errors pop up, the letter blanks don't show up, and
there is a strange blue box connected to the corner of the blue rectangle.
More importantly, though, the problem that I'm having is that once you enter a
character, the string which holds the data for the eventual on-screen output
doesn't change. For instance, if the guess word is "Turtle" and I enter "t",
then it should change from `['_','_','_','_','_','_']` to
`['t','_','_','t','_','_']`, but it doesn't.
I used Python 3.1.3 and Pygame 1.9.1.
I searched the Python as well as Pygame documentations for the functions that
I am using, but unfortunately I could find no recourse.
The original file, as well as the resources, can be found
[here](http://sourceforge.net/projects/hangman4pygame/files/ "Hangman for
Pygame on SourceForge").
Thanks so much!
Answer: You are blitting the phrase only during keydown then in every frame you clean
the screen. At 30 fps you are lucky if you see a blink of the phrase. You
should check the frase at key down but blit the frase on every frame.
...
for event in pygame.event.get(KEYDOWN):
if event.key==K_ESCAPE:
terminate()
else:
currentChar = event.unicode
guesses +=checkChar(usrWord)
print(currentChar)
print(screenWord)
msg = ''.join(screenWord)
# Clean background
hangmanSurfaceObj.fill(bgColor)
# Then blit message
msgSurfaceObj = fontObj.render(msg, False, blackColor)
msgRectObj = msgSurfaceObj.get_rect()
msgRectObj.topleft = (10, 20)
hangmanSurfaceObj.blit(msgSurfaceObj, msgRectObj)
...
**Edit**
About the blue rectangle attached to the control box, it's because you are
making the control box 200px wide and then overwriting the first 100px with
your drawRects() rountine.
You can either make the control box 100px wide:
hangmanSurfaceObj.fill(blueColor, pygame.Rect(400,0,640,480))
or modify drawRects() routine so the rects don't overlap the control box.
|
Connection appears accepted server-side but appears to be refused in my python script
Question: I have a python script I am running to add a document to a collection for a
remote mongodb database. The file is as follows:
from pymongo import Connection
ip = 'x.x.x.x' #edited out
conn = Connection()
db = conn['netmon']
users = db.users
print 'number of users: ' + str(users.count())
if users.count() == 0:
print 'Please create a new account.'
t_user = raw_input('Username:')
users.insert({'username':unicode(t_user)})
conn.close()
When I run this script, I have some interesting behavior. In the server logs,
it appears that the connection is accepted, the query is run, and then the
connection is closed.
# Mongodb logs
14:27:18 [initandlisten] connection accepted from 108.93.46.75:39558 #1
14:27:18 [conn1] run command admin.$cmd { ismaster: 1 }
14:27:18 [conn1] command admin.$cmd command: { ismaster: 1 } ntoreturn:1 reslen:71 0ms
14:27:18 [conn1] run command netmon.$cmd { count: "users", fields: null, query: {} }
14:27:18 [conn1] Accessing: netmon for the first time
14:27:18 [conn1] command netmon.$cmd command: { count: "users", fields: null, query: {} } ntoreturn:1 reslen:58 10ms
14:27:18 [conn1] end connection 108.93.46.75:39558
However, this is what I get from the python script:
# Python error
> python testmongo.py
Traceback (most recent call last):
File "testmongo.py", line 7, in <module>
conn = Connection()
File "/usr/local/lib/python2.7/dist-packages/pymongo-2.2.1-py2.7-linux-x86_64.egg/pymongo/connection.py", line 290, in __init__
self.__find_node()
File "/usr/local/lib/python2.7/dist-packages/pymongo-2.2.1-py2.7-linux-x86_64.egg/pymongo/connection.py", line 586, in __find_node
raise AutoReconnect(', '.join(errors))
pymongo.errors.AutoReconnect: could not connect to localhost:27017: [Errno 111] Connection refused
charles@charles-mbp:~/Desktop$ python testmongo.py
Traceback (most recent call last):
File "testmongo.py", line 7, in <module>
conn = Connection()
File "/usr/local/lib/python2.7/dist-packages/pymongo-2.2.1-py2.7-linux-x86_64.egg/pymongo/connection.py", line 290, in __init__
self.__find_node()
File "/usr/local/lib/python2.7/dist-packages/pymongo-2.2.1-py2.7-linux-x86_64.egg/pymongo/connection.py", line 586, in __find_node
raise AutoReconnect(', '.join(errors))
pymongo.errors.AutoReconnect: could not connect to localhost:27017: [Errno 111] Connection refused
charles@charles-mbp:~/Desktop$ python testmongo.py
Traceback (most recent call last):
File "testmongo.py", line 7, in <module>
conn = Connection()
File "/usr/local/lib/python2.7/dist-packages/pymongo-2.2.1-py2.7-linux-x86_64.egg/pymongo/connection.py", line 290, in __init__
self.__find_node()
File "/usr/local/lib/python2.7/dist-packages/pymongo-2.2.1-py2.7-linux-x86_64.egg/pymongo/connection.py", line 586, in __find_node
raise AutoReconnect(', '.join(errors))
pymongo.errors.AutoReconnect: could not connect to localhost:27017: [Errno 111] Connection refused
Some useful information: The remote server is a VPS running on OpenVZ. I know
there are compatibility problems related to count() and iterators, but I
(assumingly) fixed them by using the --smallfiles option, as well as limiting
my nssize to 100. My firewall on both sides are completely open.
I've also noticed that in the errors, autoreconnect is trying to connect to
localhost, even though I specified a different IP address.
Answer: You need to pass the IP - `conn = Connection(ip)`
|
issue converting python pandas DataFrame to R dataframe for use with rpy2
Question: I am having trouble converting a pandas DataFrame in Python to an R object,
for future use in R using rpy2.
The new pandas release 0.8.0 (released a few weeks ago) has a function to
convert pandas DataFrames to R DataFrames. The problem is in converting the
first column of my pandas DataFrame, which consists of python datetime objects
(successively, in a time series). The conversion into an R dataframe returns
an StrVector of the dates and times, rather than a vector of R datetime-type
objects which I believe are called "POSIXct" objects.
I know the command to convert a string of the type returned to a POSIXct,
using the command "as.POSIXct('yyyy-mm-dd hh:mm:ss')". Unfortunately I have
not been able to figure out the way to convert all these strings in the
StrVector to POSIXct using python and rpy2. The dates need to be in the
POSIXct format to be used with the TTR library in R. Below is the relevant
python code:
import pandas
from pandas import *
import pandas.rpy.common as com
import rpy2.robjects as robjects
r = robjects.r
r.library('TTR') #library contains the function ADX, to be used later
dataframe = read_csv('file_name', parse_dates = [0], names = ['Date','Col1','Col2','Col3'] #command makes 1st column into datetime.datetime object
r_dataframe = com.convert_to_r_dataframe(dataframe)
ADX = r['ADX'] #creating a name for an R function in python
adx = ADX(r_dataframe) #will not work because the dates in r_dataframe are in a StrVector
Further I do not believe that the StrVector can be iterated through to convert
each object to a POSIXct object individually, due to the definition of a
StrVector. Maybe there is a way to cast a StrVector to a generic one?
Any help/insight into this matter is greatly appreciated. I am a novice
programmer and have been working on this for a couple hours now to no avail.
Thank you!
Answer: The reason your `ADX` call fails is because it expects an xts or matrix-like
object with 3 columns: High, Low, Close. Your object contains 4 columns. Drop
the date column before passing `r_dataframe` to `ADX` and everything should
work. You can then add the datetime column back to the `ADX` output.
Or, if you can set the `row.names` attribute of your R data.frame to the
values of the `Date` column and then remove the `Date` column, you can convert
your R data.frame to an xts object by calling `as.xts(r.data.frame)`. Then you
can pass that to `ADX` and convert the result back to a pandas DataFrame.
|
multiprocessing.Process - Variable as function
Question: I am using the code below to parallelize the processing of a numpy array. The
target function in this case performs a simple linear stretch on the input
data. The array is segmented and then fed to the pool in chunks. This is
working quite well thanks to the numerous parallel processing with python
posts.
pool = [multiprocessing.Process(target=linear_stretch, args= (shared_arr,slice(i, i+step), 35, 200, 2.0)) for i in range (0, y, step)]
My question is, is it possible to do something like the following:
stretch = Linear.linear_stretch()
Where I create an object of the function (please correct my vocab!) and then
call it in the multiprocessing.Process.
The module that the function resides in currently looks like:
Linear.py
import numpy
def linear_stretch(args):
#Do some stuff
Answer: Yes, like this:
stretch = Linear.linear_stretch
In Python, functions are already first-class objects and are capable of being
manipulated like any other object, or passed by reference to another variable.
Note that parentheses after a function or method signals the interpreter to
call the function and pass the return value, which is why:
stretch = Linear.linear_stretch()
will not work as expected.
|
Django (or other pip package) in PyPy
Question: I am attempting to get django working using pypy. I have everything setup and
working great under python2.7 and python3.2 is not installed. I then installed
pypy and attempted to run django:
Traceback (most recent call last):
File "app_main.py", line 51, in run_toplevel
File "manage.py", line 8, in <module>
from django.core.management import execute_from_command_line
ImportError: No module named django
I noticed that pypy created its own site-packages folder, so I removed that
and made a symlink to the site-packages folder in my python2.7 installation.
This made no change. I have also noticed that it is not just a django problem,
any pip installed package doesn't work.
**python2.7 path:**
['', '/usr/lib/python27.zip',
'/usr/lib/python2.7',
'/usr/lib/python2.7/plat-linux2',
'/usr/lib/python2.7/lib-tk',
'/usr/lib/python2.7/lib-old',
'/usr/lib/python2.7/lib-dynload',
'/usr/lib/python2.7/site-packages',
'/usr/lib/python2.7/site-packages/setuptools-0.6c11.egg-info']
**pypy path**
['', '/opt/pypy/lib_pypy/__extensions__',
'/opt/pypy/lib_pypy',
'/opt/pypy/lib-python/2.7',
'/opt/pypy/lib-python/2.7/lib-tk',
'/opt/pypy/lib-python/2.7/plat-linux2']
Does anyone have any experience with this? Are symlinks allowed in this
situation? If not is there something else that is used instead? I also
attempted just copying the django folder into the site-packages folder before
deleting it but had no success with that either. Thanks
Answer: You really want to create a standalone environment for your web app. I suggest
using [buildout](http://www.buildout.org/) or
[virtualenv](http://www.virtualenv.org/). Managing system site-packages will
bite you everytime.
Good luck!
|
Is it possible to use pyGTK and Monkeyrunner in same script?
Question: I started with importing GTK, and monkeyrunner:
from com.android.monkeyrunner import MonkeyRunner
import gtk
...
when I run this with monkeyrunner in the SDK tools, it says `ImportError: No
module named gtk`. When I run this with Python, it says `ImportError: No
module named com.android.monkeyrunner`.
Is there any way to set up a program that uses both modules?
Answer: MonkeyRunner is built with Jython and it only has a small subset of the
standard modules compiled in. If you would like to use MonkeyRunner with other
python packages then you will need to use os.system or something like that in
your MonkeyRunner program to call a separate python instance.
|
Runtime import with with multiple subdirectories in python
Question: what is the best way to perform this type of import in python
file to be imported which is available in location one/ne_one/one_two/"
fielname : two.py
def foo():
print "venkatttt!"
main file : main.py
s = __import__("one.one_one.one_two.two", fromlist=[])
function_class = getattr(s,"one_one")
function_class1 = getattr(function_class,"one_two")
function_class2 = getattr(function_class1,"two")
print s
print function_class
print function_class1
print function_class2
function_class2.foo()
output of this code:
<module 'one' from '/opt/auto/src/ex/one/__init__.pyc'>
<module 'one.one_one' from '/opt/auto/src/ex/one/one_one/__init__.pyc'>
<module 'one.one_one.one_two' from '/opt/auto/src/ex/one/one_one/one_two/__init__.pyc'>
<module 'one.one_one.one_two.two' from '/opt/auto/src/ex/one/one_one/one_two/two.py'>
venkatttt!
i am looking out for the best way to perform this import
Answer: From your output, I can see you already have `__init__.py` files in each
subdirectory, therefore, you can simply `import` them:
$> from one.one_one.one_two.two import foo
$> foo()
If you want a handle for each module, you can import them separately:
$> import one.one_one as function_class
$> import one.one_one.one_two as function_class1
$> import one.one_one.one_two.two as function_class2
Finally, you can also define `__all__` in `one/__init__.py` and let this auto-
imports happen automatically when `import one` is executed.
|
Layout of python code
Question: I'm trying to learn the best way to arrange/define code. Taking the below as
an example, I have to write the tkMessageBox command twice. I did try to
create a def within getText() and refer to that, but it didn't work.
Questions therefore please
1) How could I arrange the code such that I can place the tkMessageBox command
in a def or something and refer to it even within getText()
2) Considering best practice, should this code be layed out differently? If so
how/why?
Thank you in advance
import Tkinter as tk
import tkMessageBox
import base64
myText = 'empty'
def getText():
global myText
myText = inputBox.get()
entered = "You entered: " + myText
encoded = "We encoded: " + base64.encodestring(myText)
Button1 = tk.Button(root, command = tkMessageBox.showinfo("Press me", entered))
Button1.pack()
Button2 = tk.Button(root, command = tkMessageBox.showinfo("Press me", encoded))
Button2.pack()
root.destroy()
root = tk.Tk()
# Text label
simpleTitle = tk.Label(root)
simpleTitle['text'] = 'Please enter your input here'
simpleTitle.pack()
# The entry box widget
inputBox = tk.Entry(root)
inputBox.pack()
# The button widget
button = tk.Button(root, text='Submit', command=getText)
button.pack()
tk.mainloop()
Answer: I am not sure if you are asking about
[refactoring](http://en.wikipedia.org/wiki/Code_refactoring) your code or not,
but the ultimate style guide for laying out/formatting Python code is [**PEP 8
-- Style Guide for Python Code**](http://www.python.org/dev/peps/pep-0008/).
|
Django nonrel development server doesn't import amazon.api
Question: I have a weird problem with Django nonrel's development server:
I have installed [Amazon Simple Product
API](https://github.com/yoavaviram/python-amazon-simple-product-api/ "Amazon
Simple Product API") , and it works fine in the shell, I can import it there,
and everything else seems to work fine. But when I try to import it into my
website I get this:
ImportError at /
No module named amazon.apiRequest Method: GET
Request URL: http://127.0.0.1:8000/
Django Version: 1.3
Exception Type: ImportError
Exception Value: No module named amazon.api
Exception Location: /Users/Paulius/Desktop/Django-nonrel/projects/sort/phone/functions.py in <module>, line 3
Python Executable: /opt/local/Library/Frameworks/Python.framework/Versions/2.7/Resources/Python.app/Contents/MacOS/Python
Python Version: 2.7.2
Python Path: ['/Users/Paulius/Desktop/Django-nonrel/projects/sort',
'/Users/Paulius/Desktop/Django-nonrel/projects/sort/djangoappengine/lib',
'/usr/local/google_appengine',
'/usr/local/google_appengine/lib/antlr3',
'/usr/local/google_appengine/lib/enum',
'/usr/local/google_appengine/lib/fancy_urllib',
'/usr/local/google_appengine/lib/graphy',
'/usr/local/google_appengine/lib/grizzled',
'/usr/local/google_appengine/lib/httplib2',
'/usr/local/google_appengine/lib/ipaddr',
'/usr/local/google_appengine/lib/jinja2',
'/usr/local/google_appengine/lib/markupsafe',
'/usr/local/google_appengine/lib/oauth2',
'/usr/local/google_appengine/lib/prettytable',
'/usr/local/google_appengine/lib/protorpc',
'/usr/local/google_appengine/lib/simplejson',
'/usr/local/google_appengine/lib/sqlcmd',
'/usr/local/google_appengine/lib/webapp2',
'/usr/local/google_appengine/lib/webob',
'/usr/local/google_appengine/lib/yaml/lib',
'/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/django_cms-2.2-py2.7.egg',
'/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/django_sekizai-0.5-py2.7.egg',
'/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/django_mptt-0.5.2-py2.7.egg',
'/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/html5lib-0.95-py2.7.egg',
'/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/South-0.7.4-py2.7.egg',
'/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/django_classy_tags-0.3.4.1-py2.7.egg',
'/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/django_floppyforms-0.4.7-py2.7.egg',
'/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/pygeoip-0.2.3-py2.7.egg',
'/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/six-1.1.0-py2.7.egg',
'/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/distribute-0.6.27-py2.7.egg',
'/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/bottlenose-0.4.0-py2.7.egg',
'/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/python_amazon_simple_product_api-1.1.0-py2.7.egg',
'/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python27.zip',
'/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7',
'/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/plat-darwin',
'/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/plat-mac',
'/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/plat-mac/lib-scriptpackages',
'/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/lib-tk',
'/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/lib-old',
'/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/lib-dynload',
'/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages',
'/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/PIL']
Server time: Tue, 17 Jul 2012 18:11:04 +0000
I'm using the same python version to run both the server and the shell, and I
have no idea what's wrong.
**Traceback:**
Environment:
Request Method: GET
Request URL: http://127.0.0.1:8000/
Django Version: 1.3
Python Version: 2.7.2
Installed Applications:
['django.contrib.contenttypes',
'django.contrib.auth',
'django.contrib.sessions',
'django.contrib.messages',
'django.contrib.staticfiles',
'django.contrib.admin',
'phone',
'django.contrib.admindocs',
'djangotoolbox',
'autoload',
'dbindexer',
'djangoappengine']
Installed Middleware:
('autoload.middleware.AutoloadMiddleware',
'django.contrib.sessions.middleware.SessionMiddleware',
'django.middleware.csrf.CsrfViewMiddleware',
'django.contrib.messages.middleware.MessageMiddleware',
'django.middleware.common.CommonMiddleware',
'django.contrib.auth.middleware.AuthenticationMiddleware')
Traceback:
File "/Users/Paulius/Desktop/Django-nonrel/projects/sort/django/core/handlers/base.py" in get_response
101. request.path_info)
File "/Users/Paulius/Desktop/Django-nonrel/projects/sort/django/core/urlresolvers.py" in resolve
250. for pattern in self.url_patterns:
File "/Users/Paulius/Desktop/Django-nonrel/projects/sort/django/core/urlresolvers.py" in _get_url_patterns
279. patterns = getattr(self.urlconf_module, "urlpatterns", self.urlconf_module)
File "/Users/Paulius/Desktop/Django-nonrel/projects/sort/django/core/urlresolvers.py" in _get_urlconf_module
274. self._urlconf_module = import_module(self.urlconf_name)
File "/Users/Paulius/Desktop/Django-nonrel/projects/sort/django/utils/importlib.py" in import_module
35. __import__(name)
File "/usr/local/google_appengine/google/appengine/tools/dev_appserver_import_hook.py" in Decorate
676. return func(self, *args, **kwargs)
File "/usr/local/google_appengine/google/appengine/tools/dev_appserver_import_hook.py" in load_module
1845. return self.FindAndLoadModule(submodule, fullname, search_path)
File "/usr/local/google_appengine/google/appengine/tools/dev_appserver_import_hook.py" in Decorate
676. return func(self, *args, **kwargs)
File "/usr/local/google_appengine/google/appengine/tools/dev_appserver_import_hook.py" in FindAndLoadModule
1717. description)
File "/usr/local/google_appengine/google/appengine/tools/dev_appserver_import_hook.py" in Decorate
676. return func(self, *args, **kwargs)
File "/usr/local/google_appengine/google/appengine/tools/dev_appserver_import_hook.py" in LoadModuleRestricted
1660. description)
File "/Users/Paulius/Desktop/Django-nonrel/projects/sort/urls.py" in <module>
2. from phone.views import *
File "/usr/local/google_appengine/google/appengine/tools/dev_appserver_import_hook.py" in Decorate
676. return func(self, *args, **kwargs)
File "/usr/local/google_appengine/google/appengine/tools/dev_appserver_import_hook.py" in load_module
1845. return self.FindAndLoadModule(submodule, fullname, search_path)
File "/usr/local/google_appengine/google/appengine/tools/dev_appserver_import_hook.py" in Decorate
676. return func(self, *args, **kwargs)
File "/usr/local/google_appengine/google/appengine/tools/dev_appserver_import_hook.py" in FindAndLoadModule
1717. description)
File "/usr/local/google_appengine/google/appengine/tools/dev_appserver_import_hook.py" in Decorate
676. return func(self, *args, **kwargs)
File "/usr/local/google_appengine/google/appengine/tools/dev_appserver_import_hook.py" in LoadModuleRestricted
1660. description)
File "/Users/Paulius/Desktop/Django-nonrel/projects/sort/phone/views.py" in <module>
9. from functions import *
File "/usr/local/google_appengine/google/appengine/tools/dev_appserver_import_hook.py" in Decorate
676. return func(self, *args, **kwargs)
File "/usr/local/google_appengine/google/appengine/tools/dev_appserver_import_hook.py" in load_module
1845. return self.FindAndLoadModule(submodule, fullname, search_path)
File "/usr/local/google_appengine/google/appengine/tools/dev_appserver_import_hook.py" in Decorate
676. return func(self, *args, **kwargs)
File "/usr/local/google_appengine/google/appengine/tools/dev_appserver_import_hook.py" in FindAndLoadModule
1717. description)
File "/usr/local/google_appengine/google/appengine/tools/dev_appserver_import_hook.py" in Decorate
676. return func(self, *args, **kwargs)
File "/usr/local/google_appengine/google/appengine/tools/dev_appserver_import_hook.py" in LoadModuleRestricted
1660. description)
File "/Users/Paulius/Desktop/Django-nonrel/projects/sort/phone/functions.py" in <module>
3. from amazon.api import AmazonAPI
Exception Type: ImportError at /
Exception Value: No module named amazon.api
Answer: dev_appserever modifies the environment so you don't include libraries in a
way that won't be available when you deploy your project onto App Engine.
You'll have to put the library in your actual project folder, or at least
softlink to it from within your project folder.
|
Python - SQL Server call not using a transaction
Question: I have a simple Python script where I send in a call to a SQL Server 2008
stored procedure which in turn uses bcp through xp_cmdshell. When I call the
SP through management console, it works just fine. When I call it from the
python script, it hangs up as the execution blocks the tempdb used for the bcp
results.
Is there a way to make the call from Python without using a transaction (as I
think this additional add-on is locking up my call to hang).
Here is my script:
* * *
import pyodbc as p
def CallExportFiles(conn, procName):
sql = "DECLARE @ret int EXEC @ret = [db].[dbo].[" + procName + "] @I_EMAILPROFILE = N\'SQL_AlertProfile\', @I_EMAILALERTS = N\'[email protected]\', @I_CUSTOMERID = N\'xxx\', @I_ENVIRO = N\'prod\', @I_COAFILENAME = N\'InvoiceGL\', @I_PERSONFILENAME = N\'Person\', @I_DELEGATESFILENAME = N\'Delegates\', @I_VENDORFILENAME = N\'InvoiceVendors\', @I_DIRECTORY = N\'\\\\xxx\\output\\yyy\\\', @I_ARCHIVEDIR = N\'\\\\xxx\\output\\yyy\\ARCHIVE\\\', @I_FAILUREDIR = N\'\\\\xxx\\output\\yyy\\FAILURE\\\' SELECT \'Return Value\' = @ret"
dbCursor = conn.cursor()
##Locks on this next execute call
dbCursor.execute(sql)
dbCursor.commit()
if __name__ == '__main__':
#connectin to the db with SQL Authentification
conn = p.connect(driver = '{SQL Server Native Client 10.0}', server = r'server', database = 'db', uid = 'sa', pwd = 'xxx')
if (conn == False):
print 'Error, did not connect to the database'
else:
CallExportFiles(conn, 'sp_export_files')
conn.close()
* * *
The piece that locks up when called in the stored proc is on the execute here
(NOTE: This Stored proc works fine called w/ the same string from Management
Studio:
* * *
SELECT CONVERT(varchar(1),'Z') AS [SORT],
CONVERT(varchar(64),'GLNumber') AS GLNUMBER,
CONVERT(varchar(1000),'GLDescription') AS GLDESCRIPTION,
CONVERT(varchar(4),'Type') AS [TYPE],
CONVERT(varchar(100),'GLStatusFlag') AS GLSTATUSFLAG,
CONVERT(varchar(100),'UDF1') AS UDF1,
CONVERT(varchar(100),'UDF2') AS UDF2,
CONVERT(varchar(100),'UDF3') AS UDF3,
CONVERT(varchar(100),'UDF4') AS UDF4,
CONVERT(varchar(100),'UDF5') AS UDF5
INTO ##BCP_Results1
INSERT INTO ##BCP_Results1([SORT],GLNUMBER,GLDESCRIPTION,[TYPE],GLSTATUSFLAG,UDF1,UDF2,UDF3,UDF4,UDF5)
SELECT 'A',
GLNUMBER,
GLDESCRIPTION,
[TYPE],
GLSTATUSFLAG,
UDF1,
UDF2,
UDF3,
UDF4,
UDF5
FROM dbname.DBO.GLACCOUNTS
set @sqlstring = 'bcp "SELECT GLNUMBER,GLDESCRIPTION,[TYPE],GLSTATUSFLAG,UDF1,UDF2,UDF3,UDF4,UDF5 FROM ##BCP_Results1 ORDER BY [SORT] DESC " queryout '+@I_DIRECTORY+@I_COAFILENAME+'-'+@I_ENVIRO+'-'+@I_CUSTOMERID+'-'+CONVERT(CHAR(10),GETDATE(),23)+'-'+ LEFT(CONVERT(CHAR(5),GETDATE(),114),2)+'-'+ RIGHT(CONVERT(CHAR(5),GETDATE(),114),2)+'.txt -c -t^| -U sa -P xxxx -S xserverx\xdbx'
EXECUTE master.dbo.xp_cmdshell @sqlstring
drop table ##BCP_Results1
* * *
Answer: Change the value of the
[autocommit](http://code.google.com/p/pyodbc/wiki/FAQs#Connecting_fails_with_an_error_about_SQL_ATTR_AUTOCOMMIT)
property and that should resolve the issue.
|
askdirectory() changes focus to different window
Question: I am using Tkinter to build two windows. One the main one, pressing a button
leads to the creation of the second window.
This second window does not get focus immediately when it created. That I am
able to fix by calling .focus_force(). However, when I call the askdirectory()
function from tkFileDialog, the focus changes back to the first window.
How can I prevent that focus switch from happening, without simply calling
focus_force() all over the place?
To replicate problem:
from Tkinter import *
from tkFileDialog import *
class app:
def __init__(self, master):
Button(master, command = make_new).grid()
def make_new(self):
root = Tk()
new = new_win(root)
root.mainloop() #here the focus is on the first window
class new_win:
def __init__(self, master):
f = askdirectory() #even after placing focus on second window,
#focus goes back to first window here
I am using Python 2.7.3. Thanks!
Answer: the little-documented wm_attributes method might help:
from Tkinter import *
import tkFileDialog
root = Tk()
top = Toplevel()
top.wm_attributes('-topmost', 1)
top.withdraw()
top.protocol('WM_DELETE_WINDOW', top.withdraw)
def do_dialog():
oldFoc = top.focus_get()
print tkFileDialog.askdirectory()
if oldFoc: oldFoc.focus_set()
b0 = Button(top, text='choose dir', command=do_dialog)
b0.pack(padx=100, pady=100)
def popup():
top.deiconify()
b0.focus_set()
b1 = Button(root, text='popup', command=popup)
b1.pack(padx=100, pady=100)
root.mainloop()
|
Reproduce the Unix cat command in Python
Question: I am currently reproducing the following Unix command:
cat command.info fort.13 > command.fort.13
in Python with the following:
with open('command.fort.13', 'w') as outFile:
with open('fort.13', 'r') as fort13, open('command.info', 'r') as com:
for line in com.read().split('\n'):
if line.strip() != '':
print >>outFile, line
for line in fort13.read().split('\n'):
if line.strip() != '':
print >>outFile, line
which works, but there has to be a better way. Any suggestions?
Edit (2016):
This question has started getting attention again after four years. I wrote up
some thoughts in a longer Jupyter Notebook
[here](https://github.com/jbwhit/one-
offs/blob/master/notebooks/2016-09-19_jbw_stackoverflow.ipynb).
The crux of the issue is that my question was pertaining to the (unexpected by
me) behavior of `readlines`. The answer I was aiming toward could have been
better asked, and that question would have been better answered with
`read().splitlines()`.
Answer: The easiest way might be simply to forget about the lines, and just read in
the entire file, then write it to the output:
with open('command.fort.13', 'wb') as outFile:
with open('command.info', 'rb') as com, open('fort.13', 'rb') as fort13:
outFile.write(com.read())
outFile.write(fort13.read())
As pointed out in a comment, this can cause high memory usage if either of the
inputs is large (as it copies the entire file into memory first). If this
might be an issue, the following will work just as well (by copying the input
files in chunks):
import shutil
with open('command.fort.13', 'wb') as outFile:
with open('command.info', 'rb') as com, open('fort.13', 'rb') as fort13:
shutil.copyfileobj(com, outFile)
shutil.copyfileobj(fort13, outFile)
|
Python/Django mime multipart email using boundary
Question: In Django(with python), how can I build an email that looks as follows:
What I need is an e-mail that starts with:
Content-Type: multipart/alternative;
boundary="=_5f8686714d769f9476ce778798b84ff4"
The boundary is the place to put plain text:
--=_5f8686714d769f9476ce778798b84ff4
Content-Type: text/plain; charset="ISO-8859-1"
Content-Transfer-Encoding: 7bit
This e-mail is in HTML-format. Click the following link:
http://www.company.nl/enews/7
--=_5f8686714d769f9476ce778798b84ff4
After that I need an related Content-Tye:
Content-Type: multipart/related;
boundary="=_e49477d06c604958b9b2bc038628a26f"
The boundary is the place to put the html
--=_e49477d06c604958b9b2bc038628a26f
Content-Type: text/html; charset="ISO-8859-1"
Content-Transfer-Encoding: quoted-printable
<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN" "http://www.= w3.org/TR/html4/loose.dtd"> <html style=3D"height: 100%"> <head>/head> <body></body> </html>
--=_e49477d06c604958b9b2bc038628a26f
Eventually it would look like this:
Received: (qmail 6116 invoked by uid 48); 16 Jul 2012 18:00:49 +0200
Date: 16 Jul 2012 18:00:49 +0200
To: [email protected]
Subject: Something
MIME-Version: 1.0
From: Company <[email protected]>
Content-Type: multipart/alternative;
boundary="=_5f8686714d769f9476ce778798b84ff4"
Message-ID: <[email protected]>
--=_5f8686714d769f9476ce778798b84ff4
Content-Type: text/plain; charset="ISO-8859-1"
Content-Transfer-Encoding: 7bit
This e-mail is in HTML-format. Click the following link:
http://www.company.nl/enews/7
--=_5f8686714d769f9476ce778798b84ff4
Content-Type: multipart/related;
boundary="=_e49477d06c604958b9b2bc038628a26f"
--=_e49477d06c604958b9b2bc038628a26f
Content-Type: text/html; charset="ISO-8859-1"
Content-Transfer-Encoding: quoted-printable
<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN" "http://www.=
w3.org/TR/html4/loose.dtd">
<html style=3D"height: 100%">
<head>/head>
<body></body>
</html>
--=_e49477d06c604958b9b2bc038628a26f
I tried this with Django's EmailMessage(Alternatives), python MimeMultipart
but I can't get it in the exact order.
Answer: If you are trying to send a plain text and HTML version of an e-mail (where
the plain text version just refers to an URL), the
[EmailMultiAlternatives](https://docs.djangoproject.com/en/1.4/topics/email/#sending-
alternative-content-types) class seems to work fine for me.
A slightly modified version of the example from the docs:
from django.core.mail import EmailMultiAlternatives
subject, from_email, to = 'hello', '[email protected]', '[email protected]'
text_content = 'This e-mail is in HTML-format. Click the following link:\n\nhttp://www.company.nl/enews/7'
html_content = '<p>This is an <strong>HTML-format</strong> version.</p>'
msg = EmailMultiAlternatives(subject, text_content, from_email, [to])
msg.attach_alternative(html_content, "text/html")
msg.send()
Results in this email (using the [console
backend](https://docs.djangoproject.com/en/1.4/topics/email/#console-
backend)):
Content-Type: multipart/alternative;
boundary="===============2514609180855632526=="
MIME-Version: 1.0
Subject: hello
From: [email protected]
To: [email protected]
Date: Wed, 18 Jul 2012 10:31:22 -0000
Message-ID: <[email protected]>
--===============2514609180855632526==
Content-Type: text/plain; charset="utf-8"
MIME-Version: 1.0
Content-Transfer-Encoding: 7bit
This e-mail is in HTML-format. Click the following link:
http://www.company.nl/enews/7
--===============2514609180855632526==
Content-Type: text/html; charset="utf-8"
MIME-Version: 1.0
Content-Transfer-Encoding: 7bit
<p>This is an <strong>HTML-format</strong> version.</p>
--===============2514609180855632526==--
While it does not have the `multipart/related` Content-Type, it does work both
on plain text (showing the link) and HTML clients (showing the HTML version).
|
Retrieving outlook Contacts via python
Question: I am Trying to get Contacts out of `Outlook` using `Python`. The code is :
import win32com.client
import pywintypes
o = win32com.client.Dispatch("Outlook.Application")
ns = o.GetNamespace("MAPI")
profile = ns.Folders.Item("Outlook")
contacts = profile.Folders.Item("Contacts")
but its giving error like this:
Traceback (most recent call last):
File "my_pro.py", line 7, in <module>
profile = ns.Folders.Item("Outlook")
File "C:\DOCUME~1\Manoj\LOCALS~1\Temp\gen_py\2.7\00062FFF-0000-0000-C000-00000
0000046x0x9x3\_Folders.py", line 70, in Item
ret = self._oleobj_.InvokeTypes(81, LCID, 1, (9, 0), ((12, 1),),Index
pywintypes.com_error: (-2147352567, 'Exception occurred.', (4096, u'Microsoft Of
fice Outlook', u'The operation failed. An object could not be found.', None, 0,
-2147221233), None)
I cant understand why its throwing error as I Do have a profile named
`Outlook`
Thanks
Answer: Here exists a python recipe to read contacts from outlook. Hope it would be
useful. He is using GetDefaultFolder instead of Folders.Item function.
<http://code.activestate.com/recipes/173216-import-outlook-contacts-using-
win32com/>
|
How to Pass windows full title name with space using Pywinauto in python
Question: I wanted to automate Adobe Reader menus,
from pywinauto import application
app = application.Application()
app.start_(r"C:\Program Files (x86)\Adobe\Reader 9.0\Reader\AcroRd32.exe")
so after how to get complete windows title "Adobe Reader" & navigate to File
menus
Answer: Check the documentation:
<http://pywinauto.googlecode.com/hg/pywinauto/docs/index.html>
You can use
[`MenuItems()`](http://pywinauto.googlecode.com/hg/pywinauto/docs/code/pywinauto.controls.HwndWrapper.html#pywinauto.controls.HwndWrapper.HwndWrapper.MenuItems)
to retrieve the menu items of a Dialog
|
R fitdistr for Beta distribution: which starting parameters?
Question: I need to fit my data into a Beta distribution and retrieve the alpha
parameter. I'm trying to use R from python (rpy2) and my code looks like:
from rpy2 import *
from rpy2.robjects.packages import importr
MASS = importr('MASS') #myVector is a Numpy array with values between 0 and 1
MASS.fitdistr(myVector,"beta")
But I get this error:
Error in function (x, densfun, start, ...) :
'start' must be a named list
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
File "/usr/lib/python2.7/dist-packages/rpy2/robjects/functions.py", line 82, in __call__
return super(SignatureTranslatedFunction, self).__call__(*args, **kwargs)
File "/usr/lib/python2.7/dist-packages/rpy2/robjects/functions.py", line 34, in __call__
res = super(Function, self).__call__(*new_args, **new_kwargs)
rpy2.rinterface.RRuntimeError: Error in function (x, densfun, start, ...) :
'start' must be a named list
I can't seem to find any good documentation for R with detailed examples, so I
only found
[this](http://stat.ethz.ch/R-manual/R-patched/library/stats/html/Beta.html):
> _**start_** A named list giving the parameters to be optimized with initial
> values. This can be omitted for some of the named distributions (see
> Details). ... Additional parameters, either for densfun or for optim. In
> particular, it can be used to specify bounds via lower or upper or both. If
> arguments of densfun (or the density function corresponding to a character-
> string specification) are included they will be held fixed.
I really have no clue as to:
* what to put as a starting parameters and how that will affect my estimation
* what syntax to use in Python, since `start=list(shape1=0.5, shape2=0.5)` won't do the trick
Any hint?
Answer: Ok, after a little bit more of digging, I found a solution:
from rpy2.robjects import DataFrame
starter= DataFrame({'shape1':0.5,'shape2':0.5})
x = MASS.fitdistr(myValues, "beta", start=starter))
|
Python TCPServer
Question: I have a simple question.
When I create a python TCPServer for example using the example code :
import sys, SocketServer, os
from multiprocessing import Pool, Queue
class MyTCPHandler(SocketServer.BaseRequestHandler):
def handle(self):
# self.request is the TCP socket connected to the client
self.data = self.request.recv(1024).strip()
print "{} wrote:".format(self.client_address[0])
print self.data
# just send back the same data, but upper-cased
self.request.sendall(self.data.upper())
if __name__ == '__main__':
pool = Pool(processes=2)
HOST, PORT = "localhost", 9999
server = SocketServer.TCPServer((HOST,PORT), MyTCPHandler )
server.serve_forever()
My question is : How can i pass to the function handle on the Class
MyTCPHandler the Object Pool ?
Thanks
Answer: If you want to have a multithreading `TCPServer` you can use the
`ThreadingMixIn` mixin class like this:
import SocketServer
class ThreadedTCPServer(SocketServer.ThreadingMixIn, SocketServer.TCPServer):
pass
You can also have a fork based TCPServer by using `ForkingMixIn` in the same
way as before.
More info can be found in the
[doc](http://docs.python.org/library/socketserver.html#asynchronous-mixins).
|
Load and show an image from the web in Python with Gtk 3?
Question: I'm writing an app on Ubuntu 12.04 with Python and GTK 3. The problem I have
is that I can't figure out how I should do to show a Gtk.Image in my app with
an image file from the web.
This is as far as I have come:
from gi.repository import Gtk
from gi.repository.GdkPixbuf import Pixbuf
import urllib2
url = 'http://lolcat.com/images/lolcats/1338.jpg'
response = urllib2.urlopen(url)
image = Gtk.Image()
image.set_from_pixbuf(Pixbuf.new_from_stream(response))
I think everything is correct except the last line.
Answer: This will work;
from gi.repository import Gtk
from gi.repository.GdkPixbuf import Pixbuf
from gi.repository import Gio
import urllib2
url = 'http://lolcat.com/images/lolcats/1338.jpg'
response = urllib2.urlopen(url)
input_stream = Gio.MemoryInputStream.new_from_data(response.read(), None)
pixbuf = Pixbuf.new_from_stream(input_stream, None)
image = Gtk.Image()
image.set_from_pixbuf(pixbuf)
|
Correct way to pause Python program
Question: I've been using the input function as a way to pause my scripts
print("something")
wait = input("PRESS ENTER TO CONTINUE.")
print("something")
is there a formal way to do this?
Answer: Seems fine to me (or `raw_input()` in Python 2.X). Alternatively you could use
`time.sleep()` if you want to pause for a certain number of seconds.
import time
print("something")
time.sleep(5.5) # pause 5.5 seconds
print("something")
|
Efficient method for getting elementwise types in Python/Pandas
Question: Following up on [a previous
question](http://stackoverflow.com/questions/11548005/numpy-or-pandas-keeping-
array-type-as-integer-while-having-a-nan-value), is there a preferred
efficient manner to get the type of each object within a column? This is
specifically for the case where the `dtype` of the column is `object` to allow
for heterogeneous types among the elements of the column (in particular,
allowing for numeric NaN without changing the data type of the other elements
to `float`).
I haven't done time benchmarking, but I am skeptical of the following
immediately obvious way that comes to mind (and variants that might use `map`
or `filter`). The use cases of interest need to quickly get info on the types
of all elements, so generators and the like probably won't be an efficiency
boon here.
# df is a pandas DataFrame with some column 'A', such that
# df['A'].dtype is 'object'
dfrm['A'].apply(type) #Or np.dtype, but this will fail for native types.
Another thought was to use the NumPy `vectorize` function, but is this really
going to be more efficient? For example, with the same setup as above, I could
try:
import numpy as np
vtype = np.vectorize(lambda x: type(x)) # Gives error without lambda
vtype(dfrm['A'])
Both ideas lead to workable output, but it's the efficiency I'm worried about.
**Added**
I went ahead and did a tiny benchmark in IPython. First is for `vtype` above,
then for the `apply` route. I repeated it a dozen or so times, and this
example run is pretty typical on my machine.
The `apply()` approach clearly wins, so is there a good reason to expect that
I won't get more efficient than with `apply()`?
**For`vtype()`**
In [49]: for ii in [100,1000,10000,100000,1000000,10000000]:
....: dfrm = pandas.DataFrame({'A':np.random.rand(ii)})
....: dfrm['A'] = dfrm['A'].astype(object)
....: dfrm['A'][0:-1:2] = None
....: st_time = time.time()
....: tmp = vtype(dfrm['A'])
....: ed_time = time.time()
....: print "%s:\t\t %s"%(ii, ed_time-st_time)
....:
100: 0.0351531505585
1000: 0.000324010848999
10000: 0.00209212303162
100000: 0.0224051475525
1000000: 0.211136102676
10000000: 2.2215731144
**For`apply()`**
In [50]: for ii in [100,1000,10000,100000,1000000,10000000]:
....: dfrm = pandas.DataFrame({'A':np.random.rand(ii)})
....: dfrm['A'] = dfrm['A'].astype(object)
....: dfrm['A'][0:-1:2] = None
....: st_time = time.time()
....: tmp = dfrm['A'].apply(type)
....: ed_time = time.time()
....: print "%s:\t %s"%(ii, ed_time-st_time)
....:
100: 0.000900983810425
1000: 0.000159025192261
10000: 0.00117015838623
100000: 0.0111050605774
1000000: 0.103563070297
10000000: 1.03093600273
Answer: `Series.apply` and `Series.map` use a specialized Cython method
(`pandas.lib.map_infer`) I wrote that is roughly 2x faster than using
`numpy.vectorize`.
|
CryptoJS and Pycrypto working together
Question: I'm encrypting a string in a web application using CryptoJS (v 2.3), and I
need to decrypt it on the server in Python, so I'm using PyCrypto. I feel like
I'm missing something because I can't can it working.
Here's the JS:
Crypto.AES.encrypt('1234567890123456', '1234567890123456',
{mode: new Crypto.mode.CBC(Crypto.pad.ZeroPadding)})
// output: "wRbCMWcWbDTmgXKCjQ3Pd//aRasZ4mQr57DgTfIvRYE="
The python:
from Crypto.Cipher import AES
import base64
decryptor = AES.new('1234567890123456', AES.MODE_CBC)
decryptor.decrypt(base64.b64decode("wRbCMWcWbDTmgXKCjQ3Pd//aRasZ4mQr57DgTfIvRYE="))
# output: '\xd0\xc2\x1ew\xbb\xf1\xf2\x9a\xb9\xb6\xdc\x15l\xe7\xf3\xfa\xed\xe4\xf5j\x826\xde(m\xdf\xdc_\x9e\xd3\xb1'
Answer: Here is a version with CryptoJS 3.1.2. Always beware of the following things
(use the same in both languages):
* Mode of operation (CBC in this case)
* Padding (Zero Padding in this case; better use PKCS#7 padding)
* Key (the same derivation function or clear key)
* Encoding (same encoding for key, plaintext, ciphertext, ...)
* IV (generated during encryption, passed for decryption)
If a string is passed as the `key` argument to the CryptoJS `encrypt()`
function, the string is used to derive the actual key to be used for
encryption. If you wish to use a key (valid sizes are 16, 24 and 32 byte),
then you need to pass it as a WordArray.
The result of the CryptoJS encryption is an OpenSSL formatted ciphertext
string. To get the actual ciphertext from it, you need to access the
`ciphertext` property on it.
The IV must be random for each encryption so that it is semantically secure.
That way attackers cannot say whether the same plaintext that was encrypted
multiple times is actually the same plaintext when only looking at the
ciphertext.
JavaScript:
var key = CryptoJS.enc.Utf8.parse('1234567890123456');
function encrypt(msgString, key) {
// msgString is expected to be Utf8 encoded
var iv = CryptoJS.lib.WordArray.random(16);
var encrypted = Crypto.AES.encrypt(msgString, key, {
iv: iv
});
return iv.concat(encrypted.ciphertext).toString(CryptoJS.enc.Base64);
}
function decrypt(ciphertextStr, key) {
var ciphertext = CryptoJS.enc.Base64.parse(ciphertextStr);
// split IV and ciphertext
var iv = ciphertext.clone();
iv.sigBytes = 16;
iv.clamp();
ciphertext.words.splice(0, 4); // delete 4 words = 16 bytes
ciphertext.sigBytes -= 16;
// decryption
var decrypted = CryptoJS.AES.decrypt({ciphertext: ciphertext}, key, {
iv: iv
});
return decrypted.toString(CryptoJS.enc.Utf8);
}
Python code:
BLOCK_SIZE = 16
key = b"1234567890123456"
def pad(data):
length = BLOCK_SIZE - (len(data) % BLOCK_SIZE)
return data + chr(length)*length
def unpad(data):
return data[:-ord(data[-1])]
def encrypt(message, passphrase):
IV = Random.new().read(BLOCK_SIZE)
aes = AES.new(passphrase, AES.MODE_CBC, IV)
return base64.b64encode(IV + aes.encrypt(pad(message)))
def decrypt(encrypted, passphrase):
encrypted = base64.b64decode(encrypted)
IV = encrypted[:BLOCK_SIZE]
aes = AES.new(passphrase, AES.MODE_CBC, IV)
return unpad(aes.decrypt(encrypted[BLOCK_SIZE:]))
* * *
**Other considerations:**
It seems that you want to use a passphrase as a key. Passphrases are usually
human readable, but keys are not. You can derive a key from a passphrase with
functions such as PBKDF2, bcrypt or scrypt.
The code above is not fully secure, because it lacks authentication.
Unauthenticated ciphertexts may lead to viable attacks and unnoticed data
manipulation. Usually the an encrypt-then-MAC scheme is employed with a good
MAC function such as HMAC-SHA256.
|
Integrating in Python using Sympy
Question: I am currently using `Sympy` to help me perform mathematical calculations.
Right now, I am trying to perform a numerical integration, but keep getting an
error any time I run the script. Here is the script:
from sympy import *
cst = { 'qe':1.60217646*10**-19, 'm0':N(1.25663706*10**-6) }
d = 3.6*10**-2
l = 20.3*10**-2
n = 217.0
I = 10.2
# Circum of loops
circ = l/n;
# Radius
r = N( circ/(2*pi) )
# Flux through a ring a distance R from the ceter
def flux(rad, I, loopRad):
distFromWire = loopRad - rad
bPoint = cst['m0']*I/(2*pi*distFromWire)
return ( bPoint*2*pi*rad )
# Integrate from r=0 to r=wireRad
x = Symbol('x')
ig = Symbol('ig')
ig = flux(x, I, r)
print(ig)
integrate(ig*x,x)
I am sure there is probably something wrong with the actual physics/math, but
right now I just want it to integrate. Here is the output I get when I run the
script:
8.05359718208634e-5*x/(-6.28318530717959*x + 0.000935483870967742)
Traceback (most recent call last):
File "script.py", line 34, in <module>
integrate(ig*x,x)
File "C:\Python27\lib\site-packages\sympy\utilities\decorator.py", line 24, in threaded_func
return func(expr, *args, **kwargs)
File "C:\Python27\lib\site-packages\sympy\integrals\integrals.py", line 847, in integrate
return integral.doit(deep = False)
File "C:\Python27\lib\site-packages\sympy\integrals\integrals.py", line 364, in doit
antideriv = self._eval_integral(function, xab[0])
File "C:\Python27\lib\site-packages\sympy\integrals\integrals.py", line 577, in _eval_integral
parts.append(coeff * ratint(g, x))
File "C:\Python27\lib\site-packages\sympy\integrals\rationaltools.py", line 42, in ratint
g, h = ratint_ratpart(p, q, x)
File "C:\Python27\lib\site-packages\sympy\integrals\rationaltools.py", line 124, in ratint_ratpart
H = f - A.diff()*v + A*(u.diff()*v).quo(u) - B*u
File "C:\Python27\lib\site-packages\sympy\core\decorators.py", line 75, in __sympifyit_wrapper
return func(a, sympify(b, strict=True))
File "C:\Python27\lib\site-packages\sympy\polys\polytools.py", line 3360, in __mul__
return f.mul(g)
File "C:\Python27\lib\site-packages\sympy\polys\polytools.py", line 1295, in mul
_, per, F, G = f._unify(g)
File "C:\Python27\lib\site-packages\sympy\polys\polytools.py", line 377, in _unify
F = f.rep.convert(dom)
File "C:\Python27\lib\site-packages\sympy\polys\polyclasses.py", line 277, in convert
return DMP(dmp_convert(f.rep, f.lev, f.dom, dom), dom, f.lev)
File "C:\Python27\lib\site-packages\sympy\polys\densebasic.py", line 530, in dmp_convert
return dup_convert(f, K0, K1)
File "C:\Python27\lib\site-packages\sympy\polys\densebasic.py", line 506, in dup_convert
return dup_strip([ K1.convert(c, K0) for c in f ])
File "C:\Python27\lib\site-packages\sympy\polys\domains\domain.py", line 85, in convert
raise CoercionFailed("can't convert %s of type %s to %s" % (a, K0, K1))
sympy.polys.polyerrors.CoercionFailed: can't convert DMP([1, 0], ZZ) of type ZZ[_b1] to RR
[Finished in 0.3s with exit code 1]
EDIT: Alright, so I pulled out the numbers that the program was using and put
it in wolfram alpha. Turns out that the integral doesn't converge, hence the
error. I guess it WAS just a math error.
Answer: It is a very bad idea to use a symbolic library for numerical work. Just use
scipy/numpy. That being said, for such a simple integral you could have used
sympy. However you should actually use sympy expressions, not dump everything
in opaque functions.
Firstly, learn how do variables in python work:
ig = Symbol('ig')
ig = flux(x, I, r)
After this operation `ig` is not a Symbol any more, it is just the return
value of `flux`.
Define all your symbols and then make an expression out of them. The integral
is sufficiently simple for sympy to handle it.
Finally, integral as simple as `const*x/(x-const)` as in your case should be
done by hand, not wasted on software.
[EDIT]: I have rewritten it cleanly, and still sympy does not integrate
correctly because of a bug. You could report it on the mailing list or issue
tracker and they will try to correct it. That being said, the expression is so
simple that it can be integrated by hand.
[EDIT2]:
In [5]: integrate(a*x/(b*x+c), x)
Out[5]:
⎛ ⎛ 2 ⎞⎞
⎜x c⋅log⎝b ⋅x + b⋅c⎠⎟
a⋅⎜─ - ─────────────────⎟
⎜b 2 ⎟
⎝ b ⎠
|
Can I bind multiple servers to the same TCP port?
Question: I would expect having multiple servers on the same port would cause problems.
In fact I want it to throw an exception when I try to start two servers on the
same port. The problem is, it seems more than happy to start multiple servers
on the same port. I can have many instances of the following code running just
fine with no exceptions.
import BaseHTTPServer
import SimpleHTTPServer
import sys
def main():
try:
server = BaseHTTPServer.HTTPServer(('127.0.0.1',5000), SimpleHTTPServer.SimpleHTTPRequestHandler)
print "On port: " + str(server.socket.getsockname()[1])
except Exception, e:
print e
server.serve_forever()
if __name__ == "__main__":
main()
All of which claim to be on port 5000. How can I get it to throw an exception
if it tries to use a port that is already taken?
Edit: This is Python 2.6.4
Edit 2:
[http://www.youtube.com/watch?v=rVOG3JdbHAM&feature=youtu.be](http://www.youtube.com/watch?v=rVOG3JdbHAM&feature=youtu.be)
Because people seem to think what I am explaining is not possible? Or I am
totally misunderstanding people. Either way, this video should clear it up. I
start two servers, neither of them print out any exceptions. When I close the
first, the second starts working. Why is this happening? I would expect the
2nd server to simply never start and print an exception. Is this not what
should happen?
Answer: I tried to execute your code and the second instance returned,
[Errno 98] Address already in use
as it should. Python 2.6 on SuSE Linux.
Can check with netstat utility whether port 5000 is really taken?
|
Which module should I import to use a PyHKEY?
Question: I'm attempting to win32api.RegLoadKey part of the pywin32 extension, however,
I am assuming I need to create a PyHKEY first. But I don't know which module
PyHKEY is in. The documentation is equally useless.
<http://docs.activestate.com/activepython/2.4/pywin32/PyHKEY.html> Note also
that the documentation which is there does note that a PyHKEY is just a
PyHANDLE, which is just an int, but using a int in the call causes Exception:
`error: (6, 'RegLoadKey', 'The handle is invalid.')`
Any help would be greatly appreciated!
A quick update:
import win32api
handle = int()
win32api.RegLoadKey(handle, "tempKey", "C:\\Users\\Default\\NTUSER.dat")
Answer: Python is dynamic; you don't "use" types unless you create your own object,
otherwise you use objects given to you.
[`win32api.RegOpenKeyEx()`](http://docs.activestate.com/activepython/2.4/pywin32/win32api__RegOpenKeyEx_meth.html)
will give you a key object you can use, or, as the documentation for
`win32api.RegLoadKey()` states, you can use one of 4 predefined constants to
load a hive root.
|
VPython Install Issues
Question: I'm trying to import the visual module for 64-bit python. Unfortunately, I
keep getting the following error:
> ImportError: numpy.core.multiarray failed to import
>
> Traceback (most recent call last):
>
> File "C:\python\color_space.py", line 2, in
>
>
> from visual import scene, color, sphere
>
>
> File "C:\Python27\lib\site-packages\visual__init__.py", line 1, in
>
>
> from .visual_all import *
>
>
> File "C:\Python27\lib\site-packages\visual\visual_all.py", line 1, in
>
>
> from vis import version
>
>
> File "C:\Python27\lib\site-packages\vis__init__.py", line 3, in
>
>
> from .cvisual import (vector, dot, mag, mag2, norm, cross, rotate,
>
>
> ImportError: numpy.core.multiarray failed to import
I've uninstalled my 64-bit version of python and tried the 32-bit version of
python with a 32-bit visual module, to no success. Now I've reverted to
64-bit. Any ideas on how to fix this?
Answer: It seems that you may not have numpy installed. You can download it here:
<http://www.scipy.org/Download/>
Or it might not be in your python directory.
|
Latitude and Longitude to Address
Question: I have about 8000 + Latitudes and Longitudes. I need to extract(reverse code),
them to location, possibly city.
Initially I checked with Google Maps, but according to their terms we should
not hit their services with our scripts.
Even the OpenStreetMaps doesnt allow us to hit their servers repeatedly. They
have some time limit.
So, I downloaded the latitudes and logitudes for locations. I wrote a python
script,
import tabular as tb
import csv
citiesLatLongData = tb.tabarray(SVfile="D:/latitude-longitude/citieslatlong.csv")
allData = tb.tabarray(SVfile="C:/Users/User/Desktop/alldata.csv")
latlonglocs = {'a1':"Car Nicobar",'a2':"Port Blair",'a3':"Hyderabad",'a4':"Kadapa",'a5':"Puttaparthi",
'a6':"Rajahmundry",'a7':"Tirupati",'a8':"Vijayawada",'a9':"Vishakhapatnam",'a10':"Itanagar",
'a11':"Dibrugarh",'a12':"Dispur",'a13':"Guwahati",'a14':"North Lakhimpur",'a15':"Silchar",
'a16':"Gaya",'a17':"Patna",'a18':"Chandigarh",'a19':"Raipur",'a20':"Silvassa",
'a21':"Daman",'a22':"Bawana",'a23':"New Delhi",'a24':"Mormugao",'a25':"Panaji",
'a26':"Ahmedabad",'a27':"Bhavnagar",'a28':"Bhuj",'a29':"Gandhinagar",'a30':"Jamnagar",
'a31':"Kandla",'a32':"Rajkot",'a33':"Vadodara",'a34':"Hisar",'a35':"Bilaspur",
'a36':"Dharamsala",'a37':"Kulu",'a38':"Shimla",'a39':"Jammu",'a40':"Srinagar",'a41':"Jamshedpur",
'a42':"Ranchi",'a43':"Bangalore",'a44':"Belgaum",'a45':"Bellary",'a46':"Hubli Dharwad",
'a47':"Mandya",'a48':"Mangalore",'a49':"Mysore",'a50':"Cochin",'a51':"Kozhikode",
'a52':"Thiruvananthapuram",'a53':"Bingaram Island ",'a54':"Kavaratti",'a55':"Bhopal",'a56':"Gwalior",
'a57':"Indore",'a58':"Jabalpur",'a59':"Khandwa",'a60':"Satna",'a61':"Ahmadnagar",
'a62':"Akola",'a63':"Aurangabad",'a64':"Jalna",'a65':"Kolhapur",'a66':"Mumbai",
'a67':"Nagpur",'a68':"Nasik",'a69':"Pimpri",'a70':"Pune",'a71':"Solapur",
'a72':"Imphal",'a73':"Shillong",'a74':"Aizawl",'a75':"Kohima",'a76':"Bhubaneswar",
'a77':"Jharsuguda",'a78':"Karaikal",'a79':"Mahe",'a80':"Pondicherry",'a81':"Yanam",
'a82':"Amritsar",'a83':"Pathankot",'a84':"Jaipur",'a85':"Jodhpur",'a86':"Kota",
'a87':"Udaipur",'a88':"Gangtok",'a89':"Chennai",'a90':"Coimbatore",'a91':"Madurai",
'a92':"Nagercoil",'a93':"Thiruchendur",'a94':"Thiruvannaamalai",'a95':"Thoothukudi",
'a96':"Tiruchirappalli",'a97':"Tirunelveli",'a98':"Vellore",'a99':"Agartala",
'a100':"Agra",'a101':"Allahabad",'a102':"Bareilly",'a103':"Gorakhpur",'a104':"Jhansi",
'a105':"Kanpur",'a106':"Lucknow",'a107':"Varanasi",'a108':"Dehradun",'a109':"Pantnagar",
'a110':"Kolkata",'a111':"Siliguri"}
latlongs = {'a1':[9.15,92.8167],'a2':[11.6667,92.7167],'a3':[17.45,78.4667],'a4':[14.4833,78.8333],
'a5':[14.1333,77.7833],'a6':[16.9667,81.7667],'a7':[13.65,79.4167],'a8':[16.5333,80.8],
'a9':[17.7,83.3],'a10':[27.0833,93.5667],'a11':[27.4833,95.0167],'a12':[26.0833,91.8333],
'a13':[26.1667,91.5833],'a14':[27.2333,94.1167],'a15':[24.8167,92.8],'a16':[24.75,84.95],
'a17':[25.6,85.1],'a18':[30.7333,76.75],'a19':[21.2333,81.6333],'a20':[20.2833,73],
'a21':[20.4167,72.85],'a22':[28.7833,77.0333],'a23':[28.5667,77.1167],'a24':[15.3833,73.8167],
'a25':[15.3833,73.8167],'a26':[23.0333,72.6167],'a27':[21.75,72.2],'a28':[23.25,69.6667],
'a29':[23.3333,72.5833],'a30':[22.4667,70.0667],'a31':[23.0333,70.2167],'a32':[22.3,70.7833],
'a33':[22.3,73.2667],'a34':[29.1667,75.7333],'a35':[31.25,76.6667],'a36':[32.2,76.4],
'a37':[31.9667,77.1],'a38':[31.1,77.1667],'a39':[32.7,74.8667],'a40':[34.0833,74.8167],
'a41':[22.8167,86.1833],'a42':[23.3167,85.3167],'a43':[12.9833,77.5833],'a44':[15.85,74.6167],
'a45':[15.15,76.85],'a46':[15.35,75.1667],'a47':[12.55,76.9],'a48':[12.9167,74.8833],
'a49':[12.3,76.65],'a50':[9.95,76.2667],'a51':[11.25,75.7667],'a52':[8.46667,76.95],
'a53':[10.9167,72.3333],'a54':[10.5833,72.65],'a55':[23.2833,77.35],'a56':[26.2333,78.2333],
'a57':[22.7167,75.8],'a58':[23.2,79.95],'a59':[21.8333,76.3667],'a60':[24.5667,80.8333],
'a61':[19.0833,74.7333],'a62':[20.7,77.0667],'a63':[19.85,75.4],'a64':[19.8333,75.8833],
'a65':[16.7,74.2333],'a66':[19.1167,72.85],'a67':[21.1,79.05],'a68':[19.8933,73.8],
'a69':[18.55,73.8167],'a70':[18.5333,73.8667],'a71':[17.6667,75.9],'a72':[24.7667,93.9],
'a73':[25.55,91.85],'a74':[23.6667,92.6667],'a75':[25.6667,94.1167],'a76':[20.25,85.8333],
'a77':[21.5833,84.08333],'a78':[10.95,79.7833],'a79':[11.7,75.5333],'a80':[11.9333,79.8833],
'a81':[16.7333,82.2167],'a82':[31.6333,74.8667],'a83':[32.2833,75.65],'a84':[26.8167,75.8],
'a85':[29.1667,75.7333],'a86':[25.15,75.85],'a87':[24.5667,73.6167],'a88':[27.3333,88.6167],
'a89':[13,80.1833],'a90':[11.0333,77.05],'a91':[9.83333,78.0833],'a92':[8.16667,77.4333],
'a93':[8.48333,78.1167],'a94':[12.2167,79.0667],'a95':[8.78333,78.1333],'a96':[10.7667,78.7167],
'a97':[8.73333,77.7],'a98':[12.9167,79.15],'a99':[23.8833,91.25],'a100':[27.15,77.9667],
'a101':[25.45,81.7333],'a102':[28.3667,79.4],'a103':[26.75,83.3667],'a104':[29.1667,75.7333],
'a105':[26.4,80.4],'a106':[26.75,80.8833],'a107':[25.45,83],'a108':[30.3167,78.0333],
'a109':[29.0833,79.5],'a110':[22.65,88.45],'a111':[26.6333,88.3167]
}
for eachOne in allData:
for eachTwo in latlongs:
eachOne_Coordinates_Latitude = eachOne['COORDINATES-Latitude']
latlongs_eachTwo_Latitude_Plus = int(latlongs[eachTwo][0]) + 0.18
latlongs_eachTwo_Latitude_Minus = int(latlongs[eachTwo][0]) - 0.18
eachOne_Coordinates_Longitude = eachOne['COORDINATES-Longitude']
latlongs_eachTwo_Longitude_Plus = int(latlongs[eachTwo][1]) + 0.18
latlongs_eachTwo_Longitude_Minus = int(latlongs[eachTwo][1]) - 0.18
if ( (eachOne_Coordinates_Latitude < latlongs_eachTwo_Latitude_Plus) and (latlongs_eachTwo_Latitude_Plus > latlongs_eachTwo_Latitude_Minus) ) and ( (eachOne_Coordinates_Longitude < latlongs_eachTwo_Longitude_Plus) and (eachOne_Coordinates_Longitude > latlongs_eachTwo_Longitude_Minus) ):
someDict.setdefault((eachOne_Coordinates_Latitude,eachOne_Coordinates_Longitude),[]).append(latlongs[eachTwo])
for each in someDict:
print each,':', min(someDict[each])
**MY PROBLEM:** As you know, the latitudes and longitudes that we get from
external sources does not exactly match with the latitudes and longitudes that
we have. I heard somewhere that they wont match and there will be some error
percentage or something.
I need some guidance from anyone. I request someone to please point me in the
right direction or if you know any packages or scripts that does this.
I would be extremely thankful to you.
Answer: This sounds a lot like a "Closest point problem". You have N points (cities)
and M locations (your 8000 coordinates). For each of the M locations, you want
to categorize the location by its closest city. There are a number of
solutions for the [Nearest Neighbor
Search](http://en.wikipedia.org/wiki/Closest_point_query), but the simplest
one is a linear search:
function getClosestCity(Coordinate location){
bestCity = cities[0];
foreach(city in cities){
if (distance(bestCity.location, location) < distance(city.location, location)){
bestCity = city;
}
}
return bestCity;
}
|
matplotlib - control capstyle of line collection/large number of lines
Question: Similarly to a [previous
question](http://stackoverflow.com/questions/11312579/networkx-draw-networkx-
edges-capstyle) of mine, I'd like to control the capstyle of lines being drawn
using matplotlib. However, I have an extremely large number of lines, and
drawing with anything other than a line collection takes way too long. Are
there any workarounds to control the capstyle of lines in a line collection in
a generic way (or alternatively, super fast ways of drawing a large number of
`Line2D` lines). For instance, I've tried using the matplotlib rc settings
via:
import matplotlib as mpl
mpl.rcParams['lines.solid_capstyle'] = 'round'
mpl.rcParams['lines.solid_joinstyle'] = 'round'
But this doesn't appear to have any affect. From the docstring for
`collections.py`:
> The classes are not meant to be as flexible as their single element
> counterparts (e.g. you may not be able to select all line styles) but they
> are meant to be fast for common use cases (e.g. a large set of solid line
> segemnts)
Which explains _why_ I can't seem to control various parameters, but I still
want to do it! I've had a look at the code for the AGG backend
(`_backend_agg.cpp`: not that I really understand it), and it appears that
line_cap and line_join are controlled by `gc.cap` and `gc.join`, where gc
comes from the `GCAgg` class. Does anyone know how one can control this from
Python? Am I asking the right question here? Perhaps that are easier ways to
control these parameters?
Any help is greatly appreciated... I'm desperate to get this working, so even
crazy hacks are welcome!
Thanks,
Carson
Answer: I was struggling with the same issue. I ended up plotting a scatter plot on
top of my line collection. It's not perfect, but it may work for your
application. There's a few subtleties - below is a working example.
import numpy as np
import matplotlib.pyplot as plt
from matplotlib.collections import LineCollection
x = np.random.random(10)
y = np.random.random(10)
z = np.arange(0,10)
points = np.array([x, y]).T.reshape(-1, 1, 2)
segments = np.concatenate([points[:-1], points[1:]], axis=1)
fig = plt.figure()
ax = fig.add_subplot(111)
linewidth = 10
cmap = plt.get_cmap('jet')
norm = plt.Normalize(np.min(z), np.max(z))
color = cmap(norm(z))
lc = LineCollection(segments, linewidths=linewidth, cmap=cmap, norm=norm)
lc.set_array(z)
lc.set_zorder(z.tolist())
ax.add_collection(lc)
ax.scatter(x,y,color=color,s=linewidth**2,edgecolor='none', zorder=(z+2).tolist())
|
TypeError with PAMIE
Question: I am getting a TypeError with a very simple script on PAMIE, and I'm not sure
what I can do. I had found an answer suggesting that the library, `pywin32`
might not have set a `self` argument for this particular method
(`getElementsByTagName`) but I don't know for sure, as I don't know where to
find the definition of it.
from PAM30 import PAMIE
ie = PAMIE()
ie.navigate('google.com')
ie.getButtons()
ie.quit()
print 'done'
The error is:
Traceback (most recent call last):
File "c:\pamie1.py", line 1, in <module>
from PAM30 import PAMIE
File "C:\Python27\Lib\site-packages\PAM30.py", line 678, in getButtons
return self.getElementsList("input", filter)
File "C:\Python27\Lib\site-packages\PAM30.py", line 939, in getElementsList
elements = self._ie.Document.getElementsByTagName(tag)
TypeError: getElementsByTagName() takes exactly 1 argument (2 given)
Here's the offending line in `PAM30`
elements = self._ie.Document.getElementsByTagName(tag)
where `_ie_` is
self._ie = win32com.client.dynamic.Dispatch('InternetExplorer.Application')
I'm using Windows 7x64 with Python2.7 32bit
Answer: [sourceforge bug
link](http://sourceforge.net/tracker/index.php?func=detail&aid=3562879&group_id=78018&atid=551954)
"Workaround" seems to be enable Compatibility View (`Tools > Compatibility
View settings > Display all websites in Compatibility View`).
it is a bug of IE.
|
Best Method to Find Multiple String Occurrences in Python
Question: I need to be pointed in the right direction for this problem I'm working on:
Let's say I'm reading output from a C program as follows:
while True:
ln = p.stdout.readline()
if '' == ln:
break
#do stuff here with ln
And my output looks like this line for line:
TrnIq: Thread on CPU 37
TrnIq: Thread on CPU 37 but will be moved to CPU 44
IP-Thread on CPU 33
FANOUT Thread on CPU 37
Filter-Thread on CPU 38 but will be moved to CPU 51
TRN TMR Test 2 Supervisor Thread on CPU 34
HomographyWarp Traking Thread[0] on CPU 26
I want to capture "TrnIq: Thread on" and "37" as 2 separate variables: a
string and a number from output "TrnIq: Thread on CPU 37".
Its pretty well the same for the other lines to, for example capture
"HomographyWarp Traking Thread[0] on" and the # "26" from "HomographyWarp
Traking Thread[0] on CPU 26".
The only real challenge is for lines like this: "Filter-Thread on CPU 38 but
will be moved to CPU 51" on this line I need "Filer-Thread" and the # "51" not
the first # "38".
Python has so many different ways to do this I dont even know where to start!
Thanks in advance!
Answer: The following should return a tuple of the information assuming `ln` is a
single line of your data (edited to include converting the CPU value to an
int):
match = re.match(r'(.*?)(?: on CPU.*)?(?: (?:on|to) CPU )(.*)', ln).groups()
if match:
proc, cpu = match.groups()
cpu = int(cpu)
Example:
>>> import re
>>> for ln in lines:
... print re.match(r'(.*?)(?: on CPU.*)?(?: (?:on|to) CPU )(.*)', ln).groups()
...
('TrnIq: Thread', '37')
('TrnIq: Thread', '44')
('IP-Thread', '33')
('FANOUT Thread', '37')
('Filter-Thread', '51')
('TRN TMR Test 2 Supervisor Thread', '34')
('HomographyWarp Traking Thread[0]', '26')
Explanation:
(.*?) # capture zero or more characters at the start of the string,
# as few characters as possible
(?: on CPU.*)? # optionally match ' on CPU' followed by any number of characters,
# do not capture this
(?: (?:on|to) CPU ) # match ' on CPU ' or ' to CPU ', but don't capture
(.*) # capture the rest of the line
Rubular: <http://www.rubular.com/r/HqS9nGdmbM>
|
Copy a file line by line in python
Question: I am writing a python program to copy a file line by line into a new file. The
code I have is below in which I am using a loop to copy the file line by line.
However since the number of lines in the file may change, is there a way to
copy a file line by line in python without using a loop which relies on
numbers, and instead relies on the something like the EOF character to
terminate the loop?
import os
import sys
i = 0
f = open("C:\\Users\\jgr208\\Desktop\\research_12\\sap\\beam_springs.$2k","r")
copy = open("C:\\Users\\jgr208\\Desktop\\research_12\\sap\\copy.$2k","wt")
#loop that copies file line by line and terminates loop when i reaches 10
while i < 10:
line = f.readline()
copy.write(str(line))
i = i +1
f.close()
copy.close()
Answer: You can iterate over lines in a file object in Python by iterating over the
file object itself:
for line in f:
copy.write(line)
From the [docs on file
objects](http://docs.python.org/tutorial/inputoutput.html#methods-of-file-
objects):
> An alternative approach to reading lines is to loop over the file object.
> This is memory efficient, fast, and leads to simpler code:
>>> for line in f:
print line,
|
Ubuntu pass information to a text file during process execution
Question: My issue is that I have a function call it function1 which runs indefinitely.
The function itself echo's "hello" every 1 second. Using the command:
function1 >> temp.txt
Every 1 second if I am to view the file temp.txt I should see a new line with
"hello". However what's happening is that the function doesn't write to the
file until its finished running. Therefore if I am to kill the function
nothing will be written. Does anyone know of something I can do in this
situation that will basically dynamically update temp.txt?
I have a python script set up the following way:
while [1>0]:
print "hello"
time.sleep(1)
Therefore this will always be running. Now I call this in a bash script
python pythonscript.py >> temp.txt
If I `kill` the process no data is logged.
Answer: You are going to want to flush the buffer after each print.
import time
import sys
while [1>0]:
print "hello"
sys.stdout.flush()
time.sleep(1)
This will also work on other operating systems.
|
SSL Connection Using .pem Certificate With Python
Question: I'm trying to establish successful communication over an HTTPS connection
using authentication. I'm using Python 2.7 w/ Django 1.4 on Ubuntu 12.04.
The API documentation I'm following has specific requirements for
authentication. Including the `Authentication` header you'll find below and
sending certificate information.
This is the code:
import httplib
import base64
HOST = 'some.host.com'
API_URL = '/some/api/path'
username = '1234'
password = '5678'
auth_value = base64.b64encode('WS{0}._.1:{1}'.format(username, password))
path = os.path.join(os.path.dirname(__file__), 'keys/')
pem_file = '{0}WS{1}._.1.pem'.format(path, username)
xml_string = '<some><xml></xml><stuff></stuff></some>'
headers = { 'User-Agent' : 'Rico',
'Content-type' : 'text/xml',
'Authorization' : 'Basic {0}'.format(auth_value),
}
conn = httplib.HTTPSConnection(HOST, cert_file = pem_file)
conn.putrequest("POST", API_URL, xml_string, headers)
response = conn.getresponse()
I'm getting the following error:
Traceback:
File "/usr/local/lib/python2.7/dist-packages/django/core/handlers/base.py" in get_response
111. response = callback(request, *callback_args, **callback_kwargs)
File "/usr/local/lib/python2.7/dist-packages/django/views/decorators/csrf.py" in wrapped_view
77. return view_func(*args, **kwargs)
File "/home/tokeniz/tokeniz/gateway_interface/views.py" in processPayment
37. processCreditCard = ProcessCreditCard(token, postHandling)
File "/home/tokeniz/tokeniz/gateway_interface/credit_card_handling.py" in __init__
75. self.processGateway()
File "/home/tokeniz/tokeniz/gateway_interface/credit_card_handling.py" in processGateway
95. gateway = Gateway(self)
File "/home/tokeniz/tokeniz/gateway_interface/first_data.py" in __init__
37. self.postInfo()
File "/home/tokeniz/tokeniz/gateway_interface/first_data.py" in postInfo
245. response = conn.getresponse()
File "/usr/lib/python2.7/httplib.py" in getresponse
1018. raise ResponseNotReady()
Exception Type: ResponseNotReady at /processPayment/
Exception Value:
Why am I getting this error?
UPDATE 1: I've been using the `.pem` file they gave me (Link Point Gateway)
but have read that the certificate file should contain both the certificate
and the RSA private key. Is that correct? I tried to send a `.pem` file
containing both and received the following error:
Traceback:
File "/usr/local/lib/python2.7/dist-packages/django/core/handlers/base.py" in get_response
111. response = callback(request, *callback_args, **callback_kwargs)
File "/usr/local/lib/python2.7/dist-packages/django/views/decorators/csrf.py" in wrapped_view
77. return view_func(*args, **kwargs)
File "/home/tokeniz/tokeniz/gateway_interface/views.py" in processPayment
37. processCreditCard = ProcessCreditCard(token, postHandling)
File "/home/tokeniz/tokeniz/gateway_interface/credit_card_handling.py" in __init__
75. self.processGateway()
File "/home/tokeniz/tokeniz/gateway_interface/credit_card_handling.py" in processGateway
95. gateway = Gateway(self)
File "/home/tokeniz/tokeniz/gateway_interface/first_data.py" in __init__
37. self.postInfo()
File "/home/tokeniz/tokeniz/gateway_interface/first_data.py" in postInfo
251. conn.request('POST', self.API_URL, self.xml_string, headers)
File "/usr/lib/python2.7/httplib.py" in request
958. self._send_request(method, url, body, headers)
File "/usr/lib/python2.7/httplib.py" in _send_request
992. self.endheaders(body)
File "/usr/lib/python2.7/httplib.py" in endheaders
954. self._send_output(message_body)
File "/usr/lib/python2.7/httplib.py" in _send_output
814. self.send(msg)
File "/usr/lib/python2.7/httplib.py" in send
776. self.connect()
File "/usr/lib/python2.7/httplib.py" in connect
1161. self.sock = ssl.wrap_socket(sock, self.key_file, self.cert_file)
File "/usr/lib/python2.7/ssl.py" in wrap_socket
381. ciphers=ciphers)
File "/usr/lib/python2.7/ssl.py" in __init__
141. ciphers)
Exception Type: SSLError at /processPayment/
Exception Value: [Errno 336265225] _ssl.c:351: error:140B0009:SSL routines:SSL_CTX_use_PrivateKey_file:PEM lib
I can't tell if this is a step forward or backward.
UPDATE 2: I've tried to pass both a certificate file and a key file when
creating the connection object.
conn = httplib.HTTPSConnection(HOST, cert_file = pem_file, key_file = key_file)
I get the following error:
Traceback:
File "/usr/local/lib/python2.7/dist-packages/django/core/handlers/base.py" in get_response
111. response = callback(request, *callback_args, **callback_kwargs)
File "/usr/local/lib/python2.7/dist-packages/django/views/decorators/csrf.py" in wrapped_view
77. return view_func(*args, **kwargs)
File "/home/tokeniz/tokeniz/gateway_interface/views.py" in processPayment
37. processCreditCard = ProcessCreditCard(token, postHandling)
File "/home/tokeniz/tokeniz/gateway_interface/credit_card_handling.py" in __init__
75. self.processGateway()
File "/home/tokeniz/tokeniz/gateway_interface/credit_card_handling.py" in processGateway
95. gateway = Gateway(self)
File "/home/tokeniz/tokeniz/gateway_interface/first_data.py" in __init__
37. self.postInfo()
File "/home/tokeniz/tokeniz/gateway_interface/first_data.py" in postInfo
252. conn.request('POST', self.API_URL, self.xml_string, headers)
File "/usr/lib/python2.7/httplib.py" in request
958. self._send_request(method, url, body, headers)
File "/usr/lib/python2.7/httplib.py" in _send_request
992. self.endheaders(body)
File "/usr/lib/python2.7/httplib.py" in endheaders
954. self._send_output(message_body)
File "/usr/lib/python2.7/httplib.py" in _send_output
814. self.send(msg)
File "/usr/lib/python2.7/httplib.py" in send
776. self.connect()
File "/usr/lib/python2.7/httplib.py" in connect
1161. self.sock = ssl.wrap_socket(sock, self.key_file, self.cert_file)
File "/usr/lib/python2.7/ssl.py" in wrap_socket
381. ciphers=ciphers)
File "/usr/lib/python2.7/ssl.py" in __init__
141. ciphers)
Exception Type: SSLError at /processPayment/
Exception Value: [Errno 336265225] _ssl.c:351: error:140B0009:SSL routines:SSL_CTX_use_PrivateKey_file:PEM lib
If I try and combine the certificate file and key file and send it as the
certificate argument I receive the same error.
Answer: It would seem that some of the "higher level" libraries in Python are not
equipped to handle this kind of authentication connection. After many days of
attempts I was finally able to come up with a solution going down to the
socket level.
host = 'some.host.com'
service = '/some/api/path'
port = 443
# Build the authorization info
username = '1234'
password = '5678'
path = '/path/to/key/files/'
pem_file = '{0}WS{1}._.1.pem'.format(path, username)
key_file = '{0}WS{1}._.1.key'.format(path, username)
auth = base64.b64encode('WS{0}._.1:{1}'.format(username, password))
## Create the header
http_header = "POST {0} HTTP/1.0\nHost: {1}\nContent-Type: text/xml\nAuthorization: Basic {2}\nContent-Length: {3}\n\n"
req = http_header.format(service, host, auth, len(xml_string)) + xml_string
## Create the socket
sock = socket.socket(socket.AF_INET, socket.SOCK_STREAM)
conn = ssl.wrap_socket(sock, keyfile = key_file, certfile = pem_file)
conn.connect((host, port))
conn.send(req)
response = ''
while True:
resp = conn.recv()
response += resp
if (resp == ''):
break
I hope someone finds this useful. This particular implementation was to
interface with Link Point Gateway with Python (not supported by First Data
(Link Point)). Talk about a nightmare this whole project has been. haha
Anyway, for anyone having trouble using Link Point please be advised that the
`.key` file they provide you is not sufficient for creating a connection in
Python.
`openssl rsa -in orig_file.key -out new_file.key`
Then use the `new_file.key` instead.
|
Django Installation Error :
Question: Trying to create the first project. First got the below error when I ran,
django-admin.py startproject mysite
then I tried,
django-admin.py
Also symlinked the path and its in the path. But I still get the error.
. . .
File "/Users/Satha/django-trunk/django/bin/django-admin.py", line 7, in
execfile(**file**) File "/Users/Satha/django-trunk/django/bin/django-
admin.py", line 4, in from pkg_resources import require;
require('Django==1.5.dev20120720114244') File
"/System/Library/Frameworks/Python.framework/Versions/2.7/Extras/lib/python/pkg_resources.py",
line 666, in require needed = self.resolve(parse_requirements(requirements))
File
"/System/Library/Frameworks/Python.framework/Versions/2.7/Extras/lib/python/pkg_resources.py",
line 546, in resolve requirements = list(requirements)[::-1] # set up the
stack File
"/System/Library/Frameworks/Python.framework/Versions/2.7/Extras/lib/python/pkg_resources.py",
line 2438, in parse_requirements yield Requirement(project_name, specs,
extras) File
"/System/Library/Frameworks/Python.framework/Versions/2.7/Extras/lib/python/pkg_resources.py",
line 2465, in **init** self.unsafe_name, project_name = project_name,
safe_name(project_name) File
"/System/Library/Frameworks/Python.framework/Versions/2.7/Extras/lib/python/pkg_resources.py",
line 1113, in safe_name return re.sub('[^A-Za-z0-9.]+', '-', name) File
"/System/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/re.py",
line 151, in sub File
"/System/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/re.py",
line 231, in _compile RuntimeError: maximum recursion depth exceeded while
calling a Python object
Answer: Unless you have some specific reason, you should probably not be using an
unstable dev version of django (1.5). Though I am not exactly sure why you are
having problems even with the dev branch, as it installs fine for me and
creates a project equally as easily.
I recommend trying to first remove the dev version, and then install django
via `easy_install` or `pip` which will get you v1.4. [Installation
Instructions
here](https://docs.djangoproject.com/en/1.4/topics/install/#installing-an-
official-release-with-pip)
If after installing django 1.4, if you still have this issue, try creating a
[virtualenv](http://www.virtualenv.org/en/latest/index.html), which will make
an isolated environment in a directory, and then install django in that.
|
python subprocess as normal user
Question: I have a script that needs to be run as a super user:
$ sudo ./python-script.py
Within this script, I do some other things that _do not_ require super user
privileges.
$ os.mkdir('somefolder')
What is the best/most efficient way of creating the directory as non-root
user? Should I let the script make the directory as root user, and then change
permissions on it?
Answer: `os.mkdir` does allow you to specify the permissions explicitly:
os.mkdir(path [, mode=0777])
And you also have the option of running `os.chown` to set the user and group
os.chown(path, uid, gid)
You can probably get the original user like this (but it might be platform
specific?)
import os
original_user = os.environ.get('SUDO_USER')
original_uid = os.environ.get('SUDO_UID')
original_gid = os.environ.get('SUDO_GID')
|
Is there a python json library can convert json to model objects, similar to google-gson?
Question: The standard python json module only can convert json string to dict
structures.
But I prefer to convert json to a model object strutures with their "parent-
child" relationship.
I use google-gson in Android apps but don't know which python library could do
this.
Answer: You could let the json module construct a dict and then use an
[`object_hook`](http://docs.python.org/library/json.html#module-json) to
[transform the dict into an
object](http://stackoverflow.com/questions/1305532/convert-python-dict-to-
object), something like this:
>>> import json
>>>
>>> class Person(object):
... firstName = ""
... lastName = ""
...
>>>
>>> def as_person(d):
... p = Person()
... p.__dict__.update(d)
... return p
...
>>>
>>> s = '{ "firstName" : "John", "lastName" : "Smith" }'
>>> o = json.loads(s, object_hook=as_person)
>>>
>>> type(o)
<class '__main__.Person'>
>>>
>>> o.firstName
u'John'
>>>
>>> o.lastName
u'Smith'
>>>
|
Python - how to create a random string 8 bytes long?
Question: > **Possible Duplicate:**
> [python random string generation with upper case letters and
> digits](http://stackoverflow.com/questions/2257441/python-random-string-
> generation-with-upper-case-letters-and-digits)
I need to create a random string that is 8 bytes long in python.
rand_string = ?
How do I do that?
Thanks
Answer:
import os
rand_string = os.urandom(8)
Would create a random string that is 8 characters long.
|
How can I further shorten this Python script which copies the contents of one file to another file?
Question: I'm reading Zed Shaw's "Learn Python The Hard Way". I'm up to exercise 17 (
<http://learnpythonthehardway.org/book/ex17.html> ) and hit the wall on extra
credit #'s 2 & 3\. Zed wants me to shorten the script by eliminating anything
that isn't necessary (he claims he can get it to run with just one line in the
script).
Here is the original script...
from sys import argv
from os.path import exists
script, from_file, to_file = argv
print "Copying from %s to %s" % (from_file, to_file)
# we could do these two on one line too, how?
input = open(from_file)
indata = input.read()
print "The input file is %d bytes long" % len(indata)
print "Does the output file exist? %r" % exists(to_file)
print "Ready, hit RETURN to continue, CTRL-C to abort."
raw_input()
output = open(to_file, 'w')
output.write(indata)
print "Alright, all done."
output.close()
input.close()
Here's what I was able to shorten the script to and still get it to run
properly (by properly I mean that the script successfully copies the intended
text to the intended file)...
from sys import argv
from os.path import exists
script, from_file, to_file = argv
input = open (from_file)
indata = input.read ()
output = open (to_file, 'w')
output.write (indata)
I got rid of the print commands and the two close commands (please excuse if
I'm using "command" incorrectly...I'm painfully new to coding and haven't
gotten the jargon down yet).
Anything else I try to further shorten the script produces errors. For
example, I tried to combine the "input" and "indata" commands into one line
like so...
input = open (from_file, 'r')
Then I changed any "indata" references in the script to "input"...
from sys import argv
from os.path import exists
script, from_file, to_file = argv
input = open (from_file, 'r')
output = open (to_file, 'w')
output.write (input)
But I get the following TypeError...
new-host:python Eddie$ python ex17.py text.txt copied.txt
Traceback (most recent call last):
File "ex17.py", line 10, in <module>
output.write (input)
TypeError: expected a character buffer object
How would you go about shortening the script further...or shortening it down
to just one line, as Zed suggests he can do?
Answer: The current error you get is due to this:
input = open (from_file, 'r')
output.write (input)
[write()](http://docs.python.org/library/stdtypes.html?highlight=write#file.write)
wants a string as parameter, you are giving it a file object.
Also, since you are trying to eliminate redundant things/shorten your code,
small item, the default mode for
[opening](http://docs.python.org/library/functions.html#open) files is
`'r'`ead, to that doesn't have to be specified when opening files for reading.
Also consider using the `with` construct to open and manage your files. The
advantage is that the files will be closed for you automatically when you are
done, or an exception is encountered, so no explicit `close()` is required.
E.g.,
with open('data.txt') as input:
## all of your file ops here
The [**PEP08 -- Style Guide for
Python**](http://www.python.org/dev/peps/pep-0008/) (a "must read" for Python
programmers) suggests not space between a function and the opening `(`.
I'm not sure a goal of one-line always results in a better or more readable
solution, so that should be kept in mind.
|
Programmatically login to OKC
Question: I'm trying to programatically login to OKCupid
([www.okcupid.com/login](http://www.okcupid.com/login))in order to fetch
scrape some user data. I've tried to put together a python script to do this,
but seem to be doing something wrong.
The behavior I'd like from this sample script is to login, follow a redirect
to the homepage then print the HTML response. Here's what I have so far:
import urllib, urllib2, cookielib
# cookie storage
cj = cookielib.CookieJar()
opener = urllib2.build_opener(
urllib2.HTTPCookieProcessor(cj),
urllib2.HTTPRedirectHandler
)
# Useragent
opener.addheaders.append(('User-agent','Mozilla/4.0'))
url = 'http://www.okcupid.com/login'
login_data = urllib.urlencode({
'username':'myusername',
'password':'mypassword',
})
req = urllib2.Request(url,login_data)
resp = urllib2.urlopen(req)
the_page = resp.read()
print the_page
Answer: based on what you are doing, here's an example of what i'm doing to login,
then go to messages and save all usernames
import urllib, urllib2, cookielib
import re
# cookie storage
cj = cookielib.CookieJar()
opener = urllib2.build_opener(
urllib2.HTTPCookieProcessor(cj),
urllib2.HTTPRedirectHandler
)
# Useragent
opener.addheaders.append(('User-agent','Mozilla/4.0'))
url = 'http://www.okcupid.com/login'
login_data = urllib.urlencode({
'username':'Mobius1',
'password':'raptor22',
})
urllib2.install_opener(opener)
res = opener.open(url, login_data)
print res.url #should be http://www.okcupid.com/home if successful
res.close()
#navigate profile after successful login
res = opener.open('http://www.okcupid.com/messages')
the_page = res.read() #read content at URL
#find all usernames from page content with pattern /profile/username?
UserNameList = re.findall(r'/profile/([\w\.-]+)?', the_page)
print UserNameList
with open('OkC_messages.html', 'w') as fid: #save the_page as html
fid.write(the_page)
|
How can I display an image in Python 3 using tkinter/ttk?
Question: The nub of the matter is, what am I doing wrong in the following code snippet?
from tkinter import *
from tkinter.ttk import *
root = Tk()
myButton = Button(root)
myImage = PhotoImage(myButton, file='myPicture.gif')
myButton.image = myImage
myButton.configure(image=myImage)
root.mainloop()
The error message I get from idle3 is as follows:
>>>
Traceback (most recent call last):
File "/home/bob/Documents/Python/tkImageTest.py", line 9, in <module>
myButton.configure(image=myImage)
File "/usr/lib/python3.2/tkinter/__init__.py", line 1196, in configure
return self._configure('configure', cnf, kw)
File "/usr/lib/python3.2/tkinter/__init__.py", line 1187, in _configure
self.tk.call(_flatten((self._w, cmd)) + self._options(cnf))
TypeError: __str__ returned non-string (type Button)
>>>
This error message has me stumped, I simply don't understand what it is trying
to say. Any ideas?
I would also appreciate suggestions for changes...
Answer: The error seems to point to the `myButton` argument passed to `PhotoImage`. As
you noted in your comment, `PhotoImage` was treating the widget object as a
string (there are several options of type string; see a list of PhotoImage
options
[here](http://www.pythonware.com/library/tkinter/introduction/x6716-options.htm)).
Your code will work if you implement that line without referencing the
`myButton` object:
myImage = PhotoImage(file='myPicture.gif')
I'm not certain you need to alter the `PhotoImage` constructor. Look at the
`PhotoImage` docs to determine the valid options (i.e. resource names) for
that class. Quoting the help file:
> Help on class PhotoImage in module tkinter:
>
> class PhotoImage(Image)
>
>
> | Widget which can display colored images in GIF, PPM/PGM format.
> |
> | Method resolution order:
> | PhotoImage
> | Image
> | builtins.object
> |
> | Methods defined here:
> |
> | __getitem__(self, key)
> | # XXX config
> |
> | __init__(self, name=None, cnf={}, master=None, **kw)
> | Create an image with NAME.
> |
> | Valid resource names: data, format, file, gamma, height, palette,
> | width.
>
* * *
FYI: The easiest way to get to the docs from Python at the command line or
from IDLE:
from tkinter import PhotoImage
help(PhotoImage)
And lastly, another useful link about this class is at
<http://tkinter.unpythonic.net/wiki/PhotoImage>.
|
Importing matplotlib on Ubuntu
Question: So I downloaded and installed matplotlib. The weird things is that I can run
the examples fine when they were placed in home/user/Desktop but when I moved
them to home/user/Documents, they stopped working and I get the below message.
Is there something special about the Documents folder that they prevent
matplotlib from importing?
Traceback (most recent call last):
File "contour_manual.py", line 4, in <module>
import matplotlib.pyplot as plt
File "/usr/local/lib/python2.7/dist-packages/matplotlib/pyplot.py", line 23, in <module>
from matplotlib.figure import Figure, figaspect
File "/usr/local/lib/python2.7/dist-packages/matplotlib/figure.py", line 18, in <module>
from axes import Axes, SubplotBase, subplot_class_factory
File "/usr/local/lib/python2.7/dist-packages/matplotlib/axes.py", line 8454, in <module>
Subplot = subplot_class_factory()
File "/usr/local/lib/python2.7/dist-packages/matplotlib/axes.py", line 8446, in subplot_class_factory
new_class = new.classobj("%sSubplot" % (axes_class.__name__),
AttributeError: 'module' object has no attribute 'classobj'
Answer: Do you have a file `new.py` in your `Documents` folder, by any chance? If you
have, try renaming it to something else.
The matplotlib module `axes.py` imports `new`, and if you have a file `new.py`
lying around in your Documents folder, that will cause Python to load it
instead of the built-in `new` module.
|
Youtube in Webkit/Python/GTK app
Question: I'm trying to do a python(2.7)/GTK+ app, and I have a window, containing a
WebKit WebView.
from gi.repository import Gtk, WebKit
class MainWindow:
def __init__( self ):
self.builder = Gtk.Builder()
self.builder.add_from_file("youtubeWindow.ui")
self.main_window = self.builder.get_object("main_window")
self.scrl_window = self.builder.get_object("scrl_window")
self.webview = WebKit.WebView()
self.scrl_window.add(self.webview)
self.webview.show()
self.webview.open("http://youtu.be/o-akcEzQ6Y8")
self.main_window.show_all()
Gtk.main()
tube_window = MainWindow()
When I run my app I get the folowing error:
> ERROR: Invalid browser function table. Some functionality may be restricted.
> java version "1.6.0_24" OpenJDK Runtime Environment (IcedTea6 1.11.3)
> (6b24-1.11.3-1ubuntu0.12.04.1) OpenJDK 64-Bit Server VM (build 20.0-b12,
> mixed mode) ** Message: console message: undefined @0: TypeError:
> 'undefined' is not an object
The page loads, but I can't play my video :( (The video box is all black and
doesn't have any play button, nothing)
The UI is made in Glade and the XML file generated by Glade, youtubeWindow.ui
is:
<?xml version="1.0" encoding="UTF-8"?>
<interface>
<!-- interface-requires gtk+ 3.0 -->
<object class="GtkWindow" id="main_window">
<property name="can_focus">False</property>
<property name="type_hint">menu</property>
<child>
<object class="GtkScrolledWindow" id="scrl_window">
<property name="visible">True</property>
<property name="can_focus">True</property>
<property name="shadow_type">in</property>
<child>
<placeholder/>
</child>
</object>
</child>
</object>
</interface>
Can you please help me? Thanks!
Answer: I've found the solution to your problem. The error message from OpenJDK is
irrevelant, it comes from the Java browser plugin and has no effect on what
you're trying to do.
Far more important, you make a simple mistake. You simply don't show your
window! Add a
self.main_window.show_all()
before the call to `Gtk.main()` and your window is shown, Youtube video
playback starts and everything works properly.
|
How to install and run pandas python library in Eclipse Juno?
Question: I am using pydev plugin in Eclipse Juno for my python programming in windows 7
and i am using python 3.2, it works fine while running python application
which using standard python packages. For my one of my project i have to use
pandas library, for that i download and install numpy and pandas Windows
installer for python 3. But while running even a small program it shows error
message. i am a beginner in python. So anyone have any idea about how to
install and test pandas in Windows 7 by using eclipse, just pass it to me.
The error message is like this:
Traceback (most recent call last):
import numpy
File "C:\Python32\lib\site-packages\numpy\__init__.py", line 137, in <module>
from . import add_newdocs
File "C:\Python32\lib\site-packages\numpy\add_newdocs.py", line 9, in <module>
from numpy.lib import add_newdoc
File "C:\Python32\lib\site-packages\numpy\lib\__init__.py", line 4, in <module>
from .type_check import *
File "C:\Python32\lib\site-packages\numpy\lib\type_check.py", line 8, in <module>
import numpy.core.numeric as _nx
File "C:\Python32\lib\site-packages\numpy\core\__init__.py", line 40, in <module>
from numpy.testing import Tester
File "C:\Python32\lib\site-packages\numpy\testing\__init__.py", line 8, in <module>
from unittest import TestCase
File "C:\Python32\lib\unittest\__init__.py", line 59, in <module>
from .case import (TestCase, FunctionTestCase, SkipTest, skip, skipIf,
File "C:\Python32\lib\unittest\case.py", line 6, in <module>
import pprint
EOFError: EOF read where not expected
Thanks in advance for your time
Answer: I think you have Install panda: here you can find panda package for windows
here <https://pypi.python.org/pypi/pandas#downloads>
|
Check if a directory exists in a zip file with Python
Question: Initially I was thinking of using `os.path.isdir` but I don't think this works
for zip files. Is there a way to peek into the zip file and verify that this
directory exists? I would like to prevent using `unzip -l "$@"` as much as
possible, but if that's the only solution then I guess I have no choice.
Answer: You can check for the directories with
[ZipFile.namelist()](http://docs.python.org/library/zipfile.html#zipfile.ZipFile.namelist).
import os, zipfile
dir = "some/directory/"
z = zipfile.ZipFile("myfile.zip")
if dir in z.namelist():
print "Found %s!" % dir
|
Python SciPy FFT function - Input?
Question: I am currently writing some code which is supposed to perform FFT on a set of
data. I have a python list of points and I can easily create a time list. When
I run fft(datalist), I get the 'TypeError: 'numpy.ndarray' object is not
callable' error. I think (but please correct me) the issue is that the list is
one dimension and they have no attachment to time at all by using that one
line of code above. My question is, do I have to input a two dimensional array
with time and data points? or am I completely wrong and have to rethink?
Thanks, Mike Edit - forgot to add some code. The t=time. Could it be because
the number of entries in the array isnt equal to 2^n where N is an integer?
sample_rate=10.00
t=r_[0:191.6:1/sample_rate]
S = fft([mylist])
print S
Answer: The Numpy and SciPy fft functions are looking to have numpy arrays as input,
not native python lists. Also they work just fine with lengths that are not
powers of two. You probably just need to cast your list as an array before
passing it to the fft.
From your example code above try:
from numpy.fftpack import fft
from numpy import array
""" However you generate your list goes here """
S = fft(array([mylist]))
|
How to determine whether a year is a leap year in Python?
Question: I am trying to make a simple calculator to determine whether or not a certain
year is a leap year.
By definition, a leap year is divisible by four, but not by one hundred,
unless it is divisible by four hundred.
Here is my code:
def leapyr(n):
if n%4==0 and n%100!=0:
if n%400==0:
print n, " is a leap year."
elif n%4!=0:
print n, " is not a leap year."
print leapyr(1900)
When I try this inside the Python IDLE, the module returns **None**. I am
pretty sure that I should get **1900 is a leap year**.
Answer:
import calendar
print calendar.isleap(1900)
Python provides this functionality already in the library module 'calendar'.
|
Python:Importing moduel Attribute Error,LPTHW ex47:
Question: I'm doing ex47 from Learn python the hard way[This is the
exercise](http://learnpythonthehardway.org/book/ex47.html) And this is my
code:
from nose.tools import*
from ex47.game import Room
def test_room():
gold = Room("GoldRoom",
"""This room has gold in it you can grab. there's a door to the north.""")
assert_equal(gold.name, "GoldRoom")
assert_equal(gold.paths, {})
def test_room_paths():
center = Room("Center", "Test room in the center.")
north = Room("North", "test room in the north.")
south = Room("south", "test room in the south.")
center.add_paths({'north': north, 'south': south})
assert_equal(center.go('north'), north)
assert_equal(center.go('south'), south)
def test_map():
start = Room("Start", "You can go west and down a hole.")
west = Room("Trees", "There are trees here, you can go east.")
down = Room("Dungeon", "It's dark down here, you can go up.")
start.add_paths({'west': west, 'down': down})
west.add_paths({'east': start})
down.add_paths({'up': start})
assert_equal(start.go('west'), west)
asset_equal(start.go('west').go('east'), start)
assert_equal(start.go('down').go('up'), start)
However when test this code using nosetest this is what I get:
Traceback <most recent call last>:
File "c:\Python31\lib\site-packages\nose\case.py", line 197,in runtest
self.test<*self.arg>
File "C:\path\Ex47\skeleton\tests\ex47_tests.py", line 28, in test_map
start.add_paths<{'west': west, 'down':down>}
AttributeError: 'Room' object has no attribute 'add_paths'
* * *
Ran 3 tests in 0.030s
FAILED <errors=2>
But this seems to be ridiculous since add_paths worked fine in
test_room_paths(). This has driven me crazy(google hasn't helped neither
copying the code from the book either).
Please Help!!
I'm using python 3.1, windows 7
Please don't use too much programming Lingo.(I'm very new to programming).
here is the code for game.py just in case you need it.
class Room(object):
def __init__(self, name, description):
self.name = name
self.description = description
self.paths = {}
def go(self, direction):
return self.paths.get(direction, None)
def add_paths(self, paths):
self.paths.update(paths)
Answer: You state, "add_paths worked fine in test_room_paths()", but you are assuming
the tests are run in the order you've written them. They often are run in
alphabetical order, meaning test_room_paths hasn't executed yet.
Your Room code looks incorrect, you have `def add_paths` indented under `def
__init__`, meaning `add_paths` is a function defined locally in `__init__`,
rather than another method in your class. Be sure all the `def` keywords in
your class are lined up.
|
Python MMTK "There is no program associated with ..pdb files, please install a suitable viewer"
Question: I'm new to programming and computer world. I'm trying to study biomolecular
simulations with MMTK.
I run it in Windows 7 and I have already installed this software:
* python-2.5.4
* numpy-1.6.2-win32-superpack-python2.5
* netCDF4-0.8.2.win32-py2.5
* ScientificPython-2.9.0.win32-py2.5
* MMTK-2.6.0.win32-py2.5
* pywin32-217.win32-py2.7
When I run this
[protein.py](http://structure.usc.edu/mmtk/Examples/MolecularDynamics/protein.py)
mmtk sample, all seems to be OK. It show the numbers of 1000 process steps.
But when I run a script with the `view` method, like this:
from MMTK import *
molecule = Molecule('water')
molecule.view()
Then I get this message:
There is no program associated with ..pdb files, please install a suitable viewer
After searching for some answers on the internet I got this information: "A
viewer for PDB files can be defined by the environment variable PDBVIEWER. For
showing a PDB file, MMTK will execute a command consisting of the value of
this variable followed by a space and the name of the PDB file." And my doubt
is: how define a viewer for PDB files by the environment variable PDBVIEWER?
What would be the variable value? This issue of the environment variables
seems to me so simple as the mystery of life's emergence on Mars. I know how
to change it, but I don't know **what** to change or **when** change it.
Reading the Wikipedia articles on the subject didn't help me too much. So what
I'd like to know is: how **exactly** to modify the system variable in **this**
case? I must add a new variable (PDBVIEWER) or just one more path to an
existing variable? What is the value path to PDBVIEWER (should not it be
C:\Windows\System32)?
This is my current variable value:
Variable's name: Path
Variables's value:
C:\Program Files (x86)\PC Connectivity Solution\;C:\Program Files\Common Files\Microsoft Shared\Windows Live;C:\Program Files (x86)\Common Files\Microsoft Shared\Windows Live;%SystemRoot%\system32;%SystemRoot%;%SystemRoot%\System32\Wbem;%SYSTEMROOT%\System32\WindowsPowerShell\v1.0\;C:\Program Files (x86)\Windows Live\Shared;%PYTHON_HOME%;%PYTHON_HOME%\Scripts;C:\Program Files (x86);C:\Python27\; C:\Python27\Scripts;C:\Python25\DLLs
I also have this Python variable: `PYTHON_HOME` with this variable's value:
`C:\Python27` (though I'm using Python25 with MMTK).
This question may seem trivial to an experienced programmer. But the answer to
it can be very useful to others. There is a large number of biologists,
biochemists and pharmacists interested in using computational methods to their
problems. These professionals do not always have a computer scientist in the
vicinity (especially if they are in an underdeveloped country).
Overcoming this initial frustrating phase of bugs and installation problems
can be crucial in the scientific career of many people. And the answer to this
question will help them.
Thanks in advance.
If this forum is not appropriate for questions of this level, please give me a
feedback.
Answer: Google says <http://spdbv.vital-it.ch/> is a PDB viewer.
You need to install that or something else you find that can view PDB files.
Assuming the installer for that doesn't just go set that environment variable
for you (which it may), you'd then need to set the variable PDBVIEWER to be
the path to an executable that can view PDBs presumably. So, say,
C:\SwissPDBViewer\view.exe hypothetically speaking.
|
Use entire scope as input in plugin in Sublime Text 2
Question: One of the nice things about Textmate was the ability to pipe the contents of
an entire scope into a command, like so:
You could then specify the scope to be used, such as `meta.class.python` or
whatever.
I'm trying to write a small plugin that will pipe the entire current scope in
as the input for the plugin (for example (not exactly what I'm trying to do,
but close), a function that lets you comment out an entire Python class
without selecting it all)
Using the current selection(s) as input is quite easy:
import sublime, sublime_plugin
import re
class DoStuffWithSelection(sublime_plugin.TextCommand):
def run(self, edit):
for region in self.view.sel():
if not region.empty():
changed = region # Do something to the selection
self.view.replace(edit, region, changed) # Replace the selection
I've scoured the Sublime Text plugin API for some way to do something like
`for region in self.view.scope()`, but without success.
Is there a way, then, to use the contents of the current scope under the
cursor as input for a plugin function? Or, even better, a way to use the
entire scope if there isn't a selection, but use the selection if there is
one.
Thanks!
Answer: If you want to get text that you select, the following code snippet is an
example.
if not region.empty():
selectText = self.view.substr(region)
...
If you want to get text where the cursor is located, the following code
snippet is an example.
if region.empty():
lineRegion = self.view.line(region)
lineText = self.view.substr(lineRegion)
...
To get more information, see <http://net.tutsplus.com/tutorials/python-
tutorials/how-to-create-a-sublime-text-2-plugin/> and
<http://www.sublimetext.com/docs/api-reference>.
|
Using Flask, trying to get AJAX to update a span after updating mongo record, but it's opening a new page
Question: Feel like I am stumbling over something fairly simple here.
I am not understanding something about AJAX and Flask.
I have a project wherein I display mongodb records in the browser, which has
been working fine.
I added functionality for users to increment votes on a record; to Vote it up
if they like it. But originally I was then refreshing the entire page with the
new vote, using a redirect, which is clumsy. So I am trying to get AJAX to
send the data over to the mongodb record and then update the span where I want
the votes to appear without having to reload the entire page.
Problem is, the setup I have going, while still updating the record, is now
loading a new page with the HTML i want returned only to the span where the
vote tally should be (that is, it's loading a new page with only the word
"test" in it (the test value I am currently returning)).
The jQuery (the library I am using) is loading fine and there are no other
problems (as far as I can tell).
I have the relevant HTML and JS here:
<!-- All Standard HTML up here, removed for simplicity -->
<script>
$('#vote_link').bind('click', function(e){
e.preventDefault();
var url = $(this).attr('href');
$('#vote_tally').load(url);
});
</script>
<a href='/vote_up/{{ item._id }}' id='vote_link'>Vote for Me!</a><br>
Likes: <span id='vote_tally'>{{ item.votes }}</span>
<!-- All Standard HTML down here, removed for simplicity -->
and the python is here:
from flask import Flask, render_template, request, redirect, flash, jsonify
#from mongokit import Connection, Document
#from flask.ext.pymongo import PyMongo
from pymongo import Connection#, json_util
#from pymongo.objectid import ObjectId #this is deprecated
import bson.objectid
'''my pymongo connection - removed for simplicity'''
'''bunch of other routes - also removed for same reason'''
#increment a vote
@app.route('/vote_up/<this_record>')
def vote_up(this_record):
vandalisms.update({'_id':bson.objectid.ObjectId(this_record)},
{"$inc" : { "votes": 1 }}, upsert=True)
'''
also trying to return value for votes field from mongo record, but one step at a
time here
'''
#result = vandalisms.find({'_id':bson.objectid.ObjectId(this_record)}, {'votes':1})
result = 'test'
return result
I am also having trouble figuring out how to return the individual vote value
for the specified mongodb record back to the browser, even with jsonify (which
returns {"votes":'_id'}, but that's another issue. Hopefully someone can help
me understand how to make AJAX work for me with Flask in this regard.
Thanks in advance,
**Edit-24Jul2012-2:27PM CST:**
I suspect that the jQuery isn't even activating. It seems to be loading the
new page based on the link's href attribute, hence it's no use to have
`e.prevenDefault();` when that's not being run. Furthermore, an `alert('I have
been clicked');` never runs when the click event takes place. Again, the
jQuery is loaded, but the click event is not activating the jQuery, and I
don't know why not.
Answer: My guess (based on your edit) is that you have more than one element on the
page with the ID of `vote_link` \- this is not allowed in HTML (the ID
property must be unique across the document). If you want to have multiple
links sharing the same behavior use a class instead (`$(".vote_link")` for
example).
|
Python: convert string to byte array
Question: Say that I have a 4 character string, and I want to convert this string into a
byte array where each character in the string is translated into its hex
equivalent. e.g.
str = "ABCD"
I'm trying to get my output to be
array('B', [41, 42, 43, 44])
Is there a straightforward way to accomplish this?
Answer: encode function can help you here, encode returns an encoded version of the
string
In [44]: str = "ABCD"
In [45]: [elem.encode("hex") for elem in str]
Out[45]: ['41', '42', '43', '44']
or you can use array module
In [49]: import array
In [50]: print array.array('B', "ABCD")
array('B', [65, 66, 67, 68])
|
Problems using etree in Python scraper
Question: I'm a newbie in Python looking to build a screen scraper in Scraperwiki but
I'm struggling with an error I can't work out how to fix. Essentially, I want
to parse an xml file but can't work out how to have my gp_indicators_scrape
function access the getroot() method.
Can anyone fix it, and more importantly, point me towards an explanation so I
can avoid the problem in future?
Here's the scraper: <https://scraperwiki.com/scrapers/choiceshu1>
The key bits of code:
import lxml.html
import urlparse
from urlparse import urlparse
from lxml.etree import etree
def gp_indicators_scrape(org_URL):
indicator_xml = etree.parse(org_URL)
root = lxml.etree.getroot(indicator_XML)
print root
html = scraperwiki.scrape(combined_URL_for_first_scrape)
print html
root = lxml.html.fromstring(html)
links = root.cssselect("dd a")
And here's the error when it runs
Line 5 - from lxml.etree import etree
ImportError: cannot import name etree
Answer: `from lxml.etree import etree` should be `from lxml import etree`
Also, just noticed - `lxml.etree.getroot(...)` \- you can drop the `lxml.` if
you use the import above, and normally you call `getroot()` on the object
returned via `etree.parse` (or similar).
NB: I haven't looked at code in the provided link...
|
Python Running an Excel Macro
Question: I am trying to use python to run an excel macro and then close excel. I have
the following:
import win32com.client
import os
xl = win32com.client.DispatchEx("Excel.Application")
wb = xl.workbooks.open("X:\Location\Location2\File1.xlsm")
xl.run("File1.xlsm!WorkingFull")
xl.Visible = True
wb.Close(SaveChanges=1)
xl.Quit
My script will Open and close fine if I take out the
xl.run("File1.xlsm!WorkingFull") When I run this I get the following error:
Traceback (most recent call last): File "C:\Python27\File1.py", line 6, in
xl.run("File1.xlsm!WorkingFull") File "", line 2, in run com_error:
(-2147352567, 'Exception occurred.', (0, u'Microsoft Excel', u"Cannot run the
macro 'File1.xlsm!WorkingFull'. The macro may not be available in this
workbook or all macros may be disabled.", u'xlmain11.chm', 0, -2146827284),
None)
I have macros enabled and I know its in the workbook, what is the problem?
Answer: please see below the code for running an Excel macro using python. You can
find this code in this [Site -
Link](https://sites.google.com/site/exceldriven/selenium-webdriver/python-
scripts/run-an-excel-macro-using-python). Use this site for other references
for excel, vba and python scripts which might be helpful in the future.
from __future__ import print_function
import unittest
import os.path
import win32com.client
class ExcelMacro(unittest.TestCase):
def test_excel_macro(self):
try:
xlApp = win32com.client.DispatchEx('Excel.Application')
xlsPath = os.path.expanduser('C:\test1\test2\test3\test4\MacroFile.xlsm')
wb = xlApp.Workbooks.Open(Filename=xlsPath)
xlApp.Run('macroName')
wb.Save()
xlApp.Quit()
print("Macro ran successfully!")
except:
print("Error found while running the excel macro!")
xlApp.Quit()
if __name__ == "__main__":
unittest.main()
|
List integration as argument (beginner)
Question: I am writing a script in python, but I am a beginner (started yesterday).
Basically, I just create chunks that I fill with ~10 pictures, align them,
build the model, and build the texture. Now I have my chunks and I want to
align them...
From the [manual](http://downloads.agisoft.ru/pdf/photoscan_python_api.pdf):
> `PhotoScan.alignChunks(chunks, reference, method=’points’, accuracy=’high’,
> preselection=False)`
>
> Aligns specified set of chunks.
>
> **Parameters**
>
> * chunks (list) – List of chunks to be aligned.
> * reference (Chunk) – Chunk to be used as a reference.
> * method (string) – Alignment method in [’points’, ‘markers’].
> * accuracy (string) – Alignment accuracy in [’high’, ‘medium’, ‘low’].
> * preselection (boolean) – Enables image pair preselection.
>
>
> Returns Success of operation.
>
> Return type `boolean`
I tried to align the chunks, but the script throws an error at line 26:
> TypeError: expected a list of chunks as an argument
Do you have any idea how I can make it work?
This is my current code:
import PhotoScan
doc = PhotoScan.app.document
main_doc = PhotoScan.app.document
chunk = PhotoScan.Chunk()
proj = PhotoScan.GeoProjection()
proj.init("EPSG::32641")
gc = chunk.ground_control
gc.projection = proj
working_path = "x:\\New_agisoft\\ok\\Optical\\"
for i in range (1,3):
new_chunk = PhotoScan.Chunk()
new_chunk.label = str(i)
loop = i*10
loo = (i-1)*10
doc.chunks.add(new_chunk)
for j in range (loo,loop):
file_path = working_path + str(j) + ".jpg"
new_chunk.photos.add(file_path)
gc = new_chunk.ground_control
gc.loadExif()
gc.apply()
main_doc.active = len(main_doc.chunks) - 1
doc.activeChunk.alignPhotos(accuracy="low", preselection="ground control")
doc.activeChunk.buildModel(quality="lowest", object="height field", geometry="smooth", faces=50000)
doc.activeChunk.buildTexture(mapping="generic", blending="average", width=2048, height=2048)
PhotoScan.alignChunks(,1,method="points",accuracy='low', preselection=True)
Answer:
PhotoScan.alignChunks(,1,method="points",accuracy='low', preselection=True)
^
Before the ',' you need the chunks!
|
Is it possible to draw graphs on a given image using NetworkX?
Question: Is it possible to draw graphs on a given image (instead of on an empty figure)
by using the python package NetworkX?
Answer: Perhaps you can try this but it requires matplotlib:
import matplotlib.pyplot as plt
import matplotlib.image as mpimg
import networkx as nx
G = nx.cycle_graph(2)
pos = {0:[0,0], 1:[ 300, 300]}
plt.figure(1)
img=mpimg.imread('/home/stinkbug.png')
plt.imshow(img)
nx.draw(G,pos)
plt.savefig('/home/test.png')
I used the stink bug on this
[page](http://matplotlib.sourceforge.net/users/image_tutorial.html).
Using networkx by itself might be a little tricky. Perhaps you could set the
image you want as a node (say node 0) and then position the node at origin
(0,0). Finally, orient the other nodes from your graph on top of them. I
haven't tried it myself but its an idea that popped into my head.
|
Python wrapper script to let a program be executed remotely with no blocking
Question: I am looking for a wrapper script to run a program which is called remotely by
a SSH command which terminates without waiting for the result of the program.
Here is my code:
#!/usr/bin/python
import sys
import os, subprocess
def main():
print "PID_last_child", os.getpid()
argpass = ['main_p.py']
for a in sys.argv:
if a.find("wrapper.py") == -1:
argpass.append(a)
pid = subprocess.Popen(argpass).pid
print "PID for the actual process: ", pid
if __name__ == "__main__":
print "PID_MAIN:", os.getpid()
try:
pid = os.fork()
print "FORK1: ", pid
if pid > 0:
sys.exit(0)
except OSError, e:
print >>sys.stderr, "fork failed: %d (%s)" % (e.errno, e.strerror)
sys.exit(1)
os.chdir('/')
os.setsid()
os.umask(0)
try:
pid = os.fork()
print "FORK2: ", pid
if pid > 0:
sys.exit(0)
except OSError, e:
print >>sys.stderr, "fork failed: %d (%s)" % (e.errno, e.strerror)
sys.exit(1)
main()
I suppose using double forking, i should be able to do that... but no luck so
far.
Any thoughts on this is greatly appreciated.
Answer: I fully credit this link for the answer in bash syntax: [How to starting
process as daemon using ssh command?](http://www.unix.com/shell-programming-
scripting/70523-how-starting-process-daemon-using-ssh-command.html)
You don't even need to double-fork. The issue is that the stdout is still
connected. Here is the python approach:
**wrapper.py**
import subprocess
import os
def main():
pid = subprocess.Popen(['nohup', '/path/to/main_p.py'],
stdout = open(os.devnull, 'w+', 0),
stderr = subprocess.STDOUT
).pid
print pid
if __name__ == "__main__":
main()
And then the ssh command would call this wrapper:
ssh server /path/to/wrapper.py
You just need to redirect stdout -> devull, and the process will return right
away.
|
Python: change CWD of script bundled with py2app
Question: My script works fine when ran with `python`, but after I build it with
`py2app`, files and folders are created in `.app/Contents/Resources`. I use
`os.getcwd()` to find out where the script is located.
How can I fix this and make sure my files are created in the app containing
directory?
**Hacky fix**
Here's a hack that works:
if re.search('([^/]+$)', cwd).group(0) == "Resources":
mkFldr(cwd[0:-27] + fldr) #this is a try except function
sanExt(extPath, str(cwd[0:-27] + fldr + "/" + extName + "_san.csv"))
else:
mkfldr(fldr)
sanExt(extPath, str(cwd + "/" + fldr + "/" + extName + "_san.csv"))
Answer: If I understand what you're asking correctly I use something similar to the
following to handle this. The 'frozen' part changes the behaviour depending on
whether you're running the script or a py2exe/py2app executable.
import sys
import os.path
frozen = getattr(sys, 'frozen', '')
if frozen:
MyFolder = os.path.dirname(sys.executable)
else:
Myfolder = os.getcwd()
|
__init__() takes at least 2 arguments (1 given) When Migrating using South with Custom Fields
Question: **i am new to south and i followed their documentation and after initializing
south migrations, after running**
manage.py migrate appname
**for the following custom models Models i added introspection rules as
follows**
Models:
class DependentIntegerField(models.IntegerField):
def __init__(self, default_callable, *args, **kwargs):
self.default_callable = default_callable
super(DependentIntegerField, self).__init__(*args, **kwargs)
def pre_save(self, model_instance, add):
if not add:
return super(DependentIntegerField, self).pre_save(model_instance, add)
return self.default_callable(model_instance)
class Level(models.Model):
group = models.ForeignKey(Level_Group)
number = models.IntegerField(unique=True)#null=True, blank=True
threshold = DependentIntegerField(lambda mi:mi.number*50,null=False,blank=True)
def __str__(self):
return '%s' %(self.number)
def get_fib(self):
return fib(self.number+3)
class Gallery (models.Model):
contractor = models.ForeignKey(Contractor)
image = StdImageField(upload_to='GalleryDB', size=(640, 480,True))
Title = models.CharField(max_length=250,null=True,blank = True)
Caption = models.CharField(max_length=1000,null=True,blank=True)
Introspection Rules :
add_introspection_rules([
(
[Level], # Class(es) these apply to
[], # Positional arguments (not used)
{ # Keyword argument
"threshold": ["threshold", {}],
},
),
], ["^shoghlanah\.models\.DependentIntegerField"])
add_introspection_rules([
(
[Gallery], # Class(es) these apply to
[], # Positional arguments (not used)
{ # Keyword argument
"image": ["image"], "upload_to": ["GalleryDB"]
},
),
], ["^stdimage\.fields\.StdImageField"])
Traceback
Traceback (most recent call last):
File "manage.py", line 10, in <module>
execute_from_command_line(sys.argv)
File "/Library/Python/2.7/site-packages/django/core/management/__init__.py", line 443, in execute_from_command_line
utility.execute()
File "/Library/Python/2.7/site-packages/django/core/management/__init__.py", line 382, in execute
self.fetch_command(subcommand).run_from_argv(self.argv)
File "/Library/Python/2.7/site-packages/django/core/management/base.py", line 196, in run_from_argv
self.execute(*args, **options.__dict__)
File "/Library/Python/2.7/site-packages/django/core/management/base.py", line 232, in execute
output = self.handle(*args, **options)
File "/Library/Python/2.7/site-packages/South-0.7.5-py2.7.egg/south/management/commands/migrate.py", line 107, in handle
ignore_ghosts = ignore_ghosts,
File "/Library/Python/2.7/site-packages/South-0.7.5-py2.7.egg/south/migration/__init__.py", line 219, in migrate_app
success = migrator.migrate_many(target, workplan, database)
File "/Library/Python/2.7/site-packages/South-0.7.5-py2.7.egg/south/migration/migrators.py", line 235, in migrate_many
result = migrator.__class__.migrate_many(migrator, target, migrations, database)
File "/Library/Python/2.7/site-packages/South-0.7.5-py2.7.egg/south/migration/migrators.py", line 310, in migrate_many
result = self.migrate(migration, database)
File "/Library/Python/2.7/site-packages/South-0.7.5-py2.7.egg/south/migration/migrators.py", line 133, in migrate
result = self.run(migration)
File "/Library/Python/2.7/site-packages/South-0.7.5-py2.7.egg/south/migration/migrators.py", line 99, in run
south.db.db.current_orm = self.orm(migration)
File "/Library/Python/2.7/site-packages/South-0.7.5-py2.7.egg/south/migration/migrators.py", line 260, in orm
return migration.orm()
File "/Library/Python/2.7/site-packages/South-0.7.5-py2.7.egg/south/utils/__init__.py", line 62, in method
value = function(self)
File "/Library/Python/2.7/site-packages/South-0.7.5-py2.7.egg/south/migration/base.py", line 427, in orm
return FakeORM(self.migration_class(), self.app_label())
File "/Library/Python/2.7/site-packages/South-0.7.5-py2.7.egg/south/orm.py", line 45, in FakeORM
_orm_cache[args] = _FakeORM(*args)
File "/Library/Python/2.7/site-packages/South-0.7.5-py2.7.egg/south/orm.py", line 124, in __init__
self.models[name] = self.make_model(app_label, model_name, data)
File "/Library/Python/2.7/site-packages/South-0.7.5-py2.7.egg/south/orm.py", line 317, in make_model
field = self.eval_in_context(code, app, extra_imports)
File "/Library/Python/2.7/site-packages/South-0.7.5-py2.7.egg/south/orm.py", line 235, in eval_in_context
return eval(code, globals(), fake_locals)
File "<string>", line 1, in <module>
TypeError: __init__() takes at least 2 arguments (1 given)
i am little sure it's from the field `DependentIntegerField` but i don't know
which `__init__` is it trying to call and i tried
"threshold": ["threshold", {"ldefault_callable":default_callable}],
but i get
NameError: name 'default_callable' is not defined
and i have no clues how to fix this, any help is appreciated.
Answer: # How to pass callable argument to field used in south
You have such field class and you want to make it work with south --- problem
is with default_callable argument that is a callable and cannot be frozen.
class DependentIntegerField(models.IntegerField):
def __init__(self, default_callable, *args, **kwargs):
self.default_callable = default_callable
super(DependentIntegerField, self).__init__(*args, **kwargs)
## Ignore this argument
What about leaving this argument altogether --- make it optional on the field
and remove this argument from intrspection rules (so south with ignore it's
existence) --- I gather that callable argument won't change database behaviour
of field --- and that is the only thing south is concerned with. Either allow
nulls in this argument (and make the field fail when performing database
operations --- like saving model instance --- with null `default_callable`.
It will be OK during south run because south doesn't save any models --- it
just creates database tables, and during normal operations model definitions
will be taken from `models.py` file that will have `default_callable` set.
# Pass information about what function to call
In some module create a dictionary od `default_callable` functions that are
accessible by string keys.
Change your field so:
class DependentIntegerField(models.IntegerField):
def __init__(self, default_callable="foo.bar", *args, **kwargs):
self.default_callable = default_callable #it it string now!
super(DependentIntegerField, self).__init__(*args, **kwargs)
@property
def default_fun(self):
return registry[self.default_callable]
Where registry is this dictionary of all default functions.
|
Python does not detect .pyc files
Question: I am using Python 3.2 (both for building and executing), and here is my
question.
I intend to ship my python application with the following setup:
There is a main script (say, `Main.py`), that is using a compiled module, say
`Module1.pyc`). To be precise, the directory structure is:
.\Main.py
.\__pycache__\Module1.cpython-32.pyc
When I use the python interpreter to run the main script, it fails to find the
module with the following error:
Traceback (most recent call last):
File "Main.py", line 10, in <module>
import Module1
ImportError: No module named Module1
* * *
Note that I have added the current directory to `PYTHONPATH` environment
variable, and is part of `sys.path`. Also, the inner `__pycache__` directory
is also added, and is visible in `sys.path`.
Not sure why Module1 is not found. Am guessing, it could be because of the
different file name - Module1.cpython-32.pyc? But, then that is how the Python
3.2 interpreter generates it.
Answer: Have a look at [PEP-3147](http://www.python.org/dev/peps/pep-3147/). They
describe how the python-lookup mechanism works.
So in your concrete case: Put the file Module1.pyc directly in the root
folder.
|
Best lightweight, responsive GUI framework Linux
Question: I've bought a Raspberry Pi, featuring a 300 Mhz CPU, but it does has a pretty
good GPU. It can even run XBMC. I want to program a GUI for it, which needs to
be responsive and good-looking, while taking optimal use of the hardware
available (which isn't too good, unfortunately..). The Raspberry Pi runs
Debian minimal, and I've put the X Windowing System on it, the rest is up to
me to code.
What is the best way to dive into this? I've already looked into HTML5 and
jQuery (via Python and PyWebkit), but they seem to be too CPU-intensive
(unless someone knows how to get (Py)WebKit use the GPU, instead of the CPU).
To avoid confusion, this system will be hooked up to televisions and the like,
and will be primarily pointed on home entertainment. I don't want this to be a
desktop or desktop-like system, I'd just like to know what you guys think
would work smooth on the Raspberry Pi box, so that I can program my UI upon
that framework.
Answer: Having done a custom non-desktop UI on underpowered hardware (litl.com) and
having hacked on both GTK and Clutter a fair bit, I'd reframe the question
slightly.
The main issue is you MUST use the GPU rather than be "lightweight" - usually
when something says it's lightweight that just means it doesn't have many
features or something. Too vague a word. The key is GPU.
The hard part about using the GPU is a working driver. I don't know what the
raspberry pi people have focused on here. For ARM in general the most reliable
way to get a working driver might be to use Android; maybe not the stock
Android UI but their drivers and basic framework, then replace the UI.
X11 drivers, if they exist are often broken on ARM. This is the real problem
with X, rather than lightweight vs heavyweight. By broken, I mean maybe the
driver kinda boots and runs a desktop, but it's slow in important cases or
missing things like hardware video decoding.
Short answer: use the framework (and window system) with the best 3D driver
that supports your features you need, like video decode. Again, I haven't
looked at raspberry pi but I bet there are only one or two choices that meet
this criterion.
|
Getting docstrings from Python package __init__ - based imports
Question: I have several modules that are within a Python package:
# my_package contents
__init__.py
module1.py
module2.py
Within my `__init__.py`, I'm importing these modules so that they will be
accessible once the package is imported by my users.
# __init__.py
import module1
import module2
My question is: how do I programatically access the docstrings for each of my
defined functions within each of these modules? I've seen
[others](http://stackoverflow.com/a/1270639/655787) use a form of this:
getattr(module, key). __doc__
but I can't get it to work for me. Any ideas?
EDIT: A little more background... we're trying to extract content (one of the
important things is the docstrings) from our python packages with the intent
of using that as content for documentation. My boss has something already set
up that we're trying to feed into.
Ideally, I'd like to have a `package.module.function docstring` result
EDIT2: Here's what is currently **not** working:
#my package is named 'tpp'
import tpp
for script in dir(tpp):
if not "__" in script: #not a builtin...
docstrings1 = getattr( tpp, script).__doc__
docstrings2 = " ".join(docstrings1.split())#clean out any newline chars
print script, docstrings
EDIT3: To get a picture of where the docstrings are and how we've organized
things:
import inspect
import tpp
inspect.getdoc(tpp)
#returns None
inspect.getdoc(tpp.module1)
#returns None
inspect.getdoc(tpp.module1.function1)
#'DOCSTRING TEXT FOUND!'
**Ultimately, I'd like to get a list like ['module1', 'function1', 'DOCSTRING
TEXT FOUND!']
Answer: Use
[inspect.getdoc(object)](http://docs.python.org/library/inspect.html#inspect.getdoc)
to get the docstring of an object. Use
[inspect.isfunction](http://docs.python.org/library/inspect.html#inspect.isfunction)
to check if an object is a function.
import inspect
for variable in vars(module).values():
if inspect.isfunction(variable):
print(inspect.getdoc(variable))
Note that inspect.getdoc returns None when there is no docstring for the
object and so the code will print None if there is no docstring for the
function.
|
Running wexpect on windows
Question: I have installed wexpect on windows7, now when i am trying to run any command,
i am getting below error. I am using MKS toolkit, so ls is a valid command.
>>> import pexpect
>>> pexpect.run('ls ')
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
File "C:\Python27\lib\site-packages\winpexpect-1.5-py2.7.egg\pexpect.py", line
219, in run
child = spawn(command, maxread=2000, logfile=logfile, cwd=cwd, env=env)
File "C:\Python27\lib\site-packages\winpexpect-1.5-py2.7.egg\pexpect.py", line
429, in __init__
self._spawn (command, args)
File "C:\Python27\lib\site-packages\winpexpect-1.5-py2.7.egg\pexpect.py", line
516, in _spawn
raise ExceptionPexpect ('The command was not found or was not executable: %s
.' % self.command)
pexpect.ExceptionPexpect: The command was not found or was not executable: ls.
Can some one please help
Answer: Very late reply, but I also faced this problem recently.
Many reasons for failure or probably, wexpect.py needs modification (at least
for my case)
Pl check pexpect_error.txt file generated in the same directory of wexpect.py
file.
It forks 'python.exe' hence 'python.exe' must be in path (no other name of exe
is permitted).
You must be in the same directory of wexpect.py (lib file name must be
wexpect.py not pexpect.py) when you are executing your py script.
The cmd (with extension .exe/.com/.bat), must be working at your windows/shell
command prompt . Check that (eg actually in Windows when we run 'ls', it is
actually running ls.exe/com, in py script, mention as 'ls.exe')
Last but not least: In my case, console window for Window OS creation was
failing (found from pexpect_error.txt), hence I changed below
line 2397, make Y coordinate of rect small instead of 70 eg 24 worked for me
|
Issue building cx_Oracle - libclntsh.so.11.1 => not found
Question: I'm trying to build cx_Oracle for a Python 2.7.2 and Oracle 11g installation
but the built cx_Oracle.so cannot find libclntsh.so.11.1 so importing
cx_Oracle in Python fails.
/mypath/cx_Oracle-5.1.1/build/lib.linux-x86_64-2.7-11g]$ ldd cx_Oracle.so
libclntsh.so.11.1 => not found
libpthread.so.0 => /lib64/libpthread.so.0 (0x00002ae9be290000)
libc.so.6 => /lib64/libc.so.6 (0x00002ae9be4ab000)
/lib64/ld-linux-x86-64.so.2 (0x000000389b600000)
I have **libclntsh.so.11.1** in my Oracle client installation directory:
/apps/oracle/client/11.2.0.1/home1/lib]$ ls -l libclntsh.so*
libclntsh.so -> /apps/oracle/client/11.2.0.1/home1/lib/libclntsh.so.11.1
libclntsh.so.11.1
And the cx_Oracle setup.py is picking this lib dir up:
/mypath/cx_Oracle-5.1.1]$ python2.7 setup.py build
/apps/oracle/client/11.2.0.1/home1/
running build
running build_ext
building 'cx_Oracle' extension
gcc -pthread -fno-strict-aliasing -g -O2 -DNDEBUG -g -fwrapv -O3 -Wall -Wstrict-prototypes -fPIC -I/apps/oracle/client/11.2.0.1/home1/rdbms/demo -I/apps/oracle/client/11.2.0.1/home1/rdbms/public -I/apps/bweb/python-2.7.2/include/python2.7 -c cx_Oracle.c -o build/temp.linux-x86_64-2.7-11g/cx_Oracle.o -DBUILD_VERSION=5.1.1
In file included from /apps/oracle/client/11.2.0.1/home1/rdbms/public/oci.h:3024,
from cx_Oracle.c:10:
/apps/oracle/client/11.2.0.1/home1/rdbms/public/ociap.h:10788: warning: function declaration isn't a prototype
/apps/oracle/client/11.2.0.1/home1/rdbms/public/ociap.h:10794: warning: function declaration isn't a prototype
gcc -pthread -shared build/temp.linux-x86_64-2.7-11g/cx_Oracle.o -L/apps/oracle/client/11.2.0.1/home1/lib -lclntsh -o build/lib.linux-x86_64-2.7-11g/cx_Oracle.so
Is something obviously wrong with this setup?
Thanks
**UPDATE**
My **LD_LIBRARY_PATH** contains the lib directory above with
**libclntsh.so.11.1**
$ echo $LD_LIBRARY_PATH
/apps/oracle/client/11.2.0.1/lib
This doesn't seem to make any difference. I rebuild the cx_Oracle.so file and
it still shows `libclntsh.so.11.1 => not found` when I run `$ ldd
cx_Oracle.so`.
**Python failing to load the built module:**
Python 2.7.2 (default, Jan 19 2012, 14:38:32)
[GCC 3.4.6 20060404 (Red Hat 3.4.6-11)] on linux2
Type "help", "copyright", "credits" or "license" for more information.
>>> import cx_Oracle
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
ImportError: libclntsh.so.11.1: cannot open shared object file: No such file or directory
**SOLVED**
The issue was related to the **LD_LIBRARY_PATH** environment variable. Due to
restrictions on the setup I'm working with (corp env) I had to build cx_Oracle
as another user (system account). i.e. I was running this:
$ sudo -u username python27 setup.py build
So even though **LD_LIBRARY_PATH** was set correctly for me, my version wasn't
used when command was executed as a different user. I was able to build
successfully by moving the source code to a location where I had permissions
and running the build as my user.
Answer: Add `/apps/oracle/client/11.2.0.1/home1/lib/` to your `LD_LIBRARY_PATH`
environment variable execute the command below in the terminal before running
python or add it into your `.bashrc`
export LD_LIBRARY_PATH=$LD_LIBRARY_PATH:/apps/oracle/client/11.2.0.1/home1/lib/
|
python module resides in a repository whose name contains dash characters
Question: I know name of the module should not have a dash.
Here is my repository structure
my-repo-name/
src/
tests/
__init__.py
tests.py
fab/
__init__.py
fabfile.py
README.rst
__init__.py
In my tests, I need to import fabfile.py to run a test. But because the name
has a dash, I can't do `from my-module-name.fab.fabfile import X,Y,Z` or
relative import because it's a non-package.
Any recommendation how to do this without hacking with `__import__(...)` or
adding it to the sys path? Should I just add another directory?
Answer: Use [`importlib.import
module`](http://docs.python.org/library/importlib.html#importlib.import_module):
import importlib
fabfile = importlib.import_module('my-repo-name.fab.fabfile', None)
X = fabfile.X
But you should really just change the name of the repository. To transition,
you can create a temporary [symlink](http://en.wikipedia.org/wiki/Symlink)
with
$ mv my-repo-name my_repo_name
$ ln -s my_repo_name my-repo-name
|
How can I step to use the python debugger to break at every function call?
Question: I want to closely monitor the chain of function calls which are called from a
certain function.
import pdb; pdb.set_trace()
res = api.InsertVideoEntry(video_entry, video)
I'm looking for a way to easily see that `api.insertVideoEntry(video_entry,
video)` calls `foo()` which calls `bar()` which calls `baz()`,
Here's a really crude diagram to show what I mean. I don't need it in this
form, but this is the kind kind of information I'm looking for.
api.insertVideoEntry()
foo()
bar()
baz()
baz2()
log()
finish()
Answer: This was an interesting learning experience to write up. Maybe you can use the
code shown here? [This demonstration](http://ideone.com/W3scL) should give you
an idea of the type of output you can expect when using `trace`.
# Functions to trace
# ==================
def baz():
pass
def baz2():
pass
def bar():
baz()
baz2()
def log():
pass
def foo():
bar()
log()
def finish():
pass
def insertVideoEntry():
foo()
finish()
# Names to trace
# ==============
names = list(locals())
# Machinery for tracing
# =====================
import os
import sys
def trace(start, *names):
def tracefunc(frame, event, arg):
if event == 'call':
code = frame.f_code
name = code.co_name
if name in names:
level = -start
while frame:
frame = frame.f_back
level += 1
print('{}{}.{}()'.format(
' ' * level,
os.path.splitext(os.path.basename(code.co_filename))[0],
name))
return tracefunc
sys.settrace(tracefunc)
# Demonstration of tracing
# ========================
trace(2, *names)
insertVideoEntry()
If you are interested in a recursive demo, you might like [this
variation](http://ideone.com/ltcnQ8) with a called arguments readout:
import os
import sys
def main(discs):
a, b, c = list(range(discs, 0, -1)), [], []
line = '-' * len(repr(a))
print(a, b, c, sep='\n')
for source, destination in towers_of_hanoi(discs, a, b, c):
destination.append(source.pop())
print(line, a, b, c, sep='\n')
def towers_of_hanoi(count, source, via, destination):
if count > 0:
count -= 1
yield from towers_of_hanoi(count, source, destination, via)
yield source, destination
yield from towers_of_hanoi(count, via, source, destination)
def trace(start, *names):
def tracefunc(frame, event, arg):
if event == 'call':
code = frame.f_code
name = code.co_name
if name in names:
level = -start
args = ', '.join(repr(frame.f_locals[name]) for name in
code.co_varnames[:code.co_argcount])
while frame:
frame = frame.f_back
level += 1
print('{}{}.{}({})'.format(
' ' * (level * 4),
os.path.splitext(os.path.basename(code.co_filename))[0],
name, args))
return tracefunc
sys.settrace(tracefunc)
if __name__ == '__main__':
trace(3, 'main', 'towers_of_hanoi')
main(3)
|
Python: Read from and write to a CSV file
Question: I am trying to read data from a CSV file (A), extract data, and write that to
a different CSV file (B). In the new file B, I want to have two columns.
Column 1 to list names of column 1 in file A and column 2 to list the count of
column 1 in file A. So for example, if the file A looks like this without ':'
(they are lined up in two columns):
Animal: Gender
Rabbit: Male
Dog: Male
Rabbit: Female
Cat: Male
Cat: Male
Dog: Female
Dog: Male
Turtle: Male
I want the output in file B to look like this (actually in different columns
without ':' again):
Animal: Count
Cat: 2
Dog: 3
Rabbit: 2
Turtle: 1
This is the very first time I am doing anything like this and this is what I
have so far, but I am failing in having the data printed out in file B and
have the "count" done correctly. Could anybody please help me with this?
import csv
ReadData=csv.reader(open('C:\Users\..\FileA.csv','rb'), delimiter=',')
def column(ReadData, i):
return [row[i] for row in ReadData]
for line in ReadData:
WriteData=csv.writer(open('C:\Users\..\FileB.csv','wb'),
delimiter=' ', quotechar=':', quoting=csv.QUOTE_ALL)
print column(ReadData,1)
Thank you for your help in advance!
Answer: To do the counting in Python >=2.7, see [this example for
`collections.Counter`](http://stackoverflow.com/a/3496860/1307866). With a
`collections.defaultdict`, see
[here](http://stackoverflow.com/a/2161791/1307866).
In your call to `csv.writer`, the `quotechar=':'` is probably an error (this
would make `WriteData.writerow(['Hello World', 12345]`) emit ":Hello World:
12345", as if the colon was a quotation mark.
Also note that your function `column(ReadData, i)` consumes `ReadData`;
subsequent calls to ReadData will probably return an empty list (not tested).
This is not a problem for your code (at least not now).
This is a solution without the CSV module (after all, these files do not look
too much like CSV):
import collections
inputfile = file("A")
counts = collections.Counter()
for line in inputfile:
animal = line.split(':')[0]
counts[animal] += 1
for animal, count in counts.iteritems():
print '%s: %s' % (animal, count)
|
Eclipse unresolved external with geopy
Question:
import csv
from geopy import geocoders
import time
g = geocoders.Google()
spamReader = csv.reader(open('locations.csv', 'rb'), delimiter='\t', quotechar='|')
f = open("output.txt",'w')
for row in spamReader:
a = ', '.join(row)
#exactly_one = False
time.sleep(1)
try:
place, (lat, lng) = g.geocode(a)
except (ValueError, geocoders.google.GQueryError, geocoders.google.GeocoderResultError, geocoders.google.GBadKeyError, geocoders.google.GTooManyQueriesError):
#print("Error: geocode failed on input %s with message %s"%(a, error_message)
f.write("exception")
continue
b = str(place) + "," + "[" + str(lat) + "," + str(lng) + "]" + "\n"
print b
f.write(b)
The code I have above works great from the command prompt. I am wondering why
when I try to run the script through Eclipse that I keep getting the
"Unresolved import: geopy". I have tried to add it somehow under
Project->properties->PYTHONPATH but I am having a bear of time finding out how
to get Eclipse to recognize the fact that Geopy is installed to
'C:\Python27\Lib\site-packages\geopy-0.94.2-py2.7.egg'. My version of Eclipse
is Juno running on Windows 7 with the JDK7u4 powering it. What should I do
about this problem?
Answer: It appears that under Project->Properties->PyDev - PYTHONPATH there is an area
with a tab called "External Libraries". There then is a button to add a
zip/jar/egg. The "egg" in question is actually a directory which in my
installation is located under:
C:\Python27\Lib\site-packages\geopy-0.94.2-py2.7.egg
So it is added and then Eclipse Juno will allow for the module to be used in
the code.
|
Is there a way to simulate python random.shuffle of a queue using a pseudorandom sequence or hash function?
Question: I'm building an application based around a task queue: it serves a series of
tasks to multiple, asynchronously connected clients. The twist is that the
**tasks must be served in a random order**.
My problem is that the algorithm I'm using now is computationally expensive,
because it relies on many large queries and transfers from the database. I
have a strong hunch that there's a cheaper way to achieve the same result, but
I can't quite see the solution. Can you think of a clever fix for this
problem?
Here's the (computationally expensive) algorithm I'm using now:
When the client queries for a new task...
1. Query the database for "unfinished" tasks
2. Put all tasks in a list
3. Shuffle the list (using random.shuffle)
4. Flag the first task as "in progress"
5. Send the task parameters to the client for completion
When the client finishes the task...
6a. Record the result and flag the task as "finished."
If the client fails to finish the task by some deadline...
6b. Re-flag the task as "unfinished."
Seems like we could do better by replacing steps 1, 2, and 3, with
pseudorandom sequences or hash functions. But I can't quite figure out the
whole solution. Ideas?
Other considerations:
* In case it's important, I'm using python and mongodb for all of this. (Mongodb doesn't have some clever "use find_one to efficiently return a random matching entry" usage, does it?)
* The term "queue" is a little misleading. All the tasks are stored in subfields of a single collection within the mongodb. The length (total number of tasks) in the collection is known and fixed at the outset.
* If it's necessary, it might be okay to let the same task be assigned multiple times, as long as the occurrence is rare. But instances of this kind would need to be very rare, because completing each task is costly.
* I have identifying information on each client, so we know exactly who originates each task request.
Answer: There _is_ an easy way to get a random document from MongoDB!
See [Random record from
MongoDB](http://stackoverflow.com/questions/2824157/random-record-from-
mongodb)
If you don't want a task to be picked twice, you could mark the task as active
and not select it.
|
Why doesn't PIL load locally while running Google App Engine Python 2.7 Mac OSX?
Question: I am using Google App engine on Mac OSX 10.7.4. When I load PIL from the
commandline, everything works fine. However, when I load it from the GAE local
environment, i.e.:
> import Image
Gives me the error:
> ImportError: No module named Image
This line works fine:
> from google.appengine.api import images
So I don't believe there's a problem with my installation. The app works fine
when I deploy it to GAE. Also, I load the PIL library in app.yaml:
libraries:
- name: webapp2
version: "2.5.1"
- name: lxml
version: latest
- name: PIL
version: latest
- name: numpy
version: latest
I am also using python in /usr/bin/python, 2.7.1. I have PIL installed using:
brew install pip
pip install pil
Answer: You need to use: `from PIL import Image`.
|
Iteration of calendar.month_name can't be parsed by strptime()
Question: Here's something that seems a little silly: `datetime.strptime()` is happy to
accept an iterated list of month names when I just create a list by hand
(`months = ['January','February']`) but not when I iterate over a list of
months created by `calendar.month_name` even though both return `<type 'str'>`
Broken code:
import datetime
import calendar
for month in calendar.month_name:
print datetime.datetime.strptime(month,"%B")
Error: `ValueError: time data '' does not match format '%B'`
Working code:
import datetime
months = ['January','February','March']
for month in months:
print datetime.datetime.strptime(month,"%B")
Result:
1900-01-01 00:00:00
1900-02-01 00:00:00
1900-03-01 00:00:00
What's going on here? Is this a behavior of python's `for` loop I am not
familiar with?
Answer: Try doing `print( list(calendar.month_name) )` and it will become obvious
pretty quickly why this fails ... (mainly because the first element yielded is
an empty string). Note that the reason the first month yielded is an empty
string is because they want `month_names[1]` to correspond to `January` as is
the common convention (see the
[documentation](http://docs.python.org/library/calendar.html?highlight=calendar#calendar.month_name))
You _could_ do something like this:
a = list( calendar.month_names )[1:]
or this also works in Cpython at least (although it isn't clear in the
documentation if it should):
a = calendar.month_names[1:]
|
Subtract values in one list from corresponding values in another list - Python
Question: I have two lists:
A = [2, 4, 6, 8, 10]
B = [1, 3, 5, 7, 9]
How do I subtract each value in one list from the corresponding value in the
other list and create a list such that:
C = [1, 1, 1, 1, 1]
Thanks.
Answer: The easiest way is to use a list comprehension
C = [a - b for a, b in zip(A, B)]
or `map()`:
from operator import sub
C = map(sub, A, B)
|
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.