text
stringlengths 105
4.44k
| label
int64 0
9
| label_text
stringclasses 10
values |
|---|---|---|
The spectral power distribution (SPD) of a source describes how much flux reaches the sensor over a particular wavelength and area. This effectively expresses the per-wavelength contribution to the radiometric quantity being measured. The SPD of a source is commonly shown as an SPD curve. SPD curves provide a visual representation of the color characteristics of a light source, showing the radiant flux emitted by the source at various wavelengths across the visible spectrum It is also a metric by which we can evaluate a light source's ability to render colors, that is, whether a certain color stimulus can be properly rendered under a given illuminant. | 7 | Physical Chemistry |
The primary use of dextromethorphan is as a cough suppressant, for the temporary relief of cough caused by minor throat and bronchial irritation (such as commonly accompanies the flu and common cold), or from inhaled particle irritants, as well as chronic cough at a higher dosage. Dextromethorphan is available alone in the form of cough syrup and pills as well as in combination with other agents. | 4 | Stereochemistry |
The preferred scenario for good tilth is as the result of natural soil-building processes, provided by the activity of plant roots, microorganisms, earthworms and other beneficial organisms. Such stable aggregates break apart during tillage/planting and readily provide good tilth. Soil biota and organic matter work in unison to bind soil aggregates and establish a natural soil stability – a soil carbon sponge. Plant root exudates feed bacteria that emit extracellular polysaccharides (EPS), and feed the growth of fungal hyphae, to form a soil carbon sponge with the dispersed clay particles. These active tilth-forming processes contribute to the formation and stabilization of soil structure. The resulting soil structure reduces tensile strength and soil-bulk density while still forming soil aggregates through their abiotic/biotic binding mechanisms that resist breakdown during water saturation. The fungal hyphae networks can establish a role of enmeshment with EPS and rhizodeposition, thus improving aggregate stability. However, these organic materials are themselves subject to biological degradation, requiring active amendments with organic material, and minimal mechanical tillage. Tilth quality is heavily dependent on these naturally binding processes between biotic microorganisms and abiotic soil particles, as well as the necessary input of organic matter. All constituents in this naturally binding network must be supplied or managed in agriculture to ensure the sustainability of their presence through growing seasons. | 9 | Geochemistry |
Metabolic fluxes are a function of gene expression, translation, post translational protein modifications and protein-metabolite interactions. | 1 | Biochemistry |
In nature, denitrification can take place in both terrestrial and marine ecosystems. Typically, denitrification occurs in anoxic environments, where the concentration of dissolved and freely available oxygen is depleted. In these areas, nitrate (NO) or nitrite () can be used as a substitute terminal electron acceptor instead of oxygen (O), a more energetically favourable electron acceptor. Terminal electron acceptor is a compound that gets reduced in the reaction by receiving electrons. Examples of anoxic environments can include soils, groundwater, wetlands, oil reservoirs, poorly ventilated corners of the ocean and seafloor sediments.
Furthermore, denitrification can occur in oxic environments as well. High activity of denitrifiers can be observed in the intertidal zones, where the tidal cycles cause fluctuations of oxygen concentration in sandy coastal sediments. For example, the bacterial species Paracoccus denitrificans engages in denitrification under both oxic and anoxic conditions simultaneously. Upon oxygen exposure, the bacteria is able to utilize nitrous oxide reductase, an enzyme that catalyzes the last step of denitrification. Aerobic denitrifiers are mainly Gram-negative bacteria in the phylum Proteobacteria. Enzymes NapAB, NirS, NirK and NosZ are located in the periplasm, a wide space bordered by the cytoplasmic and the outer membrane in Gram-negative bacteria.
Denitrification can lead to a condition called isotopic fractionation in the soil environment. The two stable isotopes of nitrogen, N and N are both found in the sediment profiles. The lighter isotope of nitrogen, N, is preferred during denitrification, leaving the heavier nitrogen isotope, N, in the residual matter. This selectivity leads to the enrichment of N in the biomass compared to N. Moreover, the relative abundance of N can be analyzed to distinguish denitrification apart from other processes in nature. | 1 | Biochemistry |
Formylation of octabase prior to cyclization avoids ether cleavage as a side reaction and yields higher than without N-substitution or N-methylation. In this example, the purification was done by formation of a brucine salt.
This process has also been patented by Roche. | 4 | Stereochemistry |
High light increases leaf thickness, either because of an increase in the number of cell layers within the leaf, and/or because of an increase in the cell size within a cell layer. The density of a leaf increases as well, and so does the leaf dry mass per area (LMA). There are also more stomata per mm2. | 5 | Photochemistry |
Full article: Ocean acidification
The pH of the oceans is declining due to uptake of atmospheric CO. The rise in dissolved carbon dioxide reduces the availability of the carbonate ion, reducing CaCO saturation state, thus making it thermodynamically harder to make CaCO shell. Carbonate ions preferentially bind to hydrogen ions to form bicarbonate, thus a reduction in carbonate ion availability increases the amount of unbound hydrogen ions, and decreases the amount of bicarbonate formed (Equations 1–3). pH is a measurement of hydrogen ion concentration, where a low pH means there are more unbound hydrogen ions. pH is therefore an indicator of carbonate speciation (the format of carbon present) in the oceans and can be used to assess how healthy the ocean is.
The list of organisms that may struggle due to ocean acidification include coccolithophores and foraminifera (the base of the marine food chain in many areas), human food sources such as oysters and mussels, and perhaps the most conspicuous, a structure built by organisms – the coral reefs. Most surface water will remain supersaturated with respect to CaCO (both calcite and aragonite) for some time on current emissions trajectories, but the organisms that require carbonate will likely be replaced in many areas. Coral reefs are under pressure from overfishing, nitrate pollution, and warming waters; ocean acidification will add additional stress on these important structures. | 9 | Geochemistry |
One method of measuring FRET efficiency is to measure the variation in acceptor emission intensity. When the donor and acceptor are in proximity (1–10 nm) due to the interaction of the two molecules, the acceptor emission will increase because of the intermolecular FRET from the donor to the acceptor. For monitoring protein conformational changes, the target protein is labeled with a donor and an acceptor at two loci. When a twist or bend of the protein brings the change in the distance or relative orientation of the donor and acceptor, FRET change is observed. If a molecular interaction or a protein conformational change is dependent on ligand binding, this FRET technique is applicable to fluorescent indicators for the ligand detection. | 1 | Biochemistry |
Many liquids are used as solvents, to dissolve other liquids or solids. Solutions are found in a wide variety of applications, including paints, sealants, and adhesives. Naphtha and acetone are used frequently in industry to clean oil, grease, and tar from parts and machinery. Body fluids are water-based solutions.
Surfactants are commonly found in soaps and detergents. Solvents like alcohol are often used as antimicrobials. They are found in cosmetics, inks, and liquid dye lasers. They are used in the food industry, in processes such as the extraction of vegetable oil. | 7 | Physical Chemistry |
The first protein to be classified as a suppressor of cytokine signaling, CIS (cytokine-inducible SH2), was discovered in 1995, when it was found to have a unique ability to regulate cytokine signal transduction. | 1 | Biochemistry |
A relatively recent work (2006) by Fernández and Frenking (2006) summarized the trends in hyperconjugation among various groups of acyclic molecules, using energy decomposition analysis or EDA. Fernández and Frenking define this type of analysis as "...a method that uses only the pi orbitals of the interacting fragments in the geometry of the molecule for estimating pi interactions." For this type of analysis, the formation of bonds between various molecular moieties is a combination of three component terms. ΔE represents what Fernández and Frenking call a molecules “quasiclassical electrostatic attractions.” The second term, ΔE, represents the molecules Pauli repulsion. ΔE, the third term, represents stabilizing interactions between orbitals, and is defined as the sum of ΔE and ΔE. The total energy of interaction, ΔE, is the result of the sum of the 3 terms.
A group whose ΔE values were very thoroughly analyzed were a group of enones that varied in substituent.
Fernández and Frenking reported that the methyl, hydroxyl, and amino substituents resulted in a decrease in ΔE from the parent 2-propenal. Conversely, halide substituents of increasing atomic mass resulted in increasing ΔE. Because both the enone study and Hammett analysis study substituent effects (although in different species), Fernández and Frenking felt that comparing the two to investigate possible trends might yield significant insight into their own results. They observed a linear relationship between the ΔE values for the substituted enones and the corresponding Hammett constants. The slope of the graph was found to be -51.67, with a correlation coefficient of -0.97 and a standard deviation of 0.54. Fernández and Frenking conclude from this data that ..."the electronic effects of the substituents R on pi conjugation in homo- and heteroconjugated systems is similar and thus appears to be rather independent of the nature of the conjugating system.". | 7 | Physical Chemistry |
Since skeletal structures were introduced in the latter half of the 19th century, their appearance has undergone considerable evolution. The graphical conventions in use today date to the 1980s. Thanks to the adoption of the ChemDraw software package as a de facto industry standard (by American Chemical Society, Royal Society of Chemistry, and Gesellschaft Deutscher Chemiker publications, for instance), these conventions have been nearly universal in the chemical literature since the late 1990s. A few minor conventional variations, especially with respect to the use of stereobonds, continue to exist as a result of differing US, UK and European practice, or as a matter of personal preference. As another minor variation between authors, formal charges can be shown with the plus or minus sign in a circle (⊕, ⊖) or without the circle. The set of conventions that are followed by most authors is given below, along with illustrative examples. | 0 | Organic Chemistry |
Antibodies serve various functions in protecting the host against the pathogen. Their soluble forms which carry out these functions are produced by plasma B cells, a type of white blood cell. This production is tightly regulated and requires the activation of B cells by activated T cells (another type of white blood cell), which is a sequential procedure. The major steps involved are:
*Specific or nonspecific recognition of the pathogen (because of its antigens) with its subsequent engulfing by B cells or macrophages. This activates the B cell only partially.
*Antigen processing.
*Antigen presentation.
*Activation of the T helper cells by antigen-presenting cells.
*Co-stimulation of the B cell by activated T cell resulting in its complete activation.
*Proliferation of B cells with resultant production of soluble antibodies. | 1 | Biochemistry |
In June 2023, astronomers detected, for the first time outside the Solar System, methyl cation, CH (and/or carbon cation, C), the known basic ingredients of life, in interstellar space. | 7 | Physical Chemistry |
Lipofuscin quantification is used for age determination in various crustaceans such as lobsters and spiny lobsters. Since these animals lack bony parts, they cannot be aged in the same way as bony fish, in which annual increments in the ear-bones or otoliths are commonly used. Age determination of fish and shellfish is a fundamental step in generating basic biological data such as growth curves, and is needed for many stock assessment methods. Several studies have indicated that quantifying the amount of lipofuscin present in the eye-stalks of various crustaceans can give an index of their age. This method has not yet been widely applied in fisheries management mainly due to problems in relating lipofuscin levels in wild-caught animals with accumulation curves derived from aquarium-reared animals. | 1 | Biochemistry |
In Gram-negative bacteria, e.g. Escherichia coli, PDC consists of a central cubic core made up from 24 molecules of dihydrolipoyl transacetylase (E2).
Up to 16 homodimers of pyruvate dehydrogenase (E1) and 8 homodimers of dihydrolipoyl dehydrogenase (E3) bind to the E2 PSBD around the E2 core.
In Gammaproteobacteria, the specificity of PSBD for binding either E1 or E3 is determined by the oligomeric state of PSBD. In each E2 homotrimer, two of the three PSBDs dimerize. While two E1 homodimers cooperatively bind dimeric PSBD, the remaining, unpaired PSBD specifically interacts with one E3 homodimer. PSBD dimerization thus determines the subunit composition of the pyruvate dehydrogenase complex when fully saturated with the peripheral subunits E1 and E3, which has a stoichiometry of E1:E2:E3 (monomers) = 32:24:16 | 1 | Biochemistry |
In vivo, AGEs form pentosidine through sugar fragmentation. In patients with diabetes mellitus type 2, pentosidine correlates with the presence and severity of diabetic complications. | 1 | Biochemistry |
Evolution in bacteria was previously viewed as a result of mutation or genetic drift. Today, genetic exchange, or gene transfer is viewed as a major driving force in the evolution of prokaryotes. This driving force has been widely studied in organisms like E. coli. Bacteria reproduces asexually, where daughter cells are clones of the parent. This clonal nature leads to random mutations that occur during DNA replication that potentially helps bacteria evolve. It was originally thought that only accumulated mutations helped bacteria evolve. In contrast, bacteria also import genes in a process called homologous recombination, first discovered by the observation of mosaic genes at loci encoding antibiotic resistance. The discovery of homologous recombination has made an impact on the understanding of bacterial evolution. The importance of evolution in bacterial recombination is its adaptivity. For example, bacterial recombination has been shown to promote the transfer of multi drug resistance genes via homologous recombination that goes beyond levels purely obtained by mutation. | 1 | Biochemistry |
Cyclopropyl cyanide, when heated to 660-760K and under pressure of 2-89torr, becomes cis and trans crotonitrile and allyl cyanide molecules, with some presence of methacrylonitrile. This is an isomerization reaction that is homogeneous with rate of first order. The reaction result is due to the biradical mechanism, which involves the formation of carbon radicals as the three carbon ring opens up. The radicals then react to yield carbon=carbon double bonds. | 7 | Physical Chemistry |
Ivan Ivanovich Ostromislensky (, also Iwan Ostromislensky) (9 September 1880 – 16 January 1939) was a Russian organic chemist. He is credited as the pioneer in studying polymerization of synthetic rubber as well as inventor of various industrial technologies for production of synthetic rubber, polymers and pharmaceuticals. | 0 | Organic Chemistry |
Ammonium carbamate solutions are highly corrosive to metallic construction materials – even to resistant forms of stainless steel – especially in the hottest parts of the synthesis plant such as the stripper. Historically corrosion has been minimized (although not eliminated) by continuous injection of a small amount of oxygen (as air) into the plant to establish and maintain a passive oxide layer on exposed stainless steel surfaces. Highly corrosion resistant materials have been introduced to reduce the need for passivation oxygen, such as specialized duplex stainless steels in the 1990s, and zirconium or zirconium-clad titanium tubing in the 2000s. | 7 | Physical Chemistry |
These list include codes that do not qualify for the previous section. The reasons may include the following: source code is not available, FFT acceleration is absent or reduced, the code focuses on specific applications not allowing easy calculation of standard scattering quantities. | 7 | Physical Chemistry |
In female elephants, the two compounds 3-ethyl phenol and 2-ethyl 4,5 dimethylphenol have been detected in urine samples. Temporal glands secretion examination showed the presence of phenol, m-cresol and p-cresol (4-methyl phenol) during musth in male elephants.
p-Cresol and o-cresol are also components of the human sweat. P-cresol is also a major component in pig odor.
4-Ethylphenol, 1,2-dihydroxybenzene, 3-hydroxyacetophenone, 4-methyl-1,2-dihydroxybenzene, 4-methoxyacetophenone, 5-methoxysalicylic acid, salicylaldehyde, and 3-hydroxybenzoic acid are components of castoreum, the exudate from the castor sacs of the mature North American beaver (Castor canadensis) and the European beaver (Castor fiber), used in perfumery. | 0 | Organic Chemistry |
Thienamycin (also known as thienpenem) is one of the most potent naturally produced antibiotics known thus far, discovered in Streptomyces cattleya in 1976. Thienamycin has excellent activity against both Gram-positive and Gram-negative bacteria and is resistant to bacterial β-lactamase enzymes. Thienamycin is a zwitterion at pH 7. | 0 | Organic Chemistry |
An important parameter in wet scrubbing systems is the rate of liquid flow. It is common in wet scrubber terminology to express the liquid flow as a function of the gas flow rate that is being treated. This is commonly called the liquid-to-gas ratio (L/G ratio) and uses the units of gallons per 1,000 actual cubic feet or litres per cubic metre (L/m).
Expressing the amount of liquid used as a ratio enables systems of different sizes to be readily compared.
For particulate removal, the liquid-to-gas ratio is a function of the mechanical design of the system; while for gas absorption this ratio gives an indication of the difficulty of removing a pollutant. Most wet scrubbers used for particulate control operate with liquid-to-gas ratios in the range of 4 to 20 gallons per 1,000 actual cubic foot (0.5 to 3 litres per actual cubic metre).
Depending on scrubber design, a minimum volume of liquid is required to "wet" the scrubber internals and create sufficient collection targets. After a certain optimum point, adding excess liquid to a particulate wet scrubber does not increase efficiency and in fact, could be counter-productive by causing excessive pressure loss. Liquid-to-gas ratios for gas absorption are often higher, in the range of 20 to 40 gallons per 1,000 actual cubic foot (3 to 6 litres per actual cubic metre).
L/G ratio illustrates a number of points about the choice of wet scrubbers used for gas absorption. For example, because flue-gas desulfurization systems must deal with heavy particulate loadings, open, simple designs (such as venturi, spray chamber and moving bed) are used.
Also, the liquid-to-gas ratio for the absorption process is higher than for particle removal and gas velocities are kept low to enhance the absorption process.
Solubility is a very important factor affecting the amount of a pollutant that can be absorbed. Solubility governs the amount of liquid required (liquid-to-gas ratio) and the necessary contact time. More soluble gases require less liquid. Also, more soluble gases will be absorbed faster. | 3 | Analytical Chemistry |
* Bacteroides spp., including B. fragilis
* Enterobacter spp.
* Escherichia coli
* Haemophilus influenzae
* Klebsiella species
* Morganella morganii
* Neisseria gonorrhoeae
* Proteus mirabilis
* Proteus vulgaris
* Providencia rettgeri
* Pseudomonas spp., including P. aeruginosa
* Serratia marcescens | 4 | Stereochemistry |
Components of a typical THz-TDS instrument, as illustrated in the figure, include an infrared laser, optical beamsplitters, beam steering mirrors, delay stages, a terahertz generator, terahertz beam focusing and collimating optics like parabolic mirrors, and detector. | 7 | Physical Chemistry |
The journal is indexed in Index Medicus/PubMed/MEDLINE, Index Veterinarius, CAB Abstracts, Biological Abstracts, BIOSIS Previews, Current Contents/Life Sciences, ProQuest, Science Citation Index, and others. According to the Journal Citation Reports, its 2019 impact factor is 4.060, ranking it 102nd out of 297 journals in the category "Biochemistry & Molecular Biology". | 1 | Biochemistry |
The rare, but naturally occurring amino acid selenocysteine (Sec), can also be found as the nucleophile in some catalytic triads. Selenocysteine is similar to cysteine, but contains a selenium atom instead of a sulfur. An example is in the active site of thioredoxin reductase, which uses the selenium for reduction of disulfide in thioredoxin. | 1 | Biochemistry |
While rich veins of tin are known to exist in Central and South Africa, whether these were exploited during ancient times is still debated . However, the Bantu culture of Zimbabwe are known to have actively mined, smelted and traded tin between the 11th and 15th centuries AD. | 8 | Metallurgy |
The only known place in the universe where the baryon density might possibly be high enough to produce quark matter, and the temperature is low enough for color superconductivity to occur, is the core of a compact star (often called a "neutron star", a term which prejudges the question of its actual makeup). There are many open questions here:
* We do not know the critical density at which there would be a phase transition from nuclear matter to some form of quark matter, so we do not know whether compact stars have quark matter cores or not.
* On the other extreme, it is conceivable that nuclear matter in bulk is actually metastable, and decays into quark matter (the "stable strange matter hypothesis"). In this case, compact stars would consist completely of quark matter all the way to their surface.
* Assuming that compact stars do contain quark matter, we do not know whether that quark matter is in a color superconducting phase or not. At infinite density one expects color superconductivity, and the attractive nature of the dominant strong quark-quark interaction leads one to expect that it will survive down to lower densities, but there may be a transition to some strongly coupled phase (e.g. a Bose–Einstein condensate of spatially bound di- or hexaquarks). | 7 | Physical Chemistry |
These catalysts are metallocenes together with a cocatalyst, typically MAO, −[O−Al(CH)]−. The idealized metallocene catalysts have the composition CpMCl (M = Ti, Zr, Hf) such as titanocene dichloride. Typically, the organic ligands are derivatives of cyclopentadienyl. In some complexes, the two cyclopentadiene (Cp) rings are linked with bridges, like −CH−CH− or >SiPh. Depending on the type of their cyclopentadienyl ligands, for example by using an ansa-bridge, metallocene catalysts can produce either isotactic or syndiotactic polymers of propylene and other 1-alkenes. | 7 | Physical Chemistry |
Derepression of translation increases protein production without altering the levels of mRNA in the cell. miRNAs are a common mechanism of translation repression, binding to the mRNA through complementary base pairing to silence them. Certain RNA binding proteins have been shown to target untranslated regions of the mRNAs and upregulate the translation initiation rates by alleviating the repressive miRNA effects. | 1 | Biochemistry |
In 1910 British polar explorer Robert Scott hoped to be the first to reach the South Pole, but was beaten by Norwegian explorer Roald Amundsen. On foot, the expedition trudged through the frozen deserts of the Antarctic, marching for caches of food and kerosene deposited on the way. In early 1912, at the first cache, there was no kerosene; the cans – soldered with tin – were empty. The cause of the empty tins could have been related to tin pest. The tin cans were recovered and no tin pest was found when analyzed by the Tin Research Institute. Some observers blame poor quality soldering, as tin cans over 80 years old have been discovered in Antarctic buildings with the soldering in good condition. | 8 | Metallurgy |
Generally, when reactions take place in the liquid and solid phases the change in volume due to reaction is not significant enough that it needs to be taken into account. Reactions in the gas phase often have significant changes in volume and in these cases one should use these modified equations. | 9 | Geochemistry |
A human artificial chromosome (HAC) is a microchromosome that can act as a new chromosome in a population of human cells. That is, instead of 46 chromosomes, the cell could have 47 with the 47th being very small, roughly 6–10megabases (Mb) in size instead of 50–250Mb for natural chromosomes, and able to carry new genes introduced by human researchers. Ideally, researchers could integrate different genes that perform a variety of functions, including [http://io9.com/how-artificial-chromosomes-could-transform-humanity-754993569 disease defense].
Alternative methods of creating transgenes, such as utilizing yeast artificial chromosomes and bacterial artificial chromosomes, lead to unpredictable problems. The genetic material introduced by these vectors not only leads to different expression levels, but the inserts also disrupt the original genome. HACs differ in this regard, as they are entirely separate chromosomes. This separation from existing genetic material assumes that no insertional mutants would arise. This stability and accuracy makes HACs preferable to other methods such as viral vectors, YACs, and BACs. HACs allow for delivery of more DNA (including promoters and copy-number variation) than is possible with viral vectors.
Yeast artificial chromosomes and bacterial artificial chromosomes were created before human artificial chromosomes, which were first developed in 1997. HACs are useful in expression studies as gene transfer vectors, as a tool for elucidating human chromosome function, and as a method for actively annotating the human genome. | 1 | Biochemistry |
A pesticide is a substance or a mixture of substances used for killing pests: organisms dangerous to cultivated plants or to animals. The term applies to various pesticides such as insecticide, fungicide, herbicide and nematocide.
The definition of residue of pesticide according to the world health organisation (WHO) is:- Any specified substances in or on food, agricultural commodities or animal feed resulting from the use of a pesticide. The term includes any derivatives of a pesticide, such as conversion products, metabolites, reaction products and impurities considered to be of toxicological significance. The term “pesticide residue” includes residues from unknown or unavoidable sources (e.g. environmental) as well as known uses of the chemical. The definition of a residue for compliance with maximum residue limits (MRLs) is that combination of the pesticide and its metabolites, derivatives and related compounds to which the MRL applies. | 2 | Environmental Chemistry |
Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulatory Element (WPRE) is a DNA sequence that, when transcribed, creates a tertiary structure enhancing expression. The sequence is commonly used in molecular biology to increase expression of genes delivered by viral vectors. WPRE is a tripartite regulatory element with gamma, alpha, and beta components. The alpha component is 80bp long:
GCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGT
When used alone without the gamma and beta WPRE components, the alpha component is only 9% as active as the full tripartite WPRE. The sequence for full tripartite WPRE is:
This sequence has 100% homology with base pairs 1093 to 1684 of the Woodchuck hepatitis B virus (WHV8) genome. When used in the 3' untranslated region (UTR) of a mammalian expression cassette, it can significantly increase mRNA stability and protein yield. | 1 | Biochemistry |
Given the biochemical network:
where and are fixed species to ensure the system is open. The system equation can be written as:
So that:
The elements of the rate vector will be rate equations that are functions of one or more species and parameters, p. In the example, these might be simple mass-action rate laws such as where is the rate constant parameter. The particular laws chosen will depend on the specific system under study. Assuming mass-action kinetics, the above equation can be written in complete form as: | 1 | Biochemistry |
Benzeneselenol is prepared by the reaction of phenylmagnesium bromide and selenium:
:PhMgBr + Se → PhSeMgBr
:PhSeMgBr + HCl → PhSeH + MgBrCl
Since benzeneselenol does not have a long shelf life, it is often generated in situ. A common method is by reduction of diphenyldiselenide. A further reason for this conversion is that often, it is the anion that is sought. | 0 | Organic Chemistry |
Gerel Ochir (; born 17 July 1941) is a Mongolian geologist. She specializes in petrology, geochemistry, and metallogeny. She has taught at the Mongolian University of Science and Technology for over 50 years and headed the Department of Geology for 30 years.
After earning bachelors and masters degrees in geology, geochemistry, and petrology from Charles University in Prague, she received her PhD and ScD through the Siberian Branch of the Russian Academy of Sciences.
Ochir has served as vice president of the International Union of Geological Sciences and received the Jan Masaryk Medal in 2021. | 9 | Geochemistry |
Gemperline completed both undergraduate and graduate studies at Cleveland State University (CSU), graduating with a Bachelor of Science in Chemistry in 1978 and a Ph.D. in Analytical Chemistry in 1982. His dissertation was titled, "The Design of the Laboratory Network DISNET."
In 2014 CSU recognized Gemperline as a distinguished alumnus. | 3 | Analytical Chemistry |
E–Z configuration, or the E–Z convention, is the IUPAC preferred method of describing the absolute stereochemistry of double bonds in organic chemistry. It is an extension of cis–trans isomer notation (which only describes relative stereochemistry) that can be used to describe double bonds having two, three or four substituents. E and Z notation are only used when a compound doesn't have two identical substituents.
Following the Cahn–Ingold–Prelog priority rules (CIP rules), each substituent on a double bond is assigned a priority, then positions of the higher of the two substituents on each carbon are compared to each other. If the two groups of higher priority are on opposite sides of the double bond (trans to each other), the bond is assigned the configuration E (from entgegen, , the German word for "opposite"). If the two groups of higher priority are on the same side of the double bond (cis to each other), the bond is assigned the configuration Z (from zusammen, , the German word for "together").
The letters E and Z are conventionally printed in italic type, within parentheses, and separated from the rest of the name with a hyphen. They are always printed as full capitals (not in lowercase or small capitals), but do not constitute the first letter of the name for English capitalization rules (as in the example above).
Another example: The CIP rules assign a higher priority to bromine than to chlorine, and a higher priority to chlorine than to hydrogen, hence the following (possibly counterintuitive) nomenclature.
For organic molecules with multiple double bonds, it is sometimes necessary to indicate the alkene location for each E or Z symbol. For example, the chemical name of alitretinoin is (2E,4E,6Z,8E)-3,7-dimethyl-9-(2,6,6-trimethyl-1-cyclohexenyl)nona-2,4,6,8-tetraenoic acid, indicating that the alkenes starting at positions 2, 4, and 8 are E while the one starting at position 6 is Z. | 4 | Stereochemistry |
The following peptides were synthesized using this method by 1949: <br/>
* -Ala-Gly
* -Tyr-Gly
* -Tyr-Tyr
* -Ala--Ala-Gly
* -di-Ala--cystinyl-di-Gly
* -Ala--Tyr-Gly
* -Ala--Tyr-Gly-Gly
* -Ala--Ala-L-Tyr-Gly-Gly
* -Tyr--Tyr--Tyr
* -Cystinyl-di-Gly | 1 | Biochemistry |
Microbial cells or biomass is sometimes the intended product of fermentation. Examples include single cell protein, bakers yeast, lactobacillus, E. coli, and others. In the case of single-cell protein, algae is grown in large open ponds which allow photosynthesis to occur. If the biomass is to be used for inoculation of other fermentations, care must be taken to prevent mutations from occurring. | 1 | Biochemistry |
Kortüm was a physical chemist who had a broad range of interests, and published prolifically. His research covered many aspects of light scattering. He began to pull together what was known in various fields into an understanding of how “reflectance spectroscopy” worked. In 1969, the English translation of his book entitled Reflectance Spectroscopy (long in preparation and translation) was published. This book came to dominate thinking of the day for 20 years in the emerging fields of both DRIFTS and NIR Spectroscopy.
Kortüms position was that since regular (or specular) reflection is governed by different laws than diffuse reflection, they should therefore be accorded different mathematical treatments. He developed an approach based on Schusters work by ignoring the emissivity of the clouds in the "foggy atmosphere". If we take as the fraction of incident light absorbed and as the fraction scattered isotropically by a single particle (referred to by Kortüm as the "true coefficients of single scatter"), and define the absorption and isotropic scattering for a layer as and then:
This is the same "remission function" as used by Judd, but Kortüm's translator referred to it as "the so-called reflectance function". If we substitute back for the particle properties, we obtain and then we obtain the Schuster equation for isotropic scattering:
Additionally, Kortüm derived "the Kubelka-Munk exponential solution" by defining and as the absorption and scattering coefficient per centimeter of the material and substituting: and , while pointing out in a footnote that is a back-scattering coefficient. He wound up with what he called the "Kubelka–Munk function", commonly called the Kubelka–Munk equation:
Kortüm concluded that "the two constant theory of Kubelka and Munk leads to conclusions accessible to experimental test. In practice these are found to be at least qualitatively confirmed, and suitable conditions fulfilling the assumptions made, quantitatively as well."
Kortüm tended to eschew the "particle theories", though he did record that one author, N.T. Melamed of Westinghouse Research Labs, "abandoned the idea of plane parallel layers and substituted them with a statistical summation over individual particles." | 7 | Physical Chemistry |
A cyclopentadienyl complex is a coordination complex of a metal and cyclopentadienyl groups (, abbreviated as Cp). Cyclopentadienyl ligands almost invariably bind to metals as a pentahapto (η-) bonding mode. The metal–cyclopentadienyl interaction is typically drawn as a single line from the metal center to the center of the Cp ring. | 0 | Organic Chemistry |
A set of empirical rules relating the protein structure to the pK values of ionizable residues have been developed by Li, Robertson, and Jensen. These rules form the basis for the [https://biolib.com/bio-utils/propka/ web-accessible] program called PROPKA for rapid predictions of pK values. A recent empirical pK prediction program was released by Tan KP et.al. with the online server [http://mspc.bii.a-star.edu.sg/tankp/ DEPTH web server]. | 7 | Physical Chemistry |
The most direct method for measuring atmospheric carbon dioxide concentrations for periods before instrumental sampling is to measure bubbles of air (fluid or gas inclusions) trapped in the Antarctic or Greenland ice sheets. The most widely accepted of such studies come from a variety of Antarctic cores and indicate that atmospheric concentrations were about 260–280 ppm immediately before industrial emissions began and did not vary much from this level during the preceding 10,000 years. The longest ice core record comes from East Antarctica, where ice has been sampled to an age of 800,000 years. During this time, the atmospheric carbon dioxide concentration has varied between 180 and 210 ppm during ice ages, increasing to 280–300 ppm during warmer interglacials.
mole fractions in the atmosphere have gone up by around 35 percent since the 1900s, rising from 280 parts per million by volume to 387 parts per million in 2009. One study using evidence from stomata of fossilized leaves suggests greater variability, with mole fractions above 300 ppm during the period ten to seven thousand years ago, though others have argued that these findings more likely reflect calibration or contamination problems rather than actual CO variability. Because of the way air is trapped in ice (pores in the ice close off slowly to form bubbles deep within the firn) and the time period represented in each ice sample analyzed, these figures represent averages of atmospheric concentrations of up to a few centuries rather than annual or decadal levels.
Ice cores provide evidence for greenhouse gas concentration variations over the past 800,000 years. Both CO and concentrations vary between glacial and interglacial phases, and these variations correlate strongly with temperature. Direct data does not exist for periods earlier than those represented in the ice core record, a record that indicates that CO mole fractions stayed within a range of 180 ppm to 280 ppm throughout the last 800,000 years, until the increase of the last 250 years. However, various proxy measurements and models suggest larger variations in past epochs: 500 million years ago CO levels were likely 10 times higher than now.
Various proxy measurements have been used to try to determine atmospheric CO concentrations millions of years in the past. These include boron and carbon isotope ratios in certain types of marine sediments, and the numbers of stomata observed on fossil plant leaves.
Phytane is a type of diterpenoid alkane. It is a breakdown product of chlorophyll, and is now used to estimate ancient levels. Phytane gives both a continuous record of concentrations but it also can overlap a break in the record of over 500 million years. | 2 | Environmental Chemistry |
Quinaldine red is an indicator that turns from colorless to red between a pH of 1.0–2.2. The image below shows what color quinaldine red would appear as in a given pH.
It is a cationic molecule that undergoes oxidation at different levels of pH. The rate of oxidation of Quinaldine red is in the first order with respect to the concentration of the oxidizing agent.
Other factors that increases the rate of oxidation includes increasing pH and increased sodium carbonate concentration. The reaction rate eventually levels off due to the maximum formation of the product within the oxidation process.
Quinaldine red also has the ability to fluoresce. Free quinaldine red does not fluoresce in solution when it is not bound to anything, making quinaldine red only visible by fluorescence when it is bound to something. Quinaldine red can exhibit fluorescence when it is bound to nucleic acids, which then emit radiation between 580-650 nm.
Maximum fluorescence of QR is detected from 557 nm to 607 nm. QR and the nucleic acids react quickly under room temperature, and the resulting QR-nucleic acid complex is able to fluorescence. However, fluorescent activity decrease as time goes on. Maximum fluorescence between QR and DNA is found within the pH range of 3.2-3.6, with the optimum being a pH 3.5. The amount of fluorescence seen with the use of QR is linearly related to the concentrations of DNA or RNA. | 3 | Analytical Chemistry |
The rate of electromagnetic radiation emitted at a given frequency is proportional to the amount of absorption that it would experience by the source, a property known as reciprocity. Thus, a surface that absorbs more red light thermally radiates more red light. This principle applies to all properties of the wave, including wavelength (color), direction, polarization, and even coherence. It is therefore possible to have thermal radiation which is polarized, coherent, and directional; though polarized and coherent forms are fairly rare in nature far from sources (in terms of wavelength). | 7 | Physical Chemistry |
Poly(ADP-ribose)polymerases (PARPs) are found mostly in eukaryotes and catalyze the transfer of multiple ADP-ribose molecules to target proteins. As with mono(ADP-ribosyl)ation, the source of ADP-ribose is NAD. PARPs use a catalytic triad of His-Tyr-Glu to facilitate binding of NAD and positioning of the end of the existing poly(ADP-ribose) chain on the target protein; the Glu facilitates catalysis and formation of a (1→2) O'-glycosidic linkage between two ribose molecules.
There are several other enzymes that recognize poly(ADP-ribose) chains, hydrolyse them or form branches; over 800 proteins have been annotated to contain the loosely defined poly(ADP-ribose) binding motif; therefore, in addition to this modification altering target protein conformation and structure, it may also be used as a tag to recruit other proteins or for regulation of the target protein. | 1 | Biochemistry |
Schoell has made many contributions to geochemistry with emphasis on the applications of stable isotope analysis. The results of Schoells work have included identifying the pathways of formation that distinguish methane of biogenic origin from that of thermogenic origin using stable isotope analysis. In the paper, "Biogenic methane formation in marine and freshwater environments: CO reduction VS. acetate fermentation-Isotope evidence", Schoell et al. identify that the two primary methods for aquatic and marine methane production are carbon dioxide reduction and acetate fermentation, respectively. By recognizing the difference in δC and δD fractionation of the water environments and observing the differences in δC and δD fractionations of the methane product, Schoell et al. concluded that the dominant pathway of methane in marine environments is via acetate fermentation, while methane in freshwater environments arises from CO reduction. By analyzing the CH and HO fractionation, Schoell, et al.' offer a technique for identifying the original environment in which methane was produced.
Schoell continued his work with methane origin studies expanding his research to consider how stable isotopes can provide insight regarding the temperature of the environment for both thermogenic and biogenic methane production. Specifically, Schoell collaborated on the paper "Formation temperatures of thermogenic and biogenic methane" authored by D. Stolper, which used "clustered isotope" techniques to determine the temperature at which methane was produced. This approach has become useful for identifying the thermal conditions of methane formation for both the high temperatures of thermogenic methane production and the relatively lower temperatures of microbial methane production as well as characterizing the contribution of both producers to a mixed sample.
While the majority of Schoell's work has revolved around identifying the origins and pathways of methane production, he has also done work using stable isotope analysis to address how environmental factors affect preservable products of biological activity. Schoell addresses this topic in the paper, "Sensitivity of biomarker properties to depositional environment and/or source input in the Lower Toarcian of SW-Germany". In addition to this, his career has included the research of how stable isotope analysis can be used to identify the mixing and composition of natural gasses, as discussed in "Use of Gas Isotope Analyses for Reservoir Management". | 9 | Geochemistry |
Consider a typical balanced chemical reaction:
The lowercase letters (, , , and ) represent stoichiometric coefficients, while the capital letters represent the reactants ( and ) and the products ( and ).
According to IUPAC's Gold Book definition
the reaction rate for a chemical reaction occurring in a closed system at constant volume, without a build-up of reaction intermediates, is defined as:
where denotes the concentration of the substance or . The reaction rate thus defined has the units of mol/L/s.
The rate of a reaction is always positive. A negative sign is present to indicate that the reactant concentration is decreasing. The IUPAC recommends that the unit of time should always be the second. The rate of reaction differs from the rate of increase of concentration of a product P by a constant factor (the reciprocal of its stoichiometric number) and for a reactant A by minus the reciprocal of the stoichiometric number. The stoichiometric numbers are included so that the defined rate is independent of which reactant or product species is chosen for measurement. For example, if and then is consumed three times more rapidly than , but is uniquely defined. An additional advantage of this definition is that for an elementary and irreversible reaction, is equal to the product of the probability of overcoming the transition state activation energy and the number of times per second the transition state is approached by reactant molecules. When so defined, for an elementary and irreversible reaction, is the rate of successful chemical reaction events leading to the product.
The above definition is only valid for a single reaction, in a closed system of constant volume. If water is added to a pot containing salty water, the concentration of salt decreases, although there is no chemical reaction.
For an open system, the full mass balance must be taken into account:
where
* is the inflow rate of in molecules per second;
* the outflow;
* is the instantaneous reaction rate of (in number concentration rather than molar) in a given differential volume, integrated over the entire system volume at a given moment.
When applied to the closed system at constant volume considered previously, this equation reduces to:
where the concentration is related to the number of molecules by Here is the Avogadro constant.
For a single reaction in a closed system of varying volume the so-called rate of conversion can be used, in order to avoid handling concentrations. It is defined as the derivative of the extent of reaction with respect to time.
Here is the stoichiometric coefficient for substance , equal to , , , and in the typical reaction above. Also is the volume of reaction and is the concentration of substance .
When side products or reaction intermediates are formed, the IUPAC recommends the use of the terms the rate of increase of concentration and rate of the decrease of concentration for products and reactants, properly.
Reaction rates may also be defined on a basis that is not the volume of the reactor. When a catalyst is used the reaction rate may be stated on a catalyst weight (mol g s) or surface area (mol m s) basis. If the basis is a specific catalyst site that may be rigorously counted by a specified method, the rate is given in units of s and is called a turnover frequency. | 7 | Physical Chemistry |
It is a less explosive alternative to diazomethane for the methylation of carboxylic acids. It also reacts with alcohols to give methyl ethers, where diazomethane may not.
It has also been employed widely in tandem with GC-MS for the analysis of various carboxylic compounds which are ubiquitous in nature. The fact that the reaction is rapid and occurs readily makes it attractive. However, it can form artifacts which complicate spectral interpretation. Such artifacts are usually the trimethylsilylmethyl esters, RCOCHSiMe, formed when insufficient methanol is present. Acid-catalysed methanolysis is necessary to achieve near-quantitative yields of the desired methyl esters, RCOMe.
The compound is a reagent in the Doyle-Kirmse reaction with allyl sulfides and allyl amines. | 0 | Organic Chemistry |
In 1821, the German physicist Thomas Johann Seebeck discovered that a magnetic needle held near a circuit made up of two dissimilar metals got deflected when one of the dissimilar metal junctions was heated. At the time, Seebeck referred to this consequence as thermo-magnetism. The magnetic field he observed was later shown to be due to thermo-electric current. In practical use, the voltage generated at a single junction of two different types of wire is what is of interest as this can be used to measure temperature at very high and low temperatures. The magnitude of the voltage depends on the types of wire being used. Generally, the voltage is in the microvolt range and care must be taken to obtain a usable measurement. Although very little current flows, power can be generated by a single thermocouple junction. Power generation using multiple thermocouples, as in a thermopile, is common.
The standard configuration for thermocouple usage is shown in the figure.
Briefly, the desired temperature T is obtained using three inputs—the characteristic function E(T) of the thermocouple, the measured voltage V, and the reference junctions temperature T'.
The solution to the equation E(T) = V + E(T) yields T.
These details are often hidden from the user since the reference junction block (with T thermometer), voltmeter, and equation solver are combined into a single product. | 8 | Metallurgy |
There is no evidence to show that any of these foods have a negative calorific impact. Foods claimed to be negative in calories are mostly low-calorie fruits and vegetables such as celery, grapefruit, orange, lemon, lime, apple, lettuce, broccoli, and cabbage. However, celery has a thermic effect of around 8%, much less than the 100% or more required for a food to have "negative calories".
Diets based on negative-calorie food do not work as advertised but can lead to weight loss because they satisfy hunger by filling the stomach with food that is not calorically dense. A 2005 study based on a low-fat plant-based diet found that the average participant lost over fourteen weeks, and attributed the weight loss to the reduced energy density of the foods resulting from their low fat content and high fiber content, and the increased thermic effect. Nevertheless, these diets are not "negative-calorie" since they bear energy. Another study demonstrated that negative-calorie diets (NCDs) have the same efficacy to low-calorie diets (LCDs) in inducing weight loss when both of these diets are combined with exercise.
Chewing gum has been speculated as a "negative-calorie food"; A study on chewing gum reported mastication burns roughly per hour. Therefore, to reach "negative-calorie" one has to chew for almost 6 minutes per kcal (one chewing gum can have a large range of kcal from around 2 to 15 kcal). | 1 | Biochemistry |
Bis(trimethylsilyl)peroxide (sometimes abbreviated as BTSP) is an organosilicon compound with the formula ((CH)SiO). It is a colorless liquid that is soluble in organic solvents so long as they lack acidic groups. The compound represents an aprotic analogue of hydrogen peroxide and as such it is used for certain sensitive organic oxidations. Upon treatment with organolithium compounds, it affords the silyl ether. | 0 | Organic Chemistry |
Shamoo was born and raised in Baghdad, Iraq. He is an ethnic Iraqi. He attended the University of Baghdad and graduated with a degree in physics in 1962. In 1966, he earned a Master's of Science in physics from the University of Louisville. Four years later, in 1970, he finished his Ph.D. in the program in Biology at the City University of New York. | 1 | Biochemistry |
An increasing offset between the optical phase and the maximum of the wave envelope of an optical pulse can be seen on the right.
Each line is displaced from a harmonic of the repetition rate by the carrier–envelope offset frequency. The carrier–envelope offset frequency is the rate at which the peak of the carrier frequency slips from the peak of the pulse envelope on a pulse-to-pulse basis.
Measurement of the carrier–envelope offset frequency is usually done with a self-referencing technique, in which the phase of one part of the spectrum is compared to its harmonic. Different possible approaches for carrier–envelope offset phase control were proposed in 1999. The two simplest approaches, which require only one nonlinear optical process, are described in the following.
In the "f − 2f" technique, light at the lower-energy side of the broadened spectrum is doubled using second-harmonic generation (SHG) in a nonlinear crystal, and a heterodyne beat is generated between that and light at the same wavelength on the upper-energy side of the spectrum. This beat signal, detectable with a photodiode, includes a difference-frequency component, which is the carrier–envelope offset frequency.
Alternatively, difference-frequency generation (DFG) can be used. From light of opposite ends of the broadened spectrum the difference frequency is generated in a nonlinear crystal, and a heterodyne beat between this mixing product and light at the same wavelength of the original spectrum is measured. This beat frequency, detectable with a photodiode, is the carrier–envelope offset frequency.
Because the phase is measured directly, and not the frequency, it is possible to set the frequency to zero and additionally lock the phase, but because the intensity of the laser and this detector is not very stable, and because the whole spectrum beats in phase,
one has to lock the phase on a fraction of the repetition rate. | 7 | Physical Chemistry |
In 2020, a large harmful algal bloom closed beaches in Poland and Finland, brought on by a combination of fertilizer runoff and extreme heat, posing a risk to flounder and mussel beds. This is seen by the Baltic Sea Action Group as a threat to biodiversity and regional fishing stocks. | 3 | Analytical Chemistry |
The acentric factor is a conceptual number introduced by Kenneth Pitzer in 1955, proven to be useful in the description of fluids. It has become a standard for the phase characterization of single & pure components, along with other state description parameters such as molecular weight, critical temperature, critical pressure, and critical volume (or critical compressibility). The acentric factor is also said to be a measure of the non-sphericity (centricity) of molecules.
Pitzer defined from the relationship
where
is the reduced saturation vapor pressure and
is the reduced temperature.
For a series of fluids, as the acentric factor increases the vapor curve is "pulled" down, resulting in higher boiling points. For many monatomic fluids,
is close to 0.1, which leads to . In many cases, lies above the boiling temperature of liquids at atmosphere pressure.
Values of can be determined for any fluid from accurate experimental vapor pressure data. The definition of gives values which are close to zero for the noble gases argon, krypton, and xenon. is also very close to zero for molecules which are nearly spherical. Values of correspond to vapor pressures above the critical pressure, and are non-physical.
The acentric factor can be predicted analytically from some equations of state. For example, it can be easily shown from the above definition that a van der Waals fluid has an acentric factor of about −0.302024, which if applied to a real system would indicate a small, ultra-spherical molecule. | 7 | Physical Chemistry |
Continuous casting is a refinement of the casting process for the continuous, high-volume production of metal sections with a constant cross-section. Its primarily used to produce a semi-finished products for further processing. Molten metal is poured into an open-ended, water-cooled mold, which allows a skin' of solid metal to form over the still-liquid center, gradually solidifying the metal from the outside in. After solidification, the strand, as it is sometimes called, is continuously withdrawn from the mold. Predetermined lengths of the strand can be cut off by either mechanical shears or traveling oxyacetylene torches and transferred to further forming processes, or to a stockpile. Cast sizes can range from strip (a few millimeters thick by about five meters wide) to billets (90 to 160 mm square) to slabs (1.25 m wide by 230 mm thick). Sometimes, the strand may undergo an initial hot rolling process before being cut.
Continuous casting is used due to the lower costs associated with continuous production of a standard product, and also increased quality of the final product. Metals such as steel, copper, aluminum and lead are continuously cast, with steel being the metal with the greatest tonnages cast using this method. | 8 | Metallurgy |
2A peptides are a class of 18–22 aa-long peptides, which can induce ribosomal skipping during translation of a protein in a biological cell. These peptides share a core sequence motif of , and are found in a wide range of viral families. 2A peptides can be introduced artificially to help generate polyproteins from a single ORF, by causing the ribosome to fail at making a peptide bond, and then resume translation.
The members of 2A peptides are named after the virus in which they have been first described. For example, F2A, the first described 2A peptide, is derived from foot-and-mouth disease virus. The name "2A" itself comes from the gene numbering scheme of this virus.
These peptides are also known as "self-cleaving" peptides, which is a known misnomer, because the missing peptide bond is never synthesized by the ribosome, and is thus not cleaved. | 1 | Biochemistry |
There may be some leakage of the electrons transferred in the respiratory chain to form reactive oxygen species. This was thought to result in significant oxidative stress in the mitochondria with high mutation rates of mitochondrial DNA. Hypothesized links between aging and oxidative stress are not new and were proposed in 1956, which was later refined into the mitochondrial free radical theory of aging. A vicious cycle was thought to occur, as oxidative stress leads to mitochondrial DNA mutations, which can lead to enzymatic abnormalities and further oxidative stress.
A number of changes can occur to mitochondria during the aging process. Tissues from elderly humans show a decrease in enzymatic activity of the proteins of the respiratory chain. However, mutated mtDNA can only be found in about 0.2% of very old cells. Large deletions in the mitochondrial genome have been hypothesized to lead to high levels of oxidative stress and neuronal death in Parkinson's disease. Mitochondrial dysfunction has also been shown to occur in amyotrophic lateral sclerosis.
Since mitochondria cover a pivotal role in the ovarian function, by providing ATP necessary for the development from germinal vesicle to mature oocyte, a decreased mitochondria function can lead to inflammation, resulting in premature ovarian failure and accelerated ovarian aging. The resulting dysfunction is then reflected in quantitative (such as mtDNA copy number and mtDNA deletions), qualitative (such as mutations and strand breaks) and oxidative damage (such as dysfunctional mitochondria due to ROS), which are not only relevant in ovarian aging, but perturb oocyte-cumulus crosstalk in the ovary, are linked to genetic disorders (such as Fragile X) and can interfere with embryo selection. | 1 | Biochemistry |
The Public Analyst runs a laboratory which will:
* Analyse food:
** for composition: many foods have legally defined, customary or expected compositions
** for additives: which must be legally permitted and within prescribed concentrations
** for contamination: chemical, microbiological
** to assess the accuracy of labelling
** to investigate whether complaints by the public are justified
* Interpret relevant law passed by the EU and UK or Ireland:
** act as expert witness in prosecutions
In addition to their central rôle in relation to food law enforcement, Public Analysts provide expert scientific support to local authorities and the private sector in various other areas, for example they:
* analyse drinking, bathing water including swimming pools, industrial effluents, industrial process waters and other waters
* investigate environmental products and processes including assessing land contamination, building materials and examining fuels
* advise on waste management
* investigate and monitor air pollution
* advise on consumer safety - in particular consumer products such as toys
* monitor asbestos and other hazards
* carry out toxicological work to assist HM Coroners | 2 | Environmental Chemistry |
Perovskites may be structured in layers, with the structure separated by thin sheets of intrusive material. Different forms of intrusions, based on the chemical makeup of the intrusion, are defined as:
* Aurivillius phase: the intruding layer is composed of a [] ion, occurring every n layers, leading to an overall chemical formula of []-. Their oxide ion-conducting properties were first discovered in the 1970s by Takahashi et al., and they have been used for this purpose ever since.
* Dion−Jacobson phase: the intruding layer is composed of an alkali metal (M) every n layers, giving the overall formula as
* Ruddlesden-Popper phase: the simplest of the phases, the intruding layer occurs between every one (n = 1) or multiple (n > 1) layers of the lattice. Ruddlesden−Popper phases have a similar relationship to perovskites in terms of atomic radii of elements with A typically being large (such as La or Sr) with the B ion being much smaller typically a transition metal (such as Mn, Co or Ni). Recently, hybrid organic-inorganic layered perovskites have been developed, where the structure is constituted of one or more layers of MX-octahedra, where M is a +2 metal (such as Pb or Sn) and X and halide ion (such as ), separated by layers of organic cations (such as butylammonium- or phenylethylammonium-cation). | 3 | Analytical Chemistry |
In the early 1970s, computer technology enabled on-site data processing, some real-time analysis, and even graphical displays of metabolic variables, such as O, CO, and air-flow, thereby encouraging academic institutions to test accuracy and precision in new ways. A few years later in the decade, battery-operated systems made debuts. For example, a demonstration of the mobile system with digital display of both cumulative and past-minute oxygen consumption was presented in 1977 at the Proceedings of the Physiological Society. As manufacturing and computing costs dropped over the next few decades, various universal calibration methods for preparing and comparing various models in the 1990s brought attention to short-comings or advantages of various designs. In addition to lower costs, the metabolic variable CO was often ignored, promoting instead a focus on oxygen-consumption models of weight management and exercise training.
In the new millennium, smaller "desktop-sized" indirect calorimeters were being distributed with dedicated personal computers and printers, and running modern windows-based software. | 1 | Biochemistry |
MDA can generate 1–2 µg of DNA from single cell with genome coverage of up to 99%. Products also have lower error rate and larger sizes compared to PCR based Taq amplification.
General work flow of MDA:
# Sample preparation: Samples are collected and diluted in the appropriate reaction buffer (Ca and Mg free). Cells are lysed with alkaline buffer.
# Condition: The MDA reaction with Ф29 polymerase is carried out at 30 °C. The reaction usually takes about 2.5–3 hours.
# End of reaction: Inactivate enzymes at 65 °C before collection of the amplified DNA products
# DNA products can be purified with commercial purification kit. | 1 | Biochemistry |
The AMNet consists of approximately 15 sites across the U.S. and Canada. The function of these sites is to measure ambient air concentrations of gaseous oxidized mercury (GOM), particulate bound mercury (PBM), and gaseous elemental mercury (GEM). This network works to monitor and report atmospheric mercury that causes dry and total deposition of mercury at select MDN sites. AMNet produces high-resolution data to determine atmospheric mercury trends and models, the ecological consequences of mercury discharging sources, and how to adequately control mercury levels. | 2 | Environmental Chemistry |
Athletes may adopt gene therapy technologies to improve their performance. Gene doping is not known to occur, but multiple gene therapies may have such effects. Kayser et al. argue that gene doping could level the playing field if all athletes receive equal access. Critics claim that any therapeutic intervention for non-therapeutic/enhancement purposes compromises the ethical foundations of medicine and sports. | 1 | Biochemistry |
As it was previously mentioned, L-Photo-Methionine can be used to study protein-protein interactions with the proteins in their native environment. How this is possible is how the amino acid behaves when exposed to UV light. To prove that first the synthesis works, a radioactive carbon (C) as added under its own synthesis to perform proper spectroscopic methods. | 5 | Photochemistry |
Various composite coatings were analyzed on filter paper in an experiment done by Wang et al. The ability to separate homogenous liquid solutions based on varying surface tensions has great practical use. Creating superhydrophobic and superoleophilic filter paper was achieved by treating the surface of commercially available filter paper with hydrophobic silica nanoparticles and polystyrene solution in toluene. Oil and water were successfully separated through the use of the filter paper created with an efficiency greater than 96%. In a homogenous solution the filter paper was also successful in separating the liquids through differentiating for surface tensions. Although with a lower efficiency, aqueous ethanol was also extracted from the solution when tested on the filter paper. | 7 | Physical Chemistry |
Characterization and quantification of the transcriptome in a given "dead" tissue can identify genetic assets, which can be used to determine the regulatory mechanisms and set networks of gene expression.
The techniques commonly used for simultaneously measuring the concentration of a large number of different types of mRNA include microarrays and high-throughput sequencing via RNA-Seq.
Analysis from a serology postmortem can characterize the transcriptome of a particular tissue cell type, or compare the transcriptomes between various experimental conditions. Such analysis can be complementary to the analysis of thanatomicrobiome to better understand the process of transformation of the necromass in the hours and days following death. | 1 | Biochemistry |
Huntington's disease is a disease characterized by minor coordination problems, jerking eye movements, and uncontrollable movement of peripheral limbs. Symptoms generally occur at the age of 40, and are often accompanied by depression and psychosis. The disease is caused by a mutation in the Huntingtin gene, on chromosome 4, which causes abnormally large numbers of glutamate residues in the protein. Via an unknown mechanism, this accumulation leads to neurodegeneration in the caudate nucleus and putamen, selectively destroying GABAergic neurons which project to the globus pallidus. There is also significant necrosis in the thalamus and cerebral cortex. Cholinergic interneurons and dopaminergic neurons in the midbrain are largely unaffected.
Treatment for Huntington's disease is extremely limited due to the lack of knowledge concerning the pathogenesis of protein accumulation, though drugs used include dopamine receptor antagonists to minimize tremors and antidepressants to ameliorate symptoms of psychosis and depression. | 1 | Biochemistry |
The introduction of amalgamation to silver refining in the Americas not only ended the mid-sixteenth century crisis in silver production, it also inaugurated a rapid expansion of silver production in New Spain and Peru as miners could now profitably mine lower-grade ores. In addition, places that were rich in ore but too isolated from indigenous populations or forests for the labor- and fuel-intensive smelting method to be profitable, as was the case with Potosí in modern-day Bolivia, were now viable. As a result of this expansion, the Americas became the primary producer of the worlds silver, with Spanish America producing three-fifths of the worlds silver supply prior to 1900.
Increased silver production due to the introduction of mercury amalgamation resulted in an increased demand for labor. In New Spain, mining labor was initially supplied by the encomienda system or by enslaved Indians before transitioning to a repartimiento rotating labor system, but by the early 1600s, the majority of workers were Indian free wage or debt peonage workers. These naboríos were free, unattached Indians who contracted themselves out for sustenance and payment. Spaniards tended to distrust naboríos and accused them of profiteering by stealing ore, taking advances and fleeing, or contracting themselves out to multiple employers at a time. Regardless, the mines in New Spain increasingly relied on naboríos, who constituted over two thirds of mine workers in the region. Repartimiento Indian workers made up roughly seventeen percent of laborers, with another fourteen percent composed of Black slaves. Throughout the Spanish colonies, white men typically took positions as supervisors or mine owners.
The introduction of silver amalgamation allowed for an expansion of silver production in Peru that had profound consequences for Perus native population. From 1571, the year the amalgamation process was introduced to the Andes, to 1575, Perus silver production quintupled. In 1572, in order to provide sufficient labor to accommodate the expansion of silver mining to lower-grade ores, Viceroy Francisco Toledo organized an Indian draft labor system, the mita. This system of forced labor was based on the mita, a rotating, reciprocal labor obligation instituted in pre-Hispanic Andean society. Under this system, thousands of natives were forced to work in silver and mercury mines for less than subsistence-level wages. Thirteen thousand draft laborers per year worked at the largest mine in the Americas, located at Potosí in modern Bolivia. Native attempts to avoid the mita led to the abandonment of many Indian villages throughout Peru as thousands of Indians either moved permanently to Potosí or fled their traditional ayllus' in order to escape the labor draft. Spanish monopolization of refining through amalgamation cut natives out of what had earlier been a native-dominated enterprise. Refining represented the most profitable segment of silver production. In conjunction with the mita, the exclusion of natives from owning refineries contributed to the transformation of Peruvian natives into a poorly paid labor force.
The rapid expansion of silver production and coinage—made possible due to the invention of amalgamation—has often been identified as the primary driver of the price revolution, a period of high inflation lasting from the sixteenth to early seventeenth-century in Europe. Proponents of this theory argue that Spain's reliance on silver coins from the Americas to finance its large balance of payments deficits resulted in a general expansion of the European money supply and corresponding inflation. Critics of the theory, however, argue that inflation was really a result of European government policies and population growth.
While the role of the expansion in silver production in the price revolution may be disputed, this expansion is often acknowledged as a key ingredient in the formation of early-modern world trade. In the 1530s, China decreed that all internal taxation must be paid in silver, driving demand for Spanish American silver and facilitating the development of extensive trade networks linking Europe, Africa, Asia, and the Americas as Europeans sought to gain access to Chinese wares. | 8 | Metallurgy |
These proteins are synthesized in the cell bodies of the supraoptic and paraventricular regions of the hypothalamus.
The disulfide-rich neurophysin protein is suggested to be congruent with the synthesis of insulin in which a precursor molecule of higher molecular weight is proteolytically cleaved and forms disulfide linkages.
Although not enough data has been obtained, it is hypothesized that there is a common precursor molecule between neurophysin and the two hormones it stabilizes. | 1 | Biochemistry |
As a reference, molten sodium chloride, table salt has a melting point (m.p.) of 801 °C (1474 °F). A variety of eutectic mixtures have been developed with lower melting points: | 8 | Metallurgy |
The name NANOG derives from Tír na nÓg (Irish for "Land of the Young"), a name given to the Celtic Otherworld in Irish and Scottish mythology. | 1 | Biochemistry |
A polyoxyanion is a polymeric oxyanion in which multiple oxyanion monomers, usually regarded as polyhedra, are joined by sharing corners or edges. When two corners of a polyhedron are shared the resulting structure may be a chain or a ring. Short chains occur, for example, in polyphosphates. Inosilicates, such as pyroxenes, have a long chain of tetrahedra each sharing two corners. The same structure occurs in so-called meta-vanadates, such as ammonium metavanadate, .
The formula of the oxyanion is obtained as follows: each nominal silicon ion () is attached to two nominal oxide ions () and has a half share in two others. Thus the stoichiometry and charge are given by:
A ring can be viewed as a chain in which the two ends have been joined. Cyclic triphosphate, is an example.
When three corners are shared the structure extends into two dimensions. In amphiboles, (of which asbestos is an example) two chains are linked together by sharing of a third corner on alternate places along the chain. This results in an ideal formula and a linear chain structure which explains the fibrous nature of these minerals. Sharing of all three corners can result in a sheet structure, as in mica, , in which each silicon has one oxygen to itself and a half-share in three others. Crystalline mica can be cleaved into very thin sheets.
The sharing of all four corners of the tetrahedra results in a 3-dimensional structure, such as in quartz. Aluminosilicates are minerals in which some silicon is replaced by aluminium. However, the oxidation state of aluminium is one less than that of silicon, so the replacement must be accompanied by the addition of another cation. The number of possible combinations of such a structure is very large, which is, in part, the reason why there are so many aluminosilicates.
Octahedral units are common in oxyanions of the larger transition metals. Some compounds, such as salts of the chain-polymeric ion, even contain both tetrahedral and octahedral units. Edge-sharing is common in ions containing octahedral building blocks and the octahedra are usually distorted to reduce the strain at the bridging oxygen atoms. This results in 3-dimensional structures called polyoxometalates. Typical examples occur in the Keggin structure of the phosphomolybdate ion. Edge sharing is an effective means of reducing electrical charge density, as can be seen with the hypothetical condensation reaction involving two octahedra:
Here, the average charge on each M atom is reduced by 2. The efficacy of edge-sharing is demonstrated by the following reaction, which occurs when an alkaline aqueous solution of molybdate is acidified.
The tetrahedral molybdate ion is converted into a cluster of 7 edge-linked octahedra giving an average charge on each molybdenum of . The heptamolybdate cluster is so stable that clusters with between 2 and 6 molybdate units have not been detected even though they must be formed as intermediates. | 7 | Physical Chemistry |
Oxidative phosphorylation works by using energy-releasing chemical reactions to drive energy-requiring reactions. The two sets of reactions are said to be coupled. This means one cannot occur without the other. The chain of redox reactions driving the flow of electrons through the electron transport chain, from electron donors such as NADH to electron acceptors such as oxygen and hydrogen (protons), is an exergonic process – it releases energy, whereas the synthesis of ATP is an endergonic process, which requires an input of energy. Both the electron transport chain and the ATP synthase are embedded in a membrane, and energy is transferred from the electron transport chain to the ATP synthase by movements of protons across this membrane, in a process called chemiosmosis. A current of protons is driven from the negative N-side of the membrane to the positive P-side through the proton-pumping enzymes of the electron transport chain. The movement of protons creates an electrochemical gradient across the membrane, is called the proton-motive force. It has two components: a difference in proton concentration (a H gradient, ΔpH) and a difference in electric potential, with the N-side having a negative charge.
ATP synthase releases this stored energy by completing the circuit and allowing protons to flow down the electrochemical gradient, back to the N-side of the membrane. The electrochemical gradient drives the rotation of part of the enzyme's structure and couples this motion to the synthesis of ATP.
The two components of the proton-motive force are thermodynamically equivalent: In mitochondria, the largest part of energy is provided by the potential; in alkaliphile bacteria the electrical energy even has to compensate for a counteracting inverse pH difference. Inversely, chloroplasts operate mainly on ΔpH. However, they also require a small membrane potential for the kinetics of ATP synthesis. In the case of the fusobacterium Propionigenium modestum it drives the counter-rotation of subunits a and c of the F motor of ATP synthase.
The amount of energy released by oxidative phosphorylation is high, compared with the amount produced by anaerobic fermentation. Glycolysis produces only 2 ATP molecules, but somewhere between 30 and 36 ATPs are produced by the oxidative phosphorylation of the 10 NADH and 2 succinate molecules made by converting one molecule of glucose to carbon dioxide and water, while each cycle of beta oxidation of a fatty acid yields about 14 ATPs. These ATP yields are theoretical maximum values; in practice, some protons leak across the membrane, lowering the yield of ATP. | 1 | Biochemistry |
Femtochemistry has been used to show the time-resolved electronic stages of bromine dissociation. When dissociated by a 400 nm laser pulse, electrons completely localize onto individual atoms after 140 fs, with Br atoms separated by 6.0 Å after 160 fs. | 7 | Physical Chemistry |
Difference density maps are usually calculated using Fourier coefficients which are the differences between the observed structure factor amplitudes from the X-ray diffraction experiment and the calculated structure factor amplitudes from the current model, using the phase from the model for both terms (since no phases are available for the observed data). The two sets of structure factors must be on the same scale.
It is now normal to also include maximum-likelihood weighting terms which take into account the estimated errors in the current model:
where m is a figure of merit which is an estimate of the cosine of the error in the phase, and D is a "σ" scale factor. These coefficients are derived from the gradient of the likelihood function of the observed structure factors on the basis of the current model. A difference map built with m and D is known as a mFo – DFc map.
The use of ML weighting reduces model bias (due to using the model's phase) in the 2 Fo–Fc map, which is the main estimate of the true density. However, it does not fully eliminate such bias. | 3 | Analytical Chemistry |
In the field of environmental science, adsorption is involved in many parts of technologies that can eliminate pollutants and governs the concentration of chemicals in soils and/or atmosphere. When studying pollutant degradation or the geochemical process, the pzc value related to adsorption has been examined. For example, natural and organic substrates including wood ash, sawdust, etc. are to be used as an adsorbent by eliminating harmful heavy metals like arsenic, cobalt, mercury ion and so forth in contaminated neutral drainage (CND), which is a passive reactor that could possible metal adsorption with low-cost materials. Therefore, the pzc values of the organic substrates were evaluated to optimize the selection of materials in CND. Another example is that the emission of nitrous acid, which controls the atmosphere's oxidative capacity. Different soil pH leads to the different surface charges of minerals so the emission of nitrous acid would be varied, further impacting on the biological cycle involved in the nitrous acid species. | 7 | Physical Chemistry |
Other phenomena in which large effects may be achieved faster than small effects are:
* Latent heat: Turning ice to water takes the same amount of energy as heating water from to .
* Leidenfrost effect: Lower temperature boilers can sometimes vaporize water faster than higher temperature boilers. | 7 | Physical Chemistry |
Many different illnesses can cause an increase in metabolic activity as the body combats illness and disease in order to heal itself.
Hypermetabolism is a common symptom of various pathologies. Some of the most prevalent diseases characterized by hypermetabolism are listed below.
* Hyperthyroidism: Manifestation: An overactive thyroid often causes a state of increased metabolic activity.
* Friedreich's ataxia: Manifestation: Local cerebral metabolic activity is increased extensively as the disease progresses.
* Fatal familial insomnia: Manifestation: Hypermetabolism in the thalamus occurs and disrupts sleep spindle formation that occurs there.
* Graves' disease: Manifestation: Excess hypermetabolically-induced thyroid hormone activates sympathetic pathways, causing the eyelids to retract and remain constantly elevated.
* Anorexia and bulimia: Manifestation: The prolonged stress put on the body as a result of these eating disorders forces the body into starvation mode. Some patients recovering from these disorders experience hypermetabolism until they resume normal diets.
* Astrocytoma: Manifestation: Causes hypermetabolic lesions in the brain | 1 | Biochemistry |
Paucimannosylation has been extensively studied and documented in insects, nematodes and plants over the past decades. The paucimannosidic proteins are constitutively and broadly expressed across tissues in these organisms under normal physiology. It is widely recognised that paucimannosylation is a central component of the glycoproteome in these "lower" organisms. Recently, paucimannosylation was reported to form an unconventional type of protein N-glycosylation in vertebrates. It has been proposed that "higher" species including humans, rodents and other mammals use paucimannosylation in a more tissue- and context-restricted manner in pathophysiological conditions including cancer, pathogen infection, inflammation and stemness. | 1 | Biochemistry |
When the electrons in the atom are excited, for example by being heated, the additional energy pushes the electrons to higher energy orbitals. When the electrons fall back down and leave the excited state, energy is re-emitted in the form of a photon. The wavelength (or equivalently, frequency) of the photon is determined by the difference in energy between the two states. These emitted photons form the element's spectrum.
The fact that only certain colors appear in an element's atomic emission spectrum means that only certain frequencies of light are emitted. Each of these frequencies are related to energy by the formula:
where is the energy of the photon, is its frequency, and is Planck's constant.
This concludes that only photons with specific energies are emitted by the atom. The principle of the atomic emission spectrum explains the varied colors in neon signs, as well as chemical flame test results (described below).
The frequencies of light that an atom can emit are dependent on states the electrons can be in. When excited, an electron moves to a higher energy level or orbital. When the electron falls back to its ground level the light is emitted.
The above picture shows the visible light emission spectrum for hydrogen. If only a single atom of hydrogen were present, then only a single wavelength would be observed at a given instant. Several of the possible emissions are observed because the sample contains many hydrogen atoms that are in different initial energy states and reach different final energy states. These different combinations lead to simultaneous emissions at different wavelengths. | 7 | Physical Chemistry |
Dunne completed a Bachelor of Science and Master of Engineering degree from the Department of Mechanical Engineering, University of Bristol by 1989, and moved to the Department of Mechanical and Process Engineering, University of Sheffield, for a Doctor of Philosophy in Computer Aided Modelling of Creep-cyclic Plasticity Interaction in Engineering Materials and Structures. | 8 | Metallurgy |
The expectation value of a quantum mechanical observable represents the average value which would be measured after performing repeated measurements on an ensemble of identically prepared quantum states. Therefore, while we have been examining this expectation value as the principal object of interest, it is not clear to what extent this represents physically relevant quantities. As a result of quantum fluctuations, the expectation value of an observable is not typically what will be measured during one experiment on an isolated system. However, it has been shown that for an observable satisfying the ETH, quantum fluctuations in its expectation value will typically be of the same order of magnitude as the thermal fluctuations which would be predicted in a traditional microcanonical ensemble. This lends further credence to the idea that the ETH is the underlying mechanism responsible for the thermalization of isolated quantum systems. | 7 | Physical Chemistry |
The word ion was coined from neuter present participle of
Greek ἰέναι (ienai), meaning "to go". A cation is something that moves down (, kato, meaning "down") and an anion is something that moves up (, ano, meaning "up"). They are so called because ions move toward the electrode of opposite charge. This term was introduced (after a suggestion by the English polymath William Whewell) by English physicist and chemist Michael Faraday in 1834 for the then-unknown species that goes from one electrode to the other through an aqueous medium. Faraday did not know the nature of these species, but he knew that since metals dissolved into and entered a solution at one electrode and new metal came forth from a solution at the other electrode; that some kind of substance has moved through the solution in a current. This conveys matter from one place to the other. In correspondence with Faraday, Whewell also coined the words anode and cathode, as well as anion and cation as ions that are attracted to the respective electrodes.
Svante Arrhenius put forth, in his 1884 dissertation, the explanation of the fact that solid crystalline salts dissociate into paired charged particles when dissolved, for which he would win the 1903 Nobel Prize in Chemistry. Arrhenius explanation was that in forming a solution, the salt dissociates into Faradays ions, he proposed that ions formed even in the absence of an electric current. | 7 | Physical Chemistry |
An oil formulation consists of the base or stock oil and oil additives. Most oil formulations contain basic additives and detergents, designed to react with and neutralise acids, preventing damage to engine parts, including corrosion of metal surfaces. | 3 | Analytical Chemistry |
A mass spectrometer is typically utilized in one of two ways: full scan or selective ion monitoring (SIM). The typical GC–MS instrument is capable of performing both functions either individually or concomitantly, depending on the setup of the particular instrument.
The primary goal of instrument analysis is to quantify an amount of substance. This is done by comparing the relative concentrations among the atomic masses in the generated spectrum. Two kinds of analysis are possible, comparative and original. Comparative analysis essentially compares the given spectrum to a spectrum library to see if its characteristics are present for some sample in the library. This is best performed by a computer because there are a myriad of visual distortions that can take place due to variations in scale. Computers can also simultaneously correlate more data (such as the retention times identified by GC), to more accurately relate certain data. Deep learning was shown to lead to promising results in the identification of VOCs from raw GC–MS data.
Another method of analysis measures the peaks in relation to one another. In this method, the tallest peak is assigned 100% of the value, and the other peaks being assigned proportionate values. All values above 3% are assigned. The total mass of the unknown compound is normally indicated by the parent peak. The value of this parent peak can be used to fit with a chemical formula containing the various elements which are believed to be in the compound. The isotope pattern in the spectrum, which is unique for elements that have many natural isotopes, can also be used to identify the various elements present. Once a chemical formula has been matched to the spectrum, the molecular structure and bonding can be identified, and must be consistent with the characteristics recorded by GC–MS. Typically, this identification is done automatically by programs which come with the instrument, given a list of the elements which could be present in the sample.
A "full spectrum" analysis considers all the "peaks" within a spectrum. Conversely, selective ion monitoring (SIM) only monitors selected ions associated with a specific substance. This is done on the assumption that at a given retention time, a set of ions is characteristic of a certain compound. This is a fast and efficient analysis, especially if the analyst has previous information about a sample or is only looking for a few specific substances. When the amount of information collected about the ions in a given gas chromatographic peak decreases, the sensitivity of the analysis increases. So, SIM analysis allows for a smaller quantity of a compound to be detected and measured, but the degree of certainty about the identity of that compound is reduced. | 3 | Analytical Chemistry |
In 1962 racemic galanthamine and epi-galanthamine were prepared by organic reduction of racemic narwedine by D. H. R. Barton. Narwedine is the related enone (galanthamine the allyl alcohol) obtained in an oxidative coupling. Chemical yield: 1.4%. In addition they isolated (−)-narwardine by chiral resolution from a mixture of racemic narwedine and 0.5 equivalents of (+)-galanthamine. In this way they were able to obtain (−)galanthamine again by reduction
In 1976 Kametani obtained both galanthamine enantiomers by using a derivative of tartaric acid as a chiral resolving agent. In 1977 Koga obtained both enantiomers via a chiral pool synthesis starting from L-tyrosine and in 1988 Carrol optimized the oxidative coupling route to 11% yield based on isovanillin.
In 1989 Vlahov exploited asymmetric reduction by biocatalysis in the synthesis of several galanthamine precursors. and in 1994 Shieh & Carlson obtained (−)-galanthamine by spontaneous resolution of its narwedine precursor. Racemic narwedine was treated with 0.01 equivalent of (+)-galanthamine resulting in a 76% yield. Narwedine is a racemic conglomerate allowing the isolation of the S,S enantiomer from the R,R enantiomer by simple crystallization. What made the process unique is that both enantiomers are in dynamic chemical equilibrium with each other through a common phenol in a Michael reaction-like reaction brought about by triethylamine.
In 1999 Jordis performed (−)-galanthamine synthesis on a multikilogram scale based on Carrol chemistry and Shieh/Carlson chiral resolution. This would become the basis for current industrial production by Sanochemia (AT).
In 2000 Fels proposed an intramolecular Heck reaction for the construction of the galanthamine backbone and in the same year Trost & Toste obtained (−)-galanthamine in an asymmetric synthesis involving asymmetric allylic alkylation and an intramolecular Heck reaction. Improved methods were published in 2002 and 2005 (see below)
In 2004 Node obtained (−)-galanthamine via a remote asymmetric induction method with starting chiral compound D-phenylalanine. Brown prepared (−)-galanthamine in 2007 starting from isovanillin. Isovanillin was also used by Magnus (2009) D-glucose was used by Chida (2010).
Syntheses of racemic galanthamine have been reported by Wang in 2006 and by Saito in 2008. | 0 | Organic Chemistry |
In forensic science, evidence can become contaminated. Contamination of fingerprints, hair, skin, or DNA—from first responders or from sources not related to the ongoing investigation, such as family members or friends of the victim who are not suspects—can lead to wrongful convictions, mistrials, or dismissal of evidence. | 9 | Geochemistry |
The number of two-component systems present in a bacterial genome is highly correlated with genome size as well as ecological niche; bacteria that occupy niches with frequent environmental fluctuations possess more histidine kinases and response regulators. New two-component systems may arise by gene duplication or by lateral gene transfer, and the relative rates of each process vary dramatically across bacterial species. In most cases, response regulator genes are located in the same operon as their cognate histidine kinase; lateral gene transfers are more likely to preserve operon structure than gene duplications. The small number of two-component systems present in eukaryotes most likely arose by lateral gene transfer from endosymbiotic organelles; in particular, those present in plants likely derive from chloroplasts. | 1 | Biochemistry |
Exemestane is an oral steroidal aromatase inhibitor that is used in ER-positive breast cancer in addition to surgery and/or radiation in post-menopausal women.
The main source of estrogen is the ovaries in premenopausal women, while in post-menopausal women most of the body's estrogen is produced via the conversion of androgens into estrogen by the aromatase enzyme in the peripheral tissues (i.e. adipose tissue like that of the breast) and a number of sites in the brain. Estrogen is produced locally via the actions of the aromatase enzyme in these peripheral tissues where it acts locally. Any circulating estrogen in post-menopausal women as well as men is the result of estrogen escaping local metabolism and entering the circulatory system.
Exemestane is an irreversible, steroidal aromatase inactivator of type I, structurally related to the natural substrate 4-androstenedione. It acts as a false substrate for the aromatase enzyme, and is processed to an intermediate that binds irreversibly to the active site of the enzyme causing its inactivation, an effect also known as "suicide inhibition." By being structurally similar to enzyme targets, exemestane permanently binds to the enzymes, preventing them from converting androgen into estrogen.
Type II aromatase inhibitors such as anastrozole and letrozole, by contrast, are not steroids and work by interfering with the aromatase's heme.
A study conducted on young adult males found that the estrogen suppression rate for exemestane varied from 35% for estradiol (E2) to 70% for estrone (E1). | 4 | Stereochemistry |
Asemota has a long history of international consultancy in matters of food security and biotechnology. She was an international technical expert for the European Union (1994-1995), and served the United Nations Technical Cooperation among Developing Countries (TCDC) Programmes as International Technical Cooperation Programmes (TCP). She served as an International Biotechnology consultant to the United Nations Food and Agriculture Organisation from 2001. This included consulting for the International Technical Cooperation for Syria with the Developing Countries Programmes in 2001 and as technical lead on food sufficiency for the National Seed Potato Production Programme in the Republic of Tajikistan between 2003 and 2007. She periodically serves the UN-FAO Seed Production Programmes as an International Consultant. | 1 | Biochemistry |
The symmetry-imposed barrier heights of group transfer reactions can also be analyzed using correlation diagrams. A model reaction is the transfer of a pair of hydrogen atoms from ethane to perdeuterioethylene shown to the right.
The only conserved symmetry element in this reaction is the mirror plane through the center of the molecules as shown to the left.
The molecular orbitals of the system are constructed as symmetric and antisymmetric combinations of σ and σ C–H bonds in ethane and π and π bonds in the deutero-substituted ethene. Thus the lowest energy MO is the symmetric sum of the two C–H σ-bond (σ), followed by the antisymmetric sum (σ). The two highest energy MOs are formed from linear combinations of the σ antibonds – highest is the antisymmetric σ, preceded by the symmetric σ at a slightly lower energy. In the middle of the energetic scale are the two remaining MOs that are the π and π of ethene.
The full molecular orbital correlation diagram is constructed in by matching pairs of symmetric and asymmetric MOs of increasing total energy, as explained above. As can be seen in the adjacent diagram, as the bonding orbitals of the reactants exactly correlate with the bonding orbitals of the products, this reaction is not predicted to have a high electronic symmetry-imposed barrier. | 7 | Physical Chemistry |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.